HAYATI Journal of Biosciences March 2010 Available online at:

Vol. 17 No. 1, p 9-14 http://journal.ipb.ac.id/index.php/hayati

EISSN: 2086-4094 DOI: 10.4308/hjb.17.1.9

Phylogenetic Study of Mangifera laurina and its Related Species

Using cpDNA trnL-F Spacer Markers
FITMAWATI‡∗∗, ALEX HARTANA

Department of Biology, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University,
Darmaga Campus, Bogor 16680, Indonesia

Received January 30, 2009/Accepted February 25, 2010

Phylogenetic study of cpDNA intergenic spacer trnL-F of Mangifera laurina and their related species within
the genus Mangifera in Indonesia was conducted using Rutaceae as the outgroup. This study was to reconstruct
phylogenetic relationships and to understand infraspecific relationships within Mangifera based on cpDNA trnL-F
intergenic spacer sequences. The results showed that Mangifera sp. Hiku (mangga hiku) as the basic cultivar in
the clade, and it supported the monophyletic group in Mangifera. And phylogenetic construction indicated that
Mangifera sp. Hiku was the progenitor of M. laurina and their related species.

Key words: Mangifera laurina var. Hiku, phylogentic, cpDNA, trnL-F intergenic spacer, progenitor
___________________________________________________________________________

INTRODUCTION used on the phylogenetic studies at generic and specific

levels (Alejanro et al. 2005; Barfuss et al. 2005; Shaw et
Mangoes (Mangifera) have a high number of species. al. 2005). The cpDNA markers are commonly used in the
They are distributed in tropical and subtropical areas. One phylogetic studies because they are easily isolated,
of diversity centers of mangoes in the world is Indonesia. purified, characterized and cloned. The trnL-F region of
The latest revision of mangoes was described 68 species cpDNA is conservative with low rate evolution (Bayer et
of mangoes (Kostermans & Bompard 1993). However, the al. 2000).
delimination of M. laurina and its related species i.e. M. The trnL-F intergenic spacer of cpDNA is non coding
aplanata, M. indica, and M. rubropetala was still unclear characters, and this region is more variable than the coding
(Kochumen 1996). Mangoes have allotetraploid regions. Some studies on non coding region of cpDNA
chromosomes (2n=4x=40) and polyembrionic seed (Litz showed higher variations and more often mutation than
2004). And interspecific hybridization was commonly that of coding regions (Baldwin 1995). Accordingly, the
occurred among M. laurina and its related species. trnL-F intergenic spacer is a suitable parameter to
Therefore, their morphological plasticity was high and their investigate evolution relationship on the lower taxa (Bayer
species deliminations were various. Fruit morphology of et al. 2000). Therefore this study was analyzed and
Mangifera sp. Hiku (mangga hiku) is similar to M. indica reconstructed molecular phylogeny of M. laurina and its
but the characters were very sour, roughly fibrous, and related species based on cpDNA trnL-F transgenic spacer
the carpel is whitish yellow. The morphology characters sequences.
of mangga hiku were more primitive than that of other
Indonesian mangoes. MATERIALS AND METHODS
Mango classification based on molecular markers was
scarcely studied and there was limited information Leaf samples of six mangoes were collected from six
available on molecular phylogeny of mangoes. However, areas in Indonesia namely M. laurina Betul (mangga
the molecular phylogeny is important for classifying their betul) and M. aplanata (mangga depeh) from West
taxonomic status, maintaining and conserving their genetic Kalimantan, M. indica (mangga golek), and M. indica
diversity. (mangga kiyal) from East Java, M. laurina (mangga dodol
Some phylogeny studies of plants based on cp DNA ternate) from Maluku, and Mangifera sp. Hiku (mangga
markers were reported, such as in Morus ( Weiguo et al. hiku) from Sulawesi. And three species of Rutaceae were
2005) and Cucumis (Chung et al. 2006; Chung et al. 2007). chosed as the outgroup.
The cpDNA markers provided data for reconstructing the DNA Isolation. DNA was extracted using CTAB method
phylogeny among families of flowering plants (Kajita 1998). (Doyle & Doyle 1987) with modifications by soaking in
The sequences of trnL-F region of cpDNA are frequently
_________________
water bath at 65 oC over night. trnL-F intergenic spacer
‡
Current address: Department of Biology, Faculty of was amplified using E primer (GGTTCAAGTCCCTC
Mathematics and Natural Science, Riau University, Jalan H.R. TATCCC) and F primer (ATTTGAACTGGTGACACGAG)
Soebrantas 12.5 Km, Simpang Baru, Panam-Pekanbaru 28293, (Small et al. 2005). Amplification of trnL-F intergenic DNA
Riau, Indonesia
∗ spacer region used PCR machine (GeneAmp PCR system
Corresponding author. Phone/Fax: +62-761-63273,
E-mail: [email protected]
2400 Perkin Elmer) with 35 cycles. The pre PCR was set up
10 FITMAWATI AND HARTANA HAYATI J Biosci

at 95 oC for 4 minutes. Denaturation was set up at 94 oC for nucleotides. The sequence was consist of a total of 357 bp
30 seconds, annealing was at 52 oC 30 seconds, and constant characters, 7 bp non informative parsimony
extension was at 72 oC for 1 minute. And it was followed character, and 69 bp parsimony informative character. The
by post PCR at 72 oC for 7 minutes. average ratio of mango trnL-F DNA spacer nucleotides of
DNA Sequencing and Phylogenetic Analysis. PCR Adenine (A), Thymine (T), Cytosine (C) and Guanine (G)
products were sequenced using ABI 377 automated DNA was 0.3014, 0.3316, 0.206, and 0.1608 respectively; and the
sequencer (Applied Biosystems) at First BASE G+C content was 0.3668 indicating that the region was AT
Laboratories, Malaysia. The sequences were edited using rich (Tabel 1).
BioEdit 7.0.0.1 program, and then compared using The sequence region of cpDNA trnL-F M. laurina
BLASTN with DNA sequences of Guarea glabra, Citrus and its related species was descended from the sequence
sinensis, Citrus medica from GenBank database (http:// of Anacardiaceae, it had 91 and 94% similarity with Rhus
www.ncbi.nlm.nih.gov/BLAST/). Analysis of maximum caryophila and Pistacio weinmaniifolia respectively.
parsimony and likelihood was done using PAUP version Phylogenetic tree construction based on trnL-F region
4.0b8 with 1000 times bootstrap(Swofford 2000). had consistency Index Value (CI) of 0.9625 and resistance
index (RI) of 0.99 (Figure 1), while homoplasy index (HI)
RESULTS was 0.0375. This value showed that homoplasy was
occurred only 3.75%. Grouping confirmation of M. laurina,
The aligned length of trnL-F DNA spacer of six and their related species of 11 members of Rutaceae based
Mangifera species and three outgroup species was 433 on the size of trnL-F region of mangoes showed similarity

Tabel 1. Alignment of trnL-F DNA spacer sequences of six mangoes and their Outgroup
Vol. 17, 2010 Phylogenetic of Mangifera laurina 11

Tabel 1. Continue
12 FITMAWATI AND HARTANA HAYATI J Biosci

Tabel 1. Continue

Mbetul

Dternate

Golek

Miku

Depeh

Kiyal

0 0.001 0.002 0.003 0.004 0.005

Figure 2. Cladogram of six accession of mangoes based on trnL-F
421 (T-A) markers with Neighbor Joining method. Mbetul:
47 Mbetul Mangifera laurina cv. Betul, M. indica cv. Golek, Depeh:
44 189 (A-G)
Golek M. aplanata, Dternate: M. laurina cv. dodol ternate, M.
95 421 (C-G) indica cv. Kiyal, and M.laurina cv. Hiku.
Depeh
63
Dternate
100 431 (C-A)
Kiyal
5 (A-T) common ancestor. Mangga hiku (Mangifera sp.) from
Hiku
100 South East Sulawesi was located at the lowest of the clade
100 C_aurant and separated from the other species.
C_sinens While mangga dodol ternate (M. laurina) from Ternate
100 C_medica and mangga kiyal from East Java were located at the
Figure 1. Cladogram of six accession of mangoes and outgroup position of between mangga hiku and mangga betul. The
based on trnL-F markers. Mbetul: Mangifera laurina second clade was occupied by Chisocheton and Guerea,
cv. Betul; M. indica cv. Golek, Depeh: M. aplanata, while the third group by Citrus, with 100% bootstrap
Dternate: M. laurina cv. dodol ternate, M. indica cv.
values.
Kiyal; and M.laurina cv. Hiku.

DISCUSSION
with Rutaceae. Mangga dodol ternate (M. laurina) from
Ternate and mangga kiyal from East Java were located at Gaps within cpDNA occurred due to insertion and
the position of between mangga hiku and mangga betul. deletion process. Deletion of nucleotide on position
The second clade was occupied by Chisocheton and number of 2 and 59, and insertion of nucleotide on
Guerea, while the third group by Citrus, with bootstrap nucleotide number 5 and 431 (a→t) occurred in mangga
values 100%. hiku as an accession. While in mangga depeh (M.
The phylogenetic tree performed three branches of M. aplanata) accession, insertion occurred on nucleotide of
laurina and their related species (Figure 2). Mangifera 421 (c→g) and 431 (a→t) and in mangga golek (M. indica)
group was monophyletic or descended from the same accession on nucleotide of 431 (a→t). Mutation rate of
Vol. 17, 2010 Phylogenetic of Mangifera laurina 13

cpDNA sequence among and within species of M. laurina the morphology was descended from both parents and
is very low (<1%). Mutation in nucleotide levels can be affected by the environment. Therefore clustering
used to reconstruct a phylogenetic tree. Insertion and Analysis using cpDNA trnL-F of six accession i.e. mangga
deletion phenomena in mangga hiku (M. laurina) support betul (M. laurina), ‘Depeh’ (M. aplanata), ‘Golek’ (M.
formation of phylogenic branching within the ingroup indica), ‘Hiku’ (Mangifera sp.), ‘Dodol Ternate’ (M.
species. laurina), and ‘Kiyal’ (M. indica) did not agree to the
It was found that cpDNA nucleotide of mangga hiku clusters of morphological markers reported by Kostermans
was changed from Adenine to Thymine. While the other and Bompard (1993).
five species of Mangifera sp. were separated each other The markers of cpDNA trnL-F could be used to
because of their base was changed i.e. in mangga betul investigate the phylogenetic relationships of M. laurina
(M. laurina), nucleotide 421 of cpDNA, Thymine, was and their related species. Phylogenetic cluster of cpDNA
altered by Adenine, in mangga golek (M. indica) trnL-F markers may be different from those of
nucleotide 189 of cpDNA, Adenine, was altered by Guanine, morphological markers. M. laurina and their related
and in mangga depeh (M. aplanata) nucleotide 412 of species were clustered separately from the outgroup.
cpDNA, Adenine, was altered by Thymine. Mangga hiku was presumed as the common progenitor
Sequence tracing of cpDNA trnL-F nucleotides of of M. laurina and their related species.
mango accessions showed a high homology (99%). This
value was higher that the homology of 14 species of REFERENCES
Anacardiaceae family (75%) in the ITS-1 regions of the
nuclear genome (Hidayat & Pancoro 2001). The homology Alejandro GD, Razafimandimbison SG, Liede-Schumann S. 2005.
of trnL-F intergenic spacer sequence in M. laurina and Polyphily of Mussaenda inferred from ITS and trnT-F data
and its implications for generic limits in Mussaendeae
their related species was more conservative than that of (Rubiaceae). Am J Bot 92:544-557.
nuclear DNA and uniparentally inherited. However, Baldwin BG, Sanderson MJ, Porter JM, Wojeichowski MF, Cambell
nucleotide change could be used to estimate homology CS, Donoghue MJ. 1995. The ITS region of nuclear ribosomal
patterns of the cpDNA fragment (Raubeson & Jansen DNA: a valuable source of evidence an angiosperm phylogeny.
Annu Miss Bot Gard 82:247-277.
2005). This could also be used to analyze the relationships Barfuss MHJ, Samuel R, Till W, Stuessy TF. 2005. Phylogenetic
among progenies and patterns of gene mutation process relationships in subfamily Tillandsioideae (Bromeliaceae) based
in chloroplast genomes. Even though, cpDNA was on DNA sequence data from seven plastid regions. Am J Bot
commonly conservative, the diversity of cpDNA was 92:337-351.
Bayer RJB, Puttock CF, Kelchner SA. 2000. Phylogeny of South
reported occurred in different plant species such as African Gnaphilieae (Asteraceae) based on two-coding
Fagopyrum cymosum, Astragalus sp., Conifers and sequences. Am J Bot 87:259-272.
different species of Dipterocarpaceae (Tsumura et al. 1996; Chung SM, Gordon VS, Staub JE. 2007. Sequencing cucumber
Yamane et al. 2003; Liston 2008). Variations in cpDNA (Cucumis sativus L.) chloroplast genomes identifies
differences between chilling-tolerant and -susceptible cucumber
sequence was usually caused by mutation of single line. Genome 50:215-225.
nucleotide in long period of time. Mutation rate of cpDNA Chung SM, Staub JE, Chen JF. 2006. Molecular phylogeny of
loci was between 3.2 x 10-5 and 7.9 x 10-5 (Provan et al. Cucumis species as revealed by consensus chloroplast SSR
1999). Although nucleotide change in cpDNA was very marker length and sequence variation. Genome 49:219-229.
Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure for
little than that of in nuclear genome, it was highly valuable small quantities of fresh leaf tissue. Phytochem Bull 19:11-
to provide some information to explain the process of 15.
evolution. Fitmawati. 2006. Tinjauan Jenis Mangifera laurina dan kerabat
Based on Neighbor Joining Analysis (Saitou & Nei dekatnya. Floribunda 3:49-56.
Hidayat T, Pancoro A. 2001. Studi filogenetika molekuler
1987) (Figure 2), mangga hiku (Mangifera sp.) had the Anacardiaceae berdasarkan pada variasi urutan daerah internal
longest branch and occurred earlier than the others, so transcribe spacer. Hayati 8:98-101.
that mangga hiku could be presumed as a common Kajita T, Kamiya K, Nakamura K, Tachida H, Wickneswari R,
progenitor of M. laurina and each related species. The Tsumura Y, Yoshimaru H, Yamazaki T. 1998. Moleculer
phylogeny of Dipterocarpaceae in Southeast Asia based on
length of line indicated that the change of cpDNA nucleotide sequences of matK, trnL intron, and trnL-F IGS
sequence. Therefore, mangga hiku, which is still wild in Region in cpDNA. Mol Phylo Evol 10:202-209.
South East Sulawesi was more primitive than other Kochumen KM. 1996. Genus Mangifera from Sarawak. In: Tree
Indonesian cultivated mangoes. Flora of Sabah Sarawak. Forest Research Institute Serawak:
Sabah Forestry Department. p 32-36.
The clustering pattern of M. laurina and their related Kostermans AJGH, Bompart JM. 1993. The Mangoes Their Botany
species based on E-RAPD markers of nuclear DNA Nomenclature and Utilization. IBPGR: Acad Pr.
(Fitmawati 2006) showed similar pattern with the clustering Liston A, Parker-Defeniks M, Syring JV, Willyard A, Cronn R.
using trnL-F markers, except for mangga depeh (M. 2008. Interspecific phylogenetic analysis enhances
intraspecific phylogeographic inference: A case study in Pinus
aplanata) which was separated from their related species. lambertiana. Mol Ecol 186:12-30.
On the other hand, the clustering trnL-F intergenic spacer Litz RE. 2004. Biotechnology of Fruit and Nut Crops.
differed from that the clustering based on morphological Biotechnology in Agriculture Series N. 29. Tropical Research
markers, i.e. mangga Hiku was located together with M. and Education Center University of Florida USA. CABI
Publishing.
laurina. The diversity pattern of chloroplast markers can Provan J, Soranzo N, Wilson NJ, Goldstein DB, Powel W. 1999. A
be different from that of the morphological markers. low mutation rate for chloroplast microsatelites. Genetics
Chloroplast was inherited only by the female parent, while 153:943-947.
14 FITMAWATI AND HARTANA HAYATI J Biosci

Raubeson LA, Jansen RK. 2005. Chloroplast genomes of plant. Swofford DL. 2002. PAUP. Phylogenetic Analysis Using
In: Henry RJ (ed). Plant Diversity and Evolution: Genotypic Parsimony (And Other Methods). Version 4. Sinauer Associates,
and Phenotypic Variation in Higher Plants. Massachusets, Sunderland, Massachusetts, USA.
Cambrigde, USA CABI Publ. p 332. Tsumara Y, Kawahara T, Wickenswari R, Yoshimura K. 1996.
Saitou N, Nei M. 1987. The neighbor-joining method: a new Molecular phylogeny of Dipterocarpaceae of conifer using
method for reconstructing phylogenetic trees. Mol Biol Evol RFLP analysis of PCR-amplified specific chloroplast genes.
4:406-425. Theor Appl Genet 91:1222-1236.
Shaw J, Kelchner SA, Lickey EB, Beck JT, Farmer SB, Liu W, Weiguo Z, Yile P, Shihai ZZJ, Xuexia M, Yongping H. 2005.
Miller J, Siripun KC, Winder CT, Schilling EE, Small RL. Phylogeny of the Morus (Urticales: Moraceae) inferred
2005. The tortoise and the hare ii: Relative utility of 21 from ITS and trnL-F sequences. Af J Biotechnol 4:563-
noncoding chloroplast DNA sequences for phylogenetic 569.
analysis. Am J Bot 92:142-166. Yamane K, Yasui Y, Ohmishi O. 2003. Intraspecific cpDNA
Small LR, Lickey EB, Shaw J, Hauk WD. 2005. Amplification of variation of diploid and tetraploid perennial buckwheat,
non coding chloroplast DNA for phylogenetic studies in Fagopyrum cymosum (Poligonaceae). Am J Bot 90:339-
Lycophytes and Monilophytes with a comparative example 346.
of relative phylogenetic utility from Ophioglossaceae. Mol
Phylo Evol 36:509-522.