Applied Microbiology and Biotechnology

https://doi.org/10.1007/s00253-020-10570-7

APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY

Histoplasma capsulatum 100-kilodalton antigen: recombinant

production, characterization, and evaluation of its possible
application in the diagnosis of histoplasmosis
María A. Toscanini 1 & Daniel González Maglio 2,3 & Paula Capece 4 & Gladys Posse 4 & Cristina A. Iovannitti 5 &
Alejandro D. Nusblat 1 & María L. Cuestas 5

Received: 23 December 2019 / Revised: 11 March 2020 / Accepted: 20 March 2020

# Springer-Verlag GmbH Germany, part of Springer Nature 2020

Abstract
The goal of the present work was to develop a novel reagent with potential for histoplasmosis diagnosis. For this purpose, the
genetic sequence of the 100 kDa protein of Histoplasma capsulatum (Hcp100) was cloned and expressed as a secretory protein in
Pichia pastoris. After optimizing the culture conditions and purifying by immobilized metal ion affinity chromatography, the
highest yield of Hcp100 reached approximately 1.3 mg/l with > 90% purity in shake flasks using basal salt medium supplemented
with casamino acids after 72 h of methanol induction. To investigate its potential for diagnosis, its detection in urine samples
using specific polyclonal antibodies as reagent was evaluated by dot blot in 6 patients with progressive disseminated histoplas-
mosis (PDH), of whom all had AIDS. Antigen was detected in urine from all 6 (100%) PDH patients. Urine samples from a pool
of 20 healthy individuals did not react with the anti-Hcp100 antibodies. The dot blot assay performed in this study provides
preliminary data of a simple technology that can be performed in medical institutions with limited resources to facilitate the rapid
diagnosis of histoplasmosis, particularly the disseminated forms. Hence, use of these assays may provide a rapid diagnostic tool
of PDH in endemic areas for histoplasmosis where PDH-related mortality is high, hastening treatment and improving patient
survival. Finally, this novel antigen and its specific antibodies may provide an alternative diagnostic reagent to the largely
unknown and poorly characterized polysaccharide antigens (HPA, galactomannan, histoplasmin) frequently used in the diag-
nostic tests.

Key Points
& Few antigens are used as laboratory tools for the immunodiagnosis of histoplasmosis.
& P. pastoris was an excellent system for recombinant Hcp100 expression.
& Maximum expression levels of rHcp100 were achieved in BSM with 1% casamino acids.
& Dot blot assays with anti-rHcp100 antisera can be successfully used for diagnosing PHD.

Keywords Histoplasma capsulatum . Recombinant Hcp100 . Pichia pastoris . Antibodies anti-rHcp100 . Diagnosis . Casamino
acids

Electronic supplementary material The online version of this article (https://doi.org/10.1007/s00253-020-10570-7) contains supplementary material,
which is available to authorized users.

* María L. Cuestas
[email protected]

1
Facultad de Farmacia y Bioquímica. Instituto de Nanobiotecnología (NANOBIOTEC), Universidad de Buenos Aires, Buenos Aires, Argentina
2
Facultad de Farmacia y Bioquímica. Cátedra de Inmunología, Universidad de Buenos Aires, Buenos Aires, Argentina
3
Instituto de Estudios de la Inmunidad Humoral (IDEHU), CONICET-Universidad de Buenos Aires, Buenos Aires, Argentina
4
Laboratorio de Micología. Hospital Nacional Profesor Alejandro Posadas, Buenos Aires, Argentina
5
Instituto de Investigaciones en Microbiología y Parasitología Médica (IMPaM), Universidad de Buenos Aires. CONICET, Buenos Aires, Argentina
 Appl Microbiol Biotechnol

Introduction few laboratories perform antigen assays, which have a high

sensitivity in cases of PHD and great value for the follow-up
Histoplasmosis, the most common endemic mycosis in cer- of patients with histoplasmosis. Aspergillus galactomannan
tain areas of North and Latin America, is an opportunistic detection (cross-reactivity during histoplasmosis) is not
fungal infection caused by the dimorphic fungus used as a standard of care, although some authors have sug-
Histoplasma capsulatum (Wheat et al. 2016). As a deep gested its use as an adjunctive test for the diagnosis of his-
mycosis, it has been added to the neglected tropical diseases toplasmosis when other non-invasive tests are unavailable
portfolio by the World Health Organization (WHO) in 2017 (Riviére et al. 2012).
(WHO 2017). Only few antigens are currently used as diagnostic tools,
Clinical manifestations of this disease range from a self- the H, M, and C antigens released into histoplasmin during
limited or subclinical form of infection to acute symptomatic growth and autolysis of the mycelial form, which are par-
or progressive life-threatening disseminated forms, depending ticularly useful for detecting specific antibodies against
on the size of the inoculum, age, and immune status of the H. capsulatum, and the H. capsulatum polysaccharide anti-
infected individual (Miller et al. 2013). gen (HPA), whose detection in body fluids, especially urine,
Although HIV infection is the most attributable risk factor has been helpful in the presumptive diagnosis of PHD. The
for progressive disseminated histoplasmosis (PDH), reason H antigen is a β-glucosidase, the M antigen is a catalase,
for which it was considered an AIDS-defining infection in and the C antigen is a heat-stable cross-reactive
1987 (Adenis et al. 2014), immunosuppressive agents used galactomannan polysaccharide shared by the major genera
in solid organ transplant recipients or in chronic inflammatory of primary systemic dimorphic fungal pathogens
systemic diseases also contribute to the risk of the disseminat- (Guimaraes et al. 2006). Precipitins against H and M
ed form of the disease (Oladele et al. 2018). In Latin America, exoantigens are the basis for immunodiagnosis of histoplas-
approximately 30% of HIV/AIDS patients diagnosed with mosis. However, the broad application of these antigens is
PHD die from it, ranking probably on the top of the list of limited by their low sensitivity and specificity, particularly
AIDS-defining illnesses and AIDS-related deaths (Colombo in those with acute disease or underlying immunosuppres-
et al. 2011). Early diagnosis of PDH is thus needed to initiate a sive disorders, and current methods for their production are
prompt treatment due to its high-related mortality (Nacher problematic in terms of repeatability, reproducibility, spec-
et al. 2013). ificity, stability, and standardization (de Freitas et al. 2018).
It is widely accepted that definitive diagnosis of histo- In addition, false-positive results due to serologic cross-
plasmosis is performed by isolation of H. capsulatum on reactions to Histoplasma-like antigens may occur in pa-
specific media or by histopathology using specific fungal tients with blastomycosis, coccidioidomycosis,
staining techniques. However, these procedures are insen- paracoccidioidomycosis, aspergillosis, candidiasis, and
sitive, may require invasive medical procedures to obtain cryptococcosis (Guimaraes et al. 2006). On the other hand,
tissues, and cultures are time-consuming, since they often Histoplasma antigen detection has proven to be the most
take up 3 to 6 weeks to reveal fungal growth and require sensitive and specific assay for the rapid diagnosis of histo-
biosafety level 3 laboratory (Falci et al. 2017; de Freitas plasmosis in those patients with the disseminated forms of
et al. 2018). In addition, staining of histological sections the disease and for monitoring the effect of antifungal ther-
reveals fungal elements, but identification is sometimes dif- apy (Wheat et al. 2002). Unfortunately, the main limitation
ficult due to similarities in the appearance of yeast belong- for antigen detection assays is their unavailability in many
ing to several dimorphic fungal species. In recent years, parts of the world, including regions of Central and South
studies involving a variety of non-culture-based diagnostic America where histoplasmosis is endemic. Other limita-
tests have been published in the literature (Srinivasan et al. tions include the detection of a largely uncharacterized an-
2009; Dantas et al. 2013; Caceres et al. 2014; Cunningham tigen (HPA) and difficulties in reproducibility in generating
et al. 2015; Theel et al. 2015; Gajurel et al. 2018). The use of specific antibodies for use in immunoassays (Lindsley et al.
serological assays has played an important role in the diag- 2007).
nosis of histoplasmosis, but its sensitivity depends on the Thus, there is a need to develop new affordable diagnostic
immunity of patients and the stage and type of disease. assays especially for low-/middle-income countries and to
Furthermore, the use of antibody detection for the follow- look for new antigen candidates for diagnosis as well as for
up of patients is problematic since specific antibody titers the follow-up of patients. In order to achieve standardized,
remain elevated months or even years after successful ther- reproducible, and specific whole antigen preparations to avoid
apy. The standard serological assays are the complement expression variations among H. capsulatum isolates or insta-
fixation and double immunodiffusion (ID), but immuno- bility expression as it occurs with the expression of M antigen
blotting may also be used (Kauffman 2007; de Freitas by good producer strains (Guedes et al. 2003), the use of DNA
et al. 2009; Dantas et al. 2014; Almeida et al. 2016). Only recombinant technology for the production of recombinant
Appl Microbiol Biotechnol

proteins would be a step forward not only in the diagnosis and Recombinant Hcp100 production
prognosis of histoplasmosis but also in other structural and in the methylotrophic yeast P. pastoris
biological studies, such as the structure-based rational drug
design. Media composition
The fungal protein of 100 kDa of H. capsulatum (Hcp100),
a member of the p100 kDa family, is a regulatory protein that P. pastoris growth on solid medium was carried out at 30 ±
plays an essential role to establish a successful infection (Porta 1 °C using YPD (yeast extract, peptone, dextrose) medium.
et al. 1999). It may be involved in the processes required for BMGY/BMMY (buffered glycerol or methanol complex me-
fungal adaptation and survival inside the macrophages dium), BMG/BMM (buffered minimal glycerol or methanol
(Colonna-Romano et al. 1998). A 210-bp nucleotide sequence medium), MGY/MM (minimal glycerol or methanol medi-
of the Hcp100 gene has proved to be an excellent target for um), and YPD/BSM (basal salt medium supplemented with
H. capsulatum molecular detection and identification in clin- trace metal solution, biotin, and 1% glycerol) were used for
ical samples (Bialek et al. 2002). Hcp100 was also proposed small-scale expression of the recombinant protein (rHcp100)
by many mycologists as a novel therapeutic target for histo- in 250-ml shake flasks and were prepared as previously de-
plasmosis treatment (González-González et al. 2012). Little is scribed (Xiao et al. 2006; EasySelect™ Pichia Expression
known about the presence of orthologues in other related mi- Manual 2010).
croorganisms, its structure, and the presence of antigenic sites.
The goal of the present work was to develop new reagents Construction of recombinant Pichia strains
to help diagnose histoplasmosis, particularly the disseminated
form of the disease. For this purpose, bioinformatic analysis The complete DNA sequence of Hcp100 (UniProtKB -
was first performed to infer orthology relations with other O60040) was codon optimized for yeast expression as a His-
systemic endemic fungus and other closely related species that tagged protein in P. pastoris (GenBank MN264669), synthe-
produce clinically similar diseases and to predict putative an- sized, and cloned into the pPICZα A Pichia expression vector
tigenic sites. Then, extracellular expression of soluble recom- (Life Technologies Inc., USA) by GenScript (USA). A stop
binant Hcp100 (rHcp100) was efficiently achieved in a Mut+ codon and a 6xHis-tag were included so as to express Hcp100
strain of Pichia pastoris X-33 via a strategy combining medi- without the c-Myc epitope containing the polyhistidine tag in
um optimization and proteolytic degradation circumvention. the expression vector. The constructs were checked by en-
The purification of rHcp100 was performed by a short process zyme digestion and sequencing. Linearized pPICZα A-
consisting of one step of ultrafiltration followed by Hcp100 using SacI was transformed into P. pastoris X-33
immobilized metal ion affinity chromatography (IMAC). strain by electroporation. Briefly, 80 μl of electrocompetent
Finally, the applicability and efficacy of rHcp100 and their X-33 cells was mixed with 10 μg of linearized Hcp100 ex-
specific antibodies as diagnostic reagents in the histoplasmo- pression plasmid in a 0.2-cm cuvette and pushed on the BTX
sis immunodiagnosis were also evaluated. ECM-630 electroporator (Harvard Apparatus Inc., USA). The
push parameters were 1.5 kV/cm, 50 μF, and 200 Ω.
Transformants were then spread onto YPD plates contain-
ing 1 M sorbitol and 100 μg/ml Zeocin™ (Life Technologies
Materials and methods Inc.).

Bioinformatic analysis Analysis of Pichia integrants

Similar sequences of Hcp100 retrieved from the National The recombinant transformants were cultured on minimal
Center of Biotechnology Information using tblastn tool and methanol (MM) and minimal dextrose (MD) plates to differ-
GBID CAA06786.1 as query were compared to infer entiate Mut+ from MutS phenotypes. The genomic DNA was
orthology relations using the OrthoMCL and OMA orthology isolated from the transformants as described in the EasySelect
databases. Secondary structure predictions were performed Pichia expression kit (Life Technologies Inc.) and analyzed
with JPRED 4 server. The tertiary structure of Hcp100 was for the presence of the Hcp100 gene using the primers
predicted using the I-TASSER de novo modelling Standalone flanking the recombination site (5´ AOX1: 5′GACTGGTT
Suite method, which consists of consecutive steps of CCAATTGACAAGC 3′ and 3′ AOX1: 5′ GCAAATGG
threading, fragment assembly, and interaction to obtain the CATTCGACATCC 3′), and three additional primer pairs to
structure with the lowest energy, as described previously amplify different regions of Hcp100 so as to assess the pres-
(Yang et al. 2015) using individual I-TASSER queries and ence of its complete gene sequence. According to this, the N-
each visualized with the program DeepView (Swiss Pdb- terminal region was amplified using 5′AOX1 and 3′Hcp100
Viewer, Kaplan and Littlejohn 2001). N-terminal reverse (Hcp100 NT-rev: 5′ CAGTAGAA
 Appl Microbiol Biotechnol

GCCCAAACACCCT 3′), the middle region of the gene was samples were filtrated on 5-μ and a 0.45-μ filters and were
amplified using the primers Hcp100 middle forward and re- subjected to ultrafiltration through 10,000 NMWC (nomi-
verse (Hcp100 MID-Fwd: 5′ TTGAGACAAGCTGA nal weight cutoff) hollow fibers (GE Healthcare, UK). After
GAACGC 3′; Hcp100 MID-Rev: 5′CAGCAACAACTCAG concentration, samples were resuspended in binding buffer
CAGCG 3′), and the C-terminal region was amplified using (20 mM sodium phosphate, 0.5 M NaCl, 10 mM imidazole,
the primers Hcp100 C-terminal forward (Hcp100 CT-Fwd: 5′ pH = 7.4) and loaded onto a column containing Ni-NTA
GGTAAAAACGGTGCTGAGGC 3′) and 3′AOX1. The agarose (QIAGEN) equilibrated with 5 column volumes of
resulting amplicon sizes were approximately 3.3 kb with binding buffer. Column-bound proteins were washed 10
primers 5′AOX1 and 3′AOX1, 800 bp with primers 5′AOX1 times with washing buffer (20 mM sodium phosphate,
and Hcp100 NT-rev, 900 bp with primers Hcp100 MID-Fwd 0.5 M NaCl, 20 mM imidazole, pH = 7.4) and elution was
and Hcp100 MID-Rev, and 900 bp with primers Hcp100 CT- performed using 5 column volumes of elution buffer
Fwd and 3′AOX1. (20 mM sodium phosphate, 0.5 M NaCl, 100 to 500 mM
Genomic DNA from recombinant P. pastoris transformed imidazole, pH = 7.4).
with plasmid pPICZα A_Hcp100, or P. pastoris X-33, was The protein concentration in the purified product was esti-
used as positive and negative controls, for PCR, respectively. mated with the BioRad protein assay kit (BioRad Laboratories
Inc., USA) and purity was evaluated by SDS-PAGE and
Expression of Hcp100 gene Western blot.

The recombinant strains of P. pastoris were grown in 250- SDS-PAGE, Western blot, and mass spectrometry
ml Erlenmeyer flasks containing 25 ml of BMGY, BMG, analysis
MGY, or YPD at 30 ± 1 °C with constant shaking (200–
250 rpm). When cultures reached an OD600 of 1–15, cells Samples were resolved on 8% polyacrylamide gel under re-
were harvested and re-suspended to an OD600 of 1 in 50 ml ducing conditions in the presence of dithiothreitol (DTT) at
of BMMY, BMM, MM, and BSM, respectively, to induce 110 V. Then, proteins were stained with Coomassie brilliant
expression with and without 1X protease inhibitor cocktail blue (R-250) or were transferred electrophoretically onto ni-
(104 mM AEBSF, 80 μM aprotinin, 4 mM bestatin, 1.4 mM trocellulose membranes. Membranes were blocked with 3%
E-64, 2 mM leupeptin, and 1.5 mM pepstatin A, Sigma- (w/v) dried non-fat milk in TBS containing 0.05% Tween 20
Aldrich) and/or 1% casamino acids. Then, 100% (v/v) and with mouse anti-6xHis monoclonal antibody (BD-
methanol to a final concentration of 1% (v/v) was added Biosciences, USA) diluted 1:3000 in TBS containing 0.05%
every 24 h during 3 days to maintain induction, in shaking Tween 20 and 1.5% (w/v) dried non-fat milk (TBS/Tween/
incubator (200–250 rpm) at 30 ± 1 °C. At times 0, 16, 24, non-fat milk). Goat anti-mouse IgG horseradish peroxidase
48, and 72 h, 5 ml of the induction, cultures were sampled conjugate (Jackson Immunoresearch Laboratories, USA) di-
and centrifuged at 3000g for 5 min at 4 °C and the resulting luted 1:5000 in TBS/Tween/non-fat milk was used as the sec-
culture supernatants and cell pellets were analyzed by 8% ondary antibody. Bands were visualized by using the ECL-
SDS-polyacrylamide gel electrophoresis (SDS-PAGE) Plus detection kit (GE Healthcare Life sciences, USA), ac-
stained with Coomassie brilliant blue R250 and by cording to the kit instructions and recorded with the
Western blot. To perform these analytical methods, cell su- VisionWorks® Image Acquisition and Analysis Software
pernatants were previously concentrated by ultrafiltration (Analytik Jena, USA).
using an Amicon® Ultra 10K device (10,000 MWCO; For protein analysis by nanoliquid chromatography
EMD-Millipore, USA), and cell pellets were resuspended (nanoLC)/mass spectrometry (MS), SDS-PAGE bands stained
in breaking buffer (50 mM sodium phosphate, pH 7.4; with colloidal Coomassie brilliant blue (G-250) were ana-
1 mM PMSF; 1 mM EDTA, 5% glycerol) to an OD600 of lyzed. The 100 kDa and two bands of approximately 78 kDa
80, disrupted using acid-washed 0.5-mm glass beads and 50 kDa that appeared in all unpurified recombinant Pichia
(Sigma-Aldrich), and centrifuged at 12,000g for 10 min at clones transformed with the vector containing the Hcp100
4 °C. gene but absent in the control clones were excised from the
Throughout the induction phase, temperature was main- polyacrylamide gel and were treated to obtain tryptic peptides.
tained at 30 ± 1 °C and pH values were determined on-line These peptidic samples were then separated by reversed-phase
using a pH electrode (ADWA AD1030, Hungary). chromatography via an Accucore™ Easy-Spray C18 analyti-
cal column (ThermoFisher Scientific, USA) coupled to an
Purification of rHcp100 EASY-nLC™ 1000 system at 35 °C and 3.5 kV. Peptides were
loaded onto the column with buffer A (0.1% formic acid in
The cell culture supernatants obtained as described above water) and eluted with 75 min linear gradient from 7 to 95%
were stabilized with 1 mM PMSF and 1 mM EDTA. Then, buffer B (0.1% formic acid in acetonitrile). The mass spectra
Appl Microbiol Biotechnol

were acquired in an Orbitrap nLC/MS. Data analysis was 48 h later after staining the slides with Coomassie blue, as
performed using the Thermo Proteome Discoverer program described previously (Carvalho et al. 2008).
(ThermoFisher Scientific).
Antigen detection in urinary samples

Serological tests Urine specimens from 6 patients with PHD were studied. All
of them had also AIDS. The diagnosis of all the individuals
In order to assess the immunoreactivity of rHcp100 against was confirmed either by cultural identification of
specific antibodies, a dot blot assay was carried out. Briefly, H. capsulatum or by direct identification of intracellular yeast
200 ng of the purified sample of rHcp100 as well as 400 ng of cells in samples from the patients. Twenty urine samples from
histoplasmin, paracoccidioidin, and coccidioidin was spotted healthy volunteers from areas where histoplasmosis is endem-
onto a nitrocellulose membrane. After blocking with 5% (w/v) ic were pooled and included as negative controls. All urines
dried non-fat milk in TBS containing 0.05% Tween 20, mem- were aliquoted and stored at − 20 °C until use.
branes were incubated first with 1:100 to 1:312,500 dilution of Dot blots assays were performed spotting 1 μl of urine
antisera collected from immunized rabbits diluted in TBS/ samples onto nitrocellulose membranes. Then, membranes
Tween/non-fat milk and then with mouse anti-rabbit IgG were left to dry at room temperature during 15 min and
horseradish peroxidase conjugate (Jackson Immunoresearch blocked with 5% (w/v) dried non-fat milk in TBS containing
Laboratories, USA) diluted 1:3000 in TBS/Tween/non-fat 0.05% Tween 20 during 1 h at room temperature. After this,
milk as the secondary antibody. Dots were visualized by using membranes were incubated first with 1:1000 dilution of anti-
the ECL-Plus detection kit and recorded with the rHcp100 mice antisera in TBS/Tween/non-fat milk and then
VisionWorks® Image Acquisition and Analysis Software with goat anti-mouse IgG horseradish peroxidase conjugate
(Analytik Jena, USA). (Jackson Immunoresearch Laboratories, USA) diluted
In all serological tests, histoplasmin prepared at Instituto 1:5000 in TBS/Tween/non-fat milk as the secondary antibody.
de Investigaciones en Microbiología y Parasitología Dots were visualized by using the ECL-Plus detection kit and
Médica (IMPaM, UBA-CONICET), Facultad de Medicina, recorded with the VisionWorks® Image Acquisition and
Universidad de Buenos Aires, as previously described Analysis Software (Analytik Jena, USA).
(Negroni et al. 1998) was used as a positive control antigen
for H. capsulatum. Paracoccidioidin, coccidioidin, and rab-
bit antisera against H. capsulatum, Paracoccidioides Results
brasiliensis, and Coccidioides immitis were kindly given
by Servicio de Micosis Profundas, Departamento de Hcp100 is a member of the Tudor-SN p100 proteins
Micología, INEI-ANLIS Dr. Carlos G. Malbrán, Buenos distributed in the eukaryotic kingdom
Aires, Argentina.
Mouse antiserum against rHcp100 was obtained at Instituto Hcp100 is a Tudor-SN protein of 890 amino acids, which
de Estudios de la Inmunidad Humoral Prof. Dr. Ricardo contains four staphylococcal nuclease (SNase)-like do-
Margni, Facultad de Farmacia y Bioquímica, Universidad mains at the N-terminus and a shorter SNase-like domain
de Buenos Aires. Briefly, 8-week-old female BALB/c mice and one Tudor domain at the C-terminus (Fig. 1a). The
(n = 5) were immunized subcutaneously with 5 μg of Tudor-SN proteins (p100, SND1) have been identified and
rHcp100 in 50 μl of PBS mixed with an equal volume of studied in different organisms such as metazoan (Homo
Freund’s complete (first immunization) or incomplete s a p i e ns , B o s ta u r u s , D ro s o p hi l a m e l a no g as t e r) ,
(boosts) adjuvant. Immunizations were performed on days 1, apicomplexas (Plasmodium falciparum), and fungi
15, 29, and 43. One week after the last immunization, blood (H. capsulatum). To examine the distribution in other line-
samples were taken and centrifuged for 10 min at 10,000 rpm. ages across the tree of life, a search of orthologs among
After evaluation of reactivity, sera from the 5 animals were complete genomes at the OMA database and among refer-
pooled in a single antiserum. ence proteomes at UniProtKB was performed. As shown in
Serum from a patient with chronic histoplasmosis as well Fig. 1b, the Tudor-SN protein is widespread in the mayor
as sera from a healthy blood donor was obtained from IMPaM eukaryotic lineages including amoebozoa, opisthokonts,
(UBA-CONICET) and was used as a preliminar test using SAR (stramenopiles, alveolates, rhizaria), archaeplastids,
rHcp100 for ID assays. ID assays were performed on micro- and excavates. The phylogenetic analysis grouped the
scopic slides covered with a layer of 1% noble agar in isotonic Hcp100 protein into a well-defined monophyletic branch
saline solution balanced with phosphates at pH 7.0, plus 6000 together with other p100 proteins from different fungal phy-
polyethylene glycol and phenol 0.3%. The presence of precip- la. Conversely, no orthologs were retrieved from eubacteria
itation bands for the antigen-antibody reaction was checked and archaea kingdoms. This distribution showed to be
 Appl Microbiol Biotechnol

Fig. 1 a Schematic representation of the Tudor-SN protein Hcp100 of 100 bootstraps. The model LG+I+G for the MSA was selected using
Histoplasma capsulatum. Four staphylococcal nuclease-like domains Prottest 3.0 server. c Orthology analysis showed that the M and H anti-
(SNase) of ~ 150 amino acids each, a shorter SNase-like domain of ~ gens are present in several species of fungi and bacteria, while Hcp100
100 amino acids, and one Tudor domain (T) are depicted. b Phylogenetic has no orthologs in those bacteria that produce similar clinical and radio-
analysis of Tudor-SN proteins. For phylogenetic analyses, muscle with graphic manifestations to those observed in histoplasmosis. d Predicted
default parameters was used to obtain datasets of multiple alignments 3D structure of Hcp100 obtained with I-TASSER showing SNase-like
(MSA). This MSA was used to construct the phylogeny by maximum and Tudor domains (blue and red) on the left and putative B cell epitopes
likelihood using PhyML 3.0 optimized by SPR and NNI and a support of (conformational in yellow and linear in green) on the right

different from the M and H proteins (used in the diagnostic Expression, culture optimization, and purification
of histoplasmosis) which are present in many bacterial lin- of rHcp100 in P. pastoris
eages, including those that produce similar clinical and ra-
diographic manifestations. These results suggest that this For expression of rHcp100, the Hcp100 gene was synthesized
novel candidate could be more effective for diagnosis by GenScript and cloned downstream of the AOX1 promoter
(Fig. 1c). Figure 1d shows putative B cell epitopes that of pPICZα A plasmid. The linearized pPICZα A-Hcp100
could be recognized for the adaptive immune system to vector was introduced into X-33 P. pastoris cells and clones
produce highly selective antibodies to be used in resistant to zeocin were selected. PCR analysis of
immunodiagnosis. transformants confirmed that Hcp100 gene was entirely
Appl Microbiol Biotechnol

integrated into the P. pastoris genome (Fig. 2a). After In order to optimize the expression of rHcp100, the effect
confirming the Mut+ (capable of efficient methanol utilization of using different culture media, with and without the addition
and fast growing) phenotype (Fig. 2b), the expression of the of protease inhibitors and casamino acids, were analyzed
Hcp100 protein, carried out in BMMY media, showed that (Fig. 3a–h). As it is shown in Fig. 3a, b, degradation of
protein expressed in this culture medium was degraded in- rHcp100 was observed in BMMY either supplemented or
creasingly after 24 h of induction (Fig. 2c). In contrast, not with protease inhibitors and casamino acids. The disap-
rHcp100 was not detectable in cell pellets at any time (data pearance of rHcp100 was also observed during its expression
not shown). in BMM and MM either in the presence or not of protease
Analysis of the differential expression proteins from super- inhibitors and casamino acids (Fig. 3c–f) and in BSM non-
natants between P. pastoris X-33 wild-type and recombinant supplemented with protease inhibitors and casamino acids
strains showed three prominent bands (Fig. 2c, d). The 100- (Fig. 3g). However, high levels of rHcp100 expression with-
kDa and 50-kDa bands identified peptide sequences from out proteolytic degradation at the different times of induction
Hcp100, thus confirming that the 50-kDa band was a conse- were achieved when the culture medium was BSM supple-
quence of proteolytic degradation of rHcp100. The mass spec- mented with protease inhibitors and casamino acids (Fig. 3h).
tra of other 78-kDa band revealed its identity with an ATPasa However, when it was assessed whether such effect was a
involved in protein import into the endoplasmic reticulum that combination of both proteolytic degradation inhibitors or a
also acts as a chaperone to mediate protein folding. solely contribution of one of them, it was shown that the

Fig. 2 Hcp100 expression of P. pastoris transformants. a Genotype of medium (MM) agar plates for 48 h. All clones grow as the same rate as
five transformants (1–5) was analyzed performing a colony PCR using the X-33 strain, suggesting that all were phenotype Mut+ (methanol uti-
four sets of primers that amplified the N-terminal (5′AOX + Hcp100NT), lization plus). c, d Cell culture supernatants P. pastoris X-33 strain and
middle (Hcp100MID Fw + Rv), and C-terminal (Hc100CT Fw + 3′AOX) transformant Hcp100_1 collected at different time points of induction
regions of the Hcp100 gene sequence and the AOX1 and Hcp100 com- were analyzed by 8% SDS-PAGE following Coomassie blue R250 stain-
plete genes (5′AOX + 3′AOX). Four out of five clones were positive for ing (c) and Western blot (d) with anti-histidine antibodies. A band of the
all amplification reactions. Plasmid pPICZα A_Hcp100 (pl) and expected size was observed in the supernatants at 24, 48, and 72 h of
P. pastoris X-33 strain (X33) were used as positive and negative controls, methanol induction with the highest expression level at 24 h of induction.
respectively. b Phenotype was analyzed by growing the five clones and Also, a lower molecular weight band was observed at 48 and 72 h of
the X-33 strain in minimal dextrose medium (MD) and minimal methanol induction, probably due to degradation processes
 Appl Microbiol Biotechnol

Fig. 3 Effect of protease inhibitors in rHcp100 expression. Hcp100 BSM (g, h) in absence or presence (+Inh) of protease inhibitors was
expression profile in cell culture supernatant at 0, 16, 24, 48, and 72 h evaluated by Western blot. Addition of protease inhibitors in BSM
of methanol induction in BMMY (a, b), BMM (c, d), MM (e, f), and prevent Hcp100 degradation

protective proteolytic effect was achieved only with casamino paracoccidioidin, leading rHcp100 as a more feasible marker
acids (data not shown). Thus, the maximum expression level for diagnosis. The performance of rHcp100 was also assayed
of rHcp100 was achieved in BSM supplemented with 1% using serum from a patient with chronic histoplasmosis and
casamino acids at 72 h post-induction with methanol. Under serum from a healthy blood donor by ID as a preliminar step
these conditions, a purification yield of rHcp100 reached ap- for its use in indirect diagnosis (Fig. 5b). In all cases, results
proximately 1.3 mg/l with 93.6% purity (Fig. 4a, b). were compared with that obtained with histoplasmin (Fig. 5c).
As it is shown in Fig. 5b, c, anti-H. capsulatum antibodies
from a patient with chronic histoplasmosis were immunoreac-
Serological tests tive against rHcp100, and, with the positive control,
histoplasmin.
Typical anti-rHcp100 IgG antibody reactions obtained by dot
blot assays of rabbit antisera against H. capsulatum are shown
in Fig. 5a. rHcp100 was specifically recognized by anti- Antigen detection in urinary samples
H. capsulatum antibodies and no cross-reactions were ob-
served with anti-P. brasiliensis and anti-C. immitis antibodies. Antigen was detected in urine from all 6 (100%) PDH patients
On the other hand, cross-reactivity was observed between in duplicate. Urine samples from a pool of 20 healthy individ-
histoplasmin and the other fungal antigens, coccidioidin, and uals did not react with the anti-Hcp100 antibodies (Fig. 6).

Fig. 4 Purification of rHcp100.

rHcp100 was successfully
purified (~ 93.6% purity) by Ni-
NTA affinity chromatography
from the cell culture supernatant
(SN). Flow-through (FT), washes
(W1 and W2), and eluate (E) were
analyzed by 8% SDS-PAGE fol-
lowing Coomassie blue R250
staining (a) and Western blot (b)
Appl Microbiol Biotechnol

Fig. 5 Serological tests. a Dot blot results showed that rHcp100 proved to coccidioidin and paracoccidioidin. b The performance of rHcp100 as a
be recognized by anti-rHcp100 and anti-H. capsulatum antibodies and no diagnostic antigen was assayed by ID using sera from a patient with
cross-reactions (between 1/500 and 1/312500) were observed with anti- histoplasmosis (PH) and from a healthy blood donor (HBD). Both
P. brasiliensis and anti-Coccidioides immitis antibodies. On the other rHcp100 and histoplasmin formed a precipitin band with the patient sera
hand, cross-reactivity was observed between histoplasmin and

Discussion In the present study, we describe the cloning and expres-

sion of the gene encoding Hcp100 antigen fused at the C-
Hcp100 was first described by Colonna-Romano et al. as an terminus to the polyhistidine tag in the methylotrophic yeast
essential protein for the intracellular survival of H. capsulatum P. pastoris, and the purification and evaluation of this recom-
within macrophages (Colonna-Romano et al. 1998). Sequence binant antigen as a possible tool in the diagnosis and follow-
analysis of Hcp100 revealed that it is a homolog of the up of histoplasmosis. The advantage of rHcp100 from
p100 kDa co-activator proteins found in rat, human, and P. pastoris relies mainly in the reproducibility and standardi-
Caenorhabditis elegans (Colonna-Romano et al. 1998). zation for the production of large amounts of a known se-
According to Porta et al. (1999), these mentioned p100 kDa quence of Hcp100, which is expressed in culture supernatants
sequences consist of a fourfold hydrophobic repeated module under inducible conditions in a GRAS and fast-growing yeast
related to SNs that binds to DNA, followed by a fifth hybrid (P. pastoris).
module containing a Tudor domain that binds to RNA and During the present work, the performance of different cul-
might also be involved in RNA metabolism and RNA trans- ture conditions was evaluated since it was observed that dur-
port. The SN-like module contains, in turn, a subdomain A ing the production of rHcp100 in P. pastoris, the protein was
related to oligonucleotide-oligosaccharide binding and a degraded increasingly during the phase of induction and the
subdomain B which consists of two α-helices (Porta et al. rate of degradation increased toward the end of protein expres-
1999). The deduced mature Hcp100 open reading frame en- sion at 72 h, when the process was finished, except in BSM
codes a polypeptide of 890 amino acids with a predicted mo- supplemented with casamino acids. These results strongly
lecular mass of 100 kDa. Hcp100 contains species-specific suggest that the composition of the culture media, the pH
epitopes capable of being recognized by B and T cells. A values during the induction phase, and the presence of prote-
potential N-glycosylation site (NDT 701) was also predicted. ase inhibitors and/or casamino acids affect the integrity of the
A comparison of the deduced Hcp100 protein sequence to rHcp100. In this regard, complete proteolytic degradation of
other p100 kDa sequences from fungi and other eukaryotes the rHcp100 has been observed in BMM and MM media even
showed a high degree of similarity ranging from 88.6% of in the presence of protease inhibitors and casamino acids
identity in Blastomyces dermatitidis to 37.0% of identity in whereas partial proteolytic degradation was observed in
Homo sapiens (Online Resource 1). BMMY media supplemented or not with protease inhibitors
The Hcp100 gene has proved to be an excellent molecular and casamino acids. Thus, rHcp100 is very sensitive to intra-
marker for H. capsulatum detection in human samples (Bialek cellular proteases in P. pastoris, and proteolytic degradation
et al. 2002). This approach in turn raised the possibility that could be substantially minimized in the presence of BSM
the protein coded by this gene or a specific peptide sequence media supplemented with 1% casamino acids, perhaps by
of the Hcp100 gene could be used as a novel candidate antigen acting as a preferential substrate. In contrast to the observa-
for diagnosis of histoplasmosis. tions reported by Sinha et al. (2005), the pH shift from 5 to
 Appl Microbiol Biotechnol

addition of casamino acids, protease inhibitors, or use of

protease-deficient strains are the most frequently reported
strategies (Zhang et al. 2007). In the present study, it was
found that casamino acids exerted a significant inhibition of
protease activities only in BSM, whereas the lack of inhibition
by the protease inhibitor cocktail in this medium was not un-
expected since acid proteases which are inhibited by pepstatin
A are active at pH 3.0 and the assay was carried out at pH 5.0,
which is the pH value maintained by the casamino acids pres-
ent in BSM. In addition, BSM proved to be the best culture
media for the recombinant expression of Hcp100, possibly
due to the high-cell densities achieved (OD600 approximately
20). In this regard, it was reported that induction with metha-
nol at high-cell densities after extended glycerol fed-batch
phase to enhance cell growth, followed by short induction
times on methanol, should prevent proteolytic degradation of
the heterologous protein (Wu et al. 2013). Analysis on SDS-
PAGE showed that unpurified samples in BMMY or BSM
media yielded three prominent bands of approximately 100,
78, and 50 kDa. The 50 kDa and the 100 kDa proteins also
present in Western blots were identified as rHcp100 by MS
analysis. The 78 kDa band was identified by MS spectra as an
ATPase involved in protein folding and in protein import into
the endoplasmic reticulum, thus showing the ability of
P. pastoris to secrete this high molecular weight protein into
the culture media.
Our results strictly demonstrated that fast-growing Mut+
strain of P. pastorisX-33 (resulting from the insertion of
cDNA into the genome without disruption of the endogenous
aox1 and aox2 loci) was efficient to produce rHcp100 as a
secretory and soluble protein after 72 h of methanol induction
Fig. 6 Urine antigen detection. Dot blot results showed that urine in BSM supplemented with 1% casamino acids. After elution
specimens from PHD patients were positive in all cases (samples 1–6) with 500 mM imidazole during purification by IMAC, the
whereas the urine specimens from 20 healthy volunteers were negative final rHcp100 preparation resulted in a preparation with more
for H. capsulatum antigen (sample 7). In all cases, samples were spotted
in duplicate than 90% purity with high reactivity with anti-H. capsulatum
polyclonal antibodies from rabbits immunized with the whole
yeast and from a patient with chronic histoplasmosis. The
more acid or alkaline pH already had a significant effect on the expression level of rHcp100 reached approximately 1.3 mg/l.
stability of the rHcp100 (proteolytic degradation). In this re- The final yields are certainly in need of improvement but
gard, the addition of 1% casamino acids (but not of protease we would expect high robust yields under standardized indus-
inhibitors) to the culture media improved the stability of trial GMP production and purification conditions. The quality
rHcp100 in BSM medium by adjusting and maintaining the of the final product, however, is outstanding as—according to
pH in 5. Thus, at pH 5.0, the proteolytic activity of rHcp100 our results—it renders a novel antigen candidate for potential
was significantly diminished. In agreement with our findings, applications in the diagnosis of histoplasmosis and for its fur-
there are several reports of proteolytic degradation of recom- ther characterization as a novel target for molecular therapeu-
binant proteins produced in P. pastoris (Macauley-Patrick tics of this serious fungal disease.
et al. 2005; Wu et al. 2013). Indeed, proteolytic degradation In this regard, the purified rHcp100 by IMAC was tested
has been considered an important problem when yeasts are for reactivity with serum from a patient with histoplasmosis as
used to express heterologous proteins since during this stress- well as with serum from a healthy blood donor by ID. A
ful process yeast cells are subjected to starvation, change of precipitation band was only observed using the serum sample
carbon source, heat and pH changes, or toxic chemicals from the histoplasmosis patient. Dot blot assays were used for
(Zhang et al. 2007). Among the different measures to circum- testing the immunoreactivity of the anti-rHcp100 antibodies
vent proteolytic degradation of the recombinant proteins, against antigens from P. brasiliensis and C. immitis as well as
Appl Microbiol Biotechnol

for evaluating the ability of rHcp100 to be recognized by Author contributions All authors contributed to the study conception and
design as well as to material preparation, data collection, and analysis.
rabbit antisera against H. capsulatum, P. brasiliensis, and
The first draft of the manuscript was written by MLC and ADN and all
C. immitis to assess the specificity of the anti-rHcp100 anti- authors commented on previous versions of the manuscript. All authors
bodies as well as of the recombinant antigen expressed herein, read and approved the final manuscript.
respectively, and no cross-reactions were observed. Regarding
antigen detection in urine samples from PHD patients using Funding information This work was supported by the University of
Buenos Aires (Grant UBACyT 20020130200222BA). DGM, ADN,
anti-rHcp100 antibodies, results show that dot
and MLC are staff members of CONICET. MAT thanks the doctoral
immunobinding assays with this specific antiserum can be scholarship to CONICET.
successfully adapted to the diagnosis of PHD. The dot blot
assay was chosen to compare anti-rHcp100 antibody immu- Compliance with ethical standards This study was approved
noreactivity because it is a simple, rapid, and inexpensive by the institutional review committee “Dr Vicente Federico Del Giúdice”
method. In addition, this method can be of great benefit in at Hospital Nacional Alejandro Posadas, Buenos Aires, Argentina (Ref.
developing countries where this fungal disease is endemic 260 EMnP0S0/19). Informed consents were obtained from all partici-
pants. The procedures involving animals followed the NIH Guide for
and where resources and investments for health care are low. the Care and Use of Laboratory Animals and were approved by the
Preliminary results suggest that rHcp100 produced in Comité Institucional para el Cuidado y Uso de Animales de
P. pastoris is antigenic and recognized by anti- Laboratorio (CICUAL-FFyB, Protocol number 1018-19).
H. capsulatum antibodies. It was also proved to be useful in
ID and dot blot assays with at least no cross-reaction with anti- Conflict of interest The authors declare that they have no conflict of
interest.
P. brasiliensis and anti-C. immitis antibodies, and their respec-
tive antigens. Similarly, anti-rHcp100 antibodies demonstrat-
ed to be useful for the detection of H. capsulatum antigenuria
References
in immunocompromised patients with PHD. Further studies
are needed to determine whether this antigen might be detect- Adenis A, Nacher M, Hanf M, Basurko C, Dufour J, Huber F, Aznar C,
ed in other body fluids of patients with disseminated disease. Carme B, Coupple P (2014) Tuberculosis and histoplasmosis among
Until such prospective studies can be performed, we conclud- human immunodeficiency virus-infected patients: a comparative
ed that this study represents the first step toward determining study. Am J Trop Med Hyg 90:216–223. https://doi.org/10.4269/
ajtmh.13-0084
whether rHcp100 and its corresponding specific antibodies Almeida M d A, Pizzini CV, Damasceno LS, Muniz M d M, Almeida-
have applicability for the diagnosis of H. capsulatum in clin- Paes R, Peralta RH, Oliveira R d V, Vizzoni AG, de Andrade CL,
ical samples. A thorough evaluation of the accuracy of these Zancopé-Oliveira RM (2016) Validation of western blot for
novel reagents for diagnosis will require studies including Histoplasma capsulatum antibody detection assay. BMC Infect
Dis 16:87. https://doi.org/10.1186/s12879-016-1427-0
cases that have been diagnosed with histoplasmosis with the Bialek R, Feucht A, Aepinus C, Just-Nübling G, Robertson VJ, Knobloch
different forms of the disease and with other fungal and bac- J, Hohle R (2002) Evaluation of two nested PCR assays for detec-
terial infections (cryptococcosis, candidiasis, aspergillosis, tion of Histoplasma capsulatum DNA in human tissue. J Clin
coccidioidomycosis, blastomycosis, talaromycosis, sporotri- Microbiol 40:1644–1647
Caceres DH, Scheel CM, Tobón AM, Ahiquist Cleveland A, Restrepo A,
chosis, tuberculosis, nocardiosis, or bacterial pneumonia). Brandt ME, Chiller T, Gómez BL (2014) Validation of an enzyme-
The development of novel ELISAs using this recombi- linked immunosorbent assay that detects Histoplasma capsulatum
nant antigen as well as its specific antibodies are in progress antigenuria in Colombian patients with AIDS for diagnosis and
for the indirect and direct diagnosis of histoplasmosis, follow-up during therapy. Clin Vaccine Immunol 21:1364–1368.
https://doi.org/10.1128/CVI.00101-14
respectively. Carvalho KC, Vallejo MC, Camargo ZP, Puccia R (2008) Use of recom-
Finally, a last but not least important question is that cur- binant gp43 isoforms expressed in Pichia pastoris for diagnosis of
rently available antifungals are not ideal because of their tox- Paracoccidioidomycosis. Clin Vaccine Immunol 15:622–629.
icity for the host, the difficulties for administering them, or https://doi.org/10.1128/CVI.00437-07
Colombo AL, Tobon A, Restrepo A, Queiroz-Telles F, Nucci M (2011)
their fungistatic instead of fungicide activity that leads to a Epidemiology of endemic systemic fungal infections in Latin
prolonged treatment for the patient. Thus, the development America. Med Mycol 49:785–798. https://doi.org/10.3109/
of novel antifungals with new mechanisms of actions are ur- 13693786.2011.577821
gently needed. Studies are already in progress in our labora- Colonna-Romano S, Porta A, Franco A, Kobayashi S, Maresca B (1998)
Identification and isolation by DDRT-PCR of genes differentially
tory to characterize Hcp100 as a novel therapeutic target for expressed by Histoplasma capsulatum during macrophages infec-
molecular therapy. tion. Microb Pathog 25:55–66
In summary, the new recombinant antigen and its specific Cunningham L, Cook A, Hanzlicek A, Harkin K, Wheat J, Goad C,
antibodies produced in the present study have great potential Kirsch E (2015) Sensitivity and specificity of Histoplasma antigen
detection by enzyme immunoassay. J Am Anim Hosp Assoc 51:
to be used as novel diagnostic tools in histoplasmosis. The 306–310. https://doi.org/10.5326/JAAHA-MS-6202
further characterization of this antigen might contribute to Dantas KC, de Freitas RS, Moreira AP, Silva MV, Benard G,
the development of novel antifungal therapeutic strategies. Vasconcellos C, Criado PR (2013) The use of nested polymerase
 Appl Microbiol Biotechnol

chain reaction (nested PCR) for the early diagnosis of Histoplasma America: a neglected killer continues on its rampage. PLoS Negl
capsulatum infection in serum and whole blood of HIV-positive Trop Dis 7:e2319. https://doi.org/10.1371/journal.pntd.0002319
patients. An Bras Dermatol 88:141–143 Negroni R, Iovannitti C, Arechavala AL, Carnovale S, Euguchi K (1998)
Dantas KC, de Freitas RS, García RS, da Silva MV, Muricy EC, Kohara Preparation and study of an exoantigen of Histoplasma capsulatum
VS, Vicentini AP (2014) Importance of the association of molecular for serological reactions. Rev Iberoam Micol 15:282–285
and immunological diagnosis in immunocompetent patient with Oladele RO, Avanlowo OO, Richardson MD, Denning DW (2018)
Histoplasma capsulatum and Cryptococcus neoformans infection: Histoplasmosis in Africa: an emerging or a neglected disease?
a case report. J Venom Anim Toxins Incl Trop Dis 20:36. https://doi. PLoS Negl Trop Dis 12:e0006046. https://doi.org/10.1371/journal.
org/10.1186/1678-9199-20-36 pntd.0006046
de Freitas RS, Carvalho-Vivi KO, Zamboni IM, Assis CM, Costa Martins Porta A, Colonna-Romano S, Callebaut I, Franco A, Marzullo L,
JE, Vicentini Moreira AP (2009) The importance of serological as- Kobayashi GS, Maresca B (1999) An homologue of the human
says in diagnosis acute pulmonary histoplasmosis. J Venom Anim 100-kDa protein (p100) is differentially expressed by Histoplasma
Toxins Incl Trop Dis 15:278–288 capsulatum during infection of murine macrophages. Biochem
de Freitas RS, Kamikawa CM, Vicentini AP (2018) Fast protocol for the Biophys Res Commun 254:605–613
production of Histoplasma capsulatum antigens for antibody detec- Riviére S, Denis B, Bougnoux M-E, Lanternier F, Lecuit M, Lortholary O
tion in the immunodiagnosis of histoplasmosis. Rev Iberoam Micol (2012) Serum Aspergillus galactomannan for the management of
35:27–31. https://doi.org/10.1016/j.riam.2017.04.004 disseminated histoplasmosis in AIDS. Am J Trop Med Hyg 87:
EasySelectTM Pichia Expression Kit. User manual. Invitrogen-Life 303–305. https://doi.org/10.4269/ajtmh.2012.12-0119
Technologies. 2010;(25-0172):56–8 Sinha J, Plantz BA, Inan M, Meagher MM (2005) Cause of proteolytic
Falci DR, Hoffmann ER, Paskulin DD, Pasqualotto AC (2017) degradation of secreted recombinant proteins produced in
Progressive disseminated histoplasmosis: a systematic review on methylotrophic yeast Pichia pastoris: case study with recombinant
the performance of non-culture-based diagnostic tests. Braz J ovine interferon-tau. Biotechnol Bioeng 89:103–112
Infect Dis 21:7–11. https://doi.org/10.1016/j.bjid.2016.09.012 Srinivasan A, Kleiman MB, Debelenko L, Stokes DC, De Vincenzo J,
Gajurel K, Dhakal R, Deresinski S (2018) Diagnosis and treatment of Wheat JL (2009) False-negative Histoplasma antigen in acute pul-
histoplasmosis in solid organ transplant patients. Curr Opin Infect monary histoplasmosis: the value of urinary concentration by ultra-
Dis 31:301–308. https://doi.org/10.1097/QCO.0000000000000457 filtration and heat denaturation of serum proteins in detection of
González-González AE, Taylor ML, Curiel-Quesada E (2012) Relevant Histoplasma antigen. Pediatr Infect Dis 28:447–449. https://doi.
aspects of the Hcp100 molecular marker of Histoplasma capsulatum org/10.1097/INF.0b013e318193ecc1
and its potential therapeutic use in histoplasmosis. Rev Iberoam Theel ES, Harring JA, Dababneh AS, Rollins LO, Bestrom JE, Jespersen
Micol 29:115–119. https://doi.org/10.1016/j.riam.2011.09.001 DJ (2015) Reevaluation of commercial reagents for detection of
Guedes HL, Guimaraes AJ, Muniz M d M, Pizzini CV, Hamilton AJ, Histoplasma capsulatum antigen in urine. J Clin Microbiol 53:
Peralta JM, Deepe GS Jr, Zancopé-Oliveira RM (2003) PCR assay 1198–1203. https://doi.org/10.1128/JCM.03175-14
for identification of Histoplasma capsulatum based on the nucleo- Wheat LJ, Garringer T, Brizendine E, Connolly P (2002) Diagnosis of
tide sequence of the M antigen. J Clin Microbiol 41:535–539 histoplasmosis by antigen detection based upon experience at the
Guimaraes AJ, Nosanchuk JD, Zancopé-Oliveira RM (2006) Diagnosis histoplasmosis reference laboratory. Diagn Microbiol Infect Dis 43:
of histoplasmosis. Braz J Microbiol 37:1–13 29–37
Kaplan W, Littlejohn T (2001) Swiss-PDB viewer (deep view). Briefings Wheat JL, Azar MM, Bahr NC, Spec A, Relich RF, Hage C (2016)
in bioinformatics. Brief Bioinform 2:195–197 Histoplasmosis. Infect Dis Clin N Am 30:207–227. https://doi.org/
Kauffman CA (2007) Histoplasmosis: a clinical and laboratory update. 10.1016/j.idc.2015.10.009
Clin Microbiol Rev 20:115–132 WHO (2017) http://www.who.int/neglected_diseases/diseases/en/.
Lindsley MD, Holland HL, Bragg SL, Hurst SF, Wannemuehler KA, Accessed 7th July 2018
Morrison CJ (2007) Production and evaluation of reagents for de- Wu M, Shen Q, Yang Y, Zhang S, Qu W, Chen J, Sun H, Chen S (2013)
tection of Histoplasma capsulatum antigenuria by enzyme immuno- Disruption of YPS1 and PEP4 genes reduces proteolytic degrada-
assay. Clin Vaccine Immunol 14:700–709 tion of secreted HAS-PTH in Pichia pastoris GS115. J Ind
Macauley-Patrick S, Fazenda ML, McNeil B, Harvey LM (2005) Microbiol Biotechnol 40:589–599. https://doi.org/10.1007/s10295-
Heterologous protein production using the Pichia pastoris expres- 013-1264-8
sion system. Yeast 22:249–270 Xiao A, Zhou X, Zhou L, Zhang Y (2006) Improvement of cell viability
Miller R, Assi M, AST Infectious Diseases Community of Practice and hirudin production by ascorbic acid in Pichia pastoris fermen-
(2013) Endemic fungal infections in solid organ transplantation. tation. Appl Microbiol Biotechnol 72:837–844
Am J Transplant 13:250–261. https://doi.org/10.1111/ajt.12117 Yang J, Yan R, Roy A, Xu D, Poisson J, Zhang Y (2015) The I-TASSER
Nacher M, Adenis A, Mc Donald S, Do Socorro Mendonca Gomes M, Suite: protein structure and function prediction. Nat Methods 12:7–
Singh S, Lopes Lima I, Malcher Leite R, Hermelijn S, Wongsokarijo 8. https://doi.org/10.1038/nmeth.3213
M, Van Eer M, Marques Da Silva S, Mesquita Da Costa M, Silva M, Zhang Y, Liu R, Wu X (2007) The proteolytic systems and heterologous
Calvacante M, do Menino Jesus Silva Leitao T, Gomez BL, proteins degradation in the methylotrophic yeast Pichia pastoris.
Restrepo A, Tobon A, Canteros CE, Aznar C, Blanchet D, Ann Microbiol 57:553
Vantilcke V, Vautrin C, Boukhari R, Chiller T, Scheel C, Ahlquist
A, Roy M, Lortholary O, Carme B, Crouppié P, Vreden S (2013) Publisher’s note Springer Nature remains neutral with regard to jurisdic-
Disseminated histoplasmosis in HIV-infected patients in South tional claims in published maps and institutional affiliations.