Yankner 2014

HHS Public Access
Author manuscript
Nature. Author manuscript; available in PMC 2014 September 27.
Author Manuscript
Published in final edited form as:

Nature. 2014 March 27; 507(7493): 448–454. doi:10.1038/nature13163.
REST and Stress Resistance in Aging and Alzheimer’s Disease

Tao Lu1, Liviu Aron1, Joseph Zullo1, Ying Pan1, Haeyoung Kim1, Yiwen Chen2, Tun-Hsiang
Yang1, Hyun-Min Kim1, Derek Drake1, X. Shirley Liu2, David A. Bennett3, Monica P.
Colaiácovo1, and Bruce A. Yankner1
1Department of Genetics, Harvard Medical School, Boston, MA 02115
2Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute and
Author Manuscript
Harvard School of Public Health, Boston, MA 02215

3Rush Alzheimer’s Disease Center, Rush University Medical Center, Chicago, IL 60612
Summary
Human neurons are functional over an entire lifetime, yet the mechanisms that preserve function
and protect against neurodegeneration during aging are unknown. Here we show that induction of
the repressor element 1-silencing transcription/neuron-restrictive silencer factor (REST/NRSF) is
a universal feature of normal aging in human cortical and hippocampal neurons. REST is lost,
however, in mild cognitive impairment (MCI) and Alzheimer’s disease (AD). Chromatin
immunoprecipitation with deep sequencing (ChIP-seq) and expression analysis show that REST
represses genes that promote cell death and AD pathology, and induces the expression of stress
response genes. Moreover, REST potently protects neurons from oxidative stress and amyloid β-
Author Manuscript
protein (Aβ) toxicity, and conditional deletion of REST in the mouse brain leads to age-related
neurodegeneration. A functional ortholog of REST, C. elegans SPR-4, also protects against
oxidative stress and Aβ toxicity. During normal aging, REST is induced in part by cell non-
autonomous Wnt signaling. However, in AD, frontotemporal dementia and dementia with Lewy
bodies, REST is lost from the nucleus and appears in autophagosomes together with pathologic
misfolded proteins. Finally, REST levels during aging are closely correlated with cognitive
preservation and longevity. Thus, the activation state of REST may distinguish neuroprotection
from neurodegeneration in the aging brain.
Author Manuscript
Users may view, print, copy, and download text and data-mine the content in such documents, for the purposes of academic research,
subject always to the full Conditions of use:http://www.nature.com/authors/editorial_policies/license.html#terms
Correspondence should be addressed to: Bruce A. Yankner, Department of Genetics, Harvard Medical School, 77 Avenue Louis
Pasteur, NRB-858C, Boston, MA 02115, Ph: 617-432-6800; Fax: 617-432-6825, [email protected].
Supplementary Information is available in the online version of the paper.
Author Contributions: T.L, L.A., J.Z., Y.P., H.K., and H.-M.K. performed experiments. T.L., L.A., J.Z., M.C. and B.A.Y.
contributed to the overall study design. T.L., Y.C., T.-H.Y., D.D. and X.L. performed informatics analysis. D.A.B. contributed tissue
samples, cognitive test data and analysis. B.A.Y. directed the study and B.A.Y., T.L., L.A. and J.Z. wrote the manuscript, which was
edited by all the coauthors.
Data are available in the Gene Expression Omnibus (GEO) under accession GSE53890.
Reprints and permissions information is available at www.nature.com/reprints.
The authors declare no competing financial interests.
Lu et al. Page 2
The preservation of cognitive function during aging has emerged as one of the major
Author Manuscript
medical challenges of the 21st century. A fundamental question is why some individuals age
with their cognitive function relatively intact whereas others decline and develop
Alzheimer’s disease (AD). Early studies suggested that neuronal loss was an integral feature
of the aging brain. With the advent of stereological neuronal quantification, however, it
became clear that neuronal cell number is largely preserved in the neocortex and
hippocampus of the aging human brain, declining only in the setting of neurodegenerative
disease1–3. Robust stress response mechanisms must have evolved, therefore, to preserve
neurons and cognitive function across an entire lifespan4,5.
REST is a repressor of neuronal genes during embryonic development that is downregulated

once terminal neuronal differentiation has occurred6–8. Here we show that REST is induced
in the aging human brain and regulates a network of genes that mediate cell death, stress
resistance and AD pathology. This gene network becomes dysregulated at early stages of
Author Manuscript
AD when REST is lost from the nucleus. Conditional REST knockout mice and C. elegans
models suggest that REST protects neurons from age-related toxic insults. In aging humans,
elevated REST levels are associated with preservation of cognitive function and increased
longevity, even in the presence of AD pathology. Hence, REST regulates a neuroprotective
stress response that may be central to cognitive preservation during aging.
REST is induced in the aging human brain and declines in AD

Transcriptional profiling has demonstrated significant changes in the expression of neuronal
genes in the prefrontal cortex of aging humans9,10. Analysis of this dataset using the
Ingenuity Systems IPA platform suggests that the transcription factor most strongly
predicted to be activated in the aging brain is REST/NRSF (P=9E-10). Moreover, the 21-bp
Author Manuscript
canonical RE1 recognition motif for REST is highly enriched in the age-downregulated gene
set (P=3E-7) (Fig. 1a).
To explore the role of REST in the aging brain, we measured REST levels in extracts of
prefrontal cortex (PFC) from young adult (20–35 years) and aged (73–106 years) individuals
without AD. REST expression was significantly increased in the aging human PFC at both
the mRNA and protein levels, as determined by quantitative real time RT-PCR (qRT-PCR)
and Western blotting (Fig. 1b, c). Full-length REST was markedly increased; the truncated
splice variant REST4 was a minor component, comprising 0.1–0.5% of REST mRNA.
Immunofluorescence microscopy using three different antibodies against the N- or C-
terminal domains of REST showed a striking induction of REST in the nucleus of aging
neurons in the PFC and hippocampus (Fig. 1d, e; Extended Data Fig. 1). Much lower levels
of REST were detected in microglial cells and astrocytes (data not shown). REST antibody
Author Manuscript
specificity was indicated by ablation of immunoreactivity after antibody preabsorption with

a REST blocking peptide, absence of immunoreactivity with matched nonspecific IgG, and
loss of immunoreactivity after shRNA-mediated REST knockdown in neural SH-SY5Y cells
(Extended Data Fig. 1b, c).
We then asked whether induction of REST in aging neurons leads to increased REST-RE1
site binding. To assess REST targeting specifically in neurons, we isolated neuronal nuclei

Lu et al. Page 3
from the PFC by fluorescence-activated cell sorting (FACS) of NeuN-positive nuclei5

Author Manuscript
(Methods). ChIP-PCR analysis showed a marked induction of REST binding to canonical

RE1 motifs in REST target genes in the aged PFC (Fig. 1f). These results indicate that
REST expression and function is increased in aging neurons.
We next examined REST in aging individuals with mild cognitive impairment (MCI) or AD.
REST was almost absent from the nucleus of cortical and hippocampal neurons in AD (Fig.
1d, Extended Data Fig. 1a, d). Punctate cytoplasmic REST immunoreactivity was detected
in some AD neurons, but was not detectable in other neurons (Fig. 1d). Loss of nuclear
REST was confirmed by quantitative immunocytochemical analysis of 77 cases of sporadic
AD compared with 72 age-matched cognitively intact controls, and confirmed by FACS
analysis of neuronal nuclei in a subset of cases (Fig. 1e). In 23 of 24 cases of amnestic MCI,
nuclear REST levels were reduced relative to the mean of aged controls (Fig. 1e). A survey
of brain regions showed significantly reduced nuclear REST levels in affected neuronal
Author Manuscript
populations in AD, including prefrontal cortical neurons, and neurons of the CA1, CA3 and
CA4 subfields of the hippocampus (Extended Data Fig. 1a, c). In contrast, nuclear REST
was not reduced in neurons of the dentate gyrus and cerebellum, which are relatively
unaffected in AD (Extended Data Fig. 1a, d). Reduced REST levels in AD were confirmed
by Western blotting of prefrontal cortical grey matter samples, as well as isolated cortical
nuclei (Fig. 1c, upper and far right panels, respectively). Furthermore, ChIP-PCR analysis of
neuronal nuclei showed significantly reduced or absent REST-RE1 site binding in AD
relative to normal aging controls (Fig. 1f, 2a). Thus, REST is induced during normal brain
aging, but is markedly reduced in AD in vulnerable neuronal populations.
REST represses genes involved in cell death and AD

Author Manuscript
To obtain greater insight into the functional consequences of REST induction in the aging
brain, we explored REST targets by chromatin immunoprecipitation and deep sequencing
(ChIP-seq) in the neural cell line SH-SY5Y. REST binding to a subset of the identified
target genes was confirmed by ChIP-qPCR (Extended Data Fig. 2). REST ChIP-seq sites
were significantly enriched among age-regulated genes in human PFC (P=1.65E-12), and
were predominantly downregulated from the third to the tenth decades of life (Extended
Data Fig. 2a). Pathway analysis of the ChIP-seq database showed a highly significant
enrichment for genes in cell death pathways and genes that are associated with AD/dementia
(Extended Data Fig. 2b, c). Cell death genes include p38 MAP kinase (MAPK11), FAS,
FADD, TRADD, BAX, BID, DAXX, PUMA, the mitochondrial permeability transition pore
ANT1 and cytochrome C. REST targets related to the pathology of AD include the gamma
secretase complex members presenilin-2 and pen-2 implicated in Aβ generation, and cdk5R1
Author Manuscript
(p35), cdk5R2 (p39), p38 MAP kinase and 14-3-3zeta implicated in tau phosphorylation.
REST repressed the expression of these genes in SH-SY5Y cells (Extended Data Fig. 3a, b),
and strongly inhibited tau phosphorylation at the AT8 and PHF1 epitopes associated with
AD (Extended Data Fig. 3c).
We next examined the regulation of these REST target genes in the normal aging brain and
AD. To distinguish effects at different stages of cognitive decline, we stratified the AD
population for least severe (AD1; MMSE score >18) and most severe (AD2; MMSE score

Lu et al. Page 4
<8). REST targets related to cell death and AD pathology showed reduced REST binding
Author Manuscript
and elevated mRNA expression at both stages of AD (Fig. 2a, b). REST target genes related
to neurotransmission, however, showed elevated mRNA expression in early stage AD1, but
reduced expression in later stage AD2 (Fig. 2b). Regression analysis of protein levels
showed that nuclear REST is inversely correlated with levels of pro-apoptotic (BAX and
DAXX) and AD-related (presenilin-2) proteins in normal aging and AD neurons (Fig. 2c, d).
This was also observed for REST targets associated with neurotransmission (SST and
CALB1) during normal aging and early stage AD1, but not in late stage AD2 (Fig. 2c). The
activation-associated histone modification H3K9ac, which is typically reduced by REST,
was globally downregulated in normal aging PFC neurons (Fig. 2e) and was inversely
correlated with REST levels (Fig. 2c, d). In contrast, neuronal H3K9ac increased
significantly in early AD (Fig. 2e). Thus, loss of nuclear REST in AD is associated with
epigenetic derepression of potentially pathogenic genes.
Author Manuscript
REST is neuroprotective
Since REST represses pro-apoptotic genes, we explored a role in neuroprotection by
assessing vulnerability to oxidative stress and oligomeric Aβ, stressors associated with brain
aging9 and AD11. Primary cultures of mouse E16 cortical neurons were established from
Nestin-Cre:RESTlx/lx (REST cKO) and littermate control embryos. After 1–2 weeks in
culture, neuronal differentiation was comparable in REST-deficient and control cultures.
Upon treatment with hydrogen peroxide or oligomeric Aβ42, REST-deficient neurons
showed markedly increased degeneration and cell death relative to controls (Fig. 3a,
Extended Data Fig. 4a). REST-deficient neurons were rescued by lentiviral transduction of
wild-type REST, leading to expression levels 2–2.5-fold that of wild-type (Fig. 3a, Extended
Data Fig. 4a). In contrast, a REST mutant that is deficient in nuclear translocation
Author Manuscript
(ΔREST)12,13 was unable to rescue (Fig. 3a, b). REST-deficient neurons showed increased
expression of pro-apoptotic genes in response to oxidative stress and oligomeric Aβ
(Extended Data Fig. 4b). Thus, endogenous REST is neuroprotective.
REST-deficient mice showed a progressive age-related neurodegenerative phenotype. At

one month of age, neuronal numbers in the cortex and hippocampus of REST cKO mice
were not significantly different from controls. Neuronal degeneration and apoptosis
appeared by 8 months of age, as indicated by positive neuronal labeling for cleaved
caspase-3 and TUNEL (Fig. 3c, d). This was accompanied by significant neuronal loss in the
cerebral cortex and hippocampus, and pronounced gliosis (Fig. 3c, d). These results suggest
that REST is essential for maintaining neuronal viability in the aging brain.
To confirm the findings on REST-deficient neurons, we assessed vulnerability to oxidative

Author Manuscript
stress after REST overexpression or shRNA-mediated knockdown in neural SH-SY5Y cells.

Cell death induced by hydrogen peroxide was significantly reduced when REST was
overexpressed by 3-to 20-fold (Extended Data Fig. 4c). Higher levels of REST
overexpression increased cell death. REST knockdown by lentiviral shRNA transduction
significantly increased H2O2-induced apoptosis in both SH-SY5Y cells and cultured human
cortical neurons, which was prevented by shRNA-resistant mouse REST (Extended Data
Fig. 4c, d). Furthermore, shRNA-mediated REST knockdown increased levels of reactive

Lu et al. Page 5
oxygen species (ROS), which was prevented by the antioxidant N-acetyl-cysteine (NAC)
Author Manuscript
(Extended Data Fig. 4e, f). Moreover, REST knockdown increased oxidative DNA damage,
which was reduced by REST overexpression (Extended Data Fig. 4g). To examine the
relationship of REST expression to oxidative DNA damage in the human brain, we double-
labeled for REST and the oxidative DNA damage marker 8-oxoguanine (8-oxoG). Linear
regression analysis showed a significant inverse relationship between nuclear REST and 8-
oxoG levels in normal aging neurons and in AD (Extended Data Fig. 4h). Thus, REST
expression during aging may reduce oxidative damage.
The nematode C. elegans has served as a model system of aging and stress resistance4. Two
multi-zinc finger transcription factors in C. elegans structurally resemble mammalian REST
(spr-3 and spr-4)14,15, and another gene is closely homologous to CoREST (spr-1)16. To test
the role of these genes in oxidative stress resistance, we placed adult worms on nematode
growth medium supplemented with paraquat, a superoxide generator. C. elegans lines with
Author Manuscript
mutations in spr-1, spr-3, and spr-4 all showed significantly reduced survival relative to
wild-type controls (Fig. 4a, Extended Data Fig. 5a). The spr-4(by105) mutant showed the
greatest vulnerability. Furthermore, depletion of spr-4 by RNAi significantly reduced
survival in wild-type worms after treatment with paraquat (Extended Data Fig. 5b). SPR-4
was expressed predominantly in neurons (Extended Data Fig. 5c), and was induced by
oxidative stress (Extended Data Fig. 5d).
The increased sensitivity of the spr-4 mutant worms to oxidative stress was significantly
reduced by transgenic expression of either wild-type SPR-4 or human REST (Fig. 4a, b). To
ascertain whether SPR-4 and REST directly modulate ROS levels, worms were labeled with
the fluorescent ROS indicator 2′,7′-dichlorodihydrofluorescein diacetate (DCFDA).
Spr-4(by105) mutants treated with paraquat showed significantly elevated ROS levels
Author Manuscript
relative to wild-type, which was reduced by transgenic expression of either wild-type SPR-4
or human REST (Fig. 4c, d). To determine whether REST can substitute for SPR-4 as a
transcriptional repressor, we assessed the expression of the presenilin gene hop-1, which is
repressed by SPR-4. The expression of hop-1 was elevated in adult spr-4 mutants relative to
wild-type worms, and was repressed by both wild-type SPR-4 and human REST (Extended
Data Fig. 5e). These results suggest that human REST can functionally substitute for SPR-4
in C. elegans.
SPR-4 also modulated the neurotoxicity of Aβ in a C. elegans line that expresses Aβ42 in
glutamatergic neurons and undergoes age-dependent neuronal loss17. When this Aβ-
expressing line was crossed with the spr-4(by105) mutant, the resulting line expressed Aβ42
in an SPR-4 loss-of-function background and showed significantly accelerated
Author Manuscript
neurodegeneration (Fig. 4e). Thus, SPR-4 protects against both oxidative stress and Aβ
toxicity, consistent with a general role in stress resistance.
Induction of REST by stress and Wnt signaling

To determine whether REST might be induced by oxidative and other forms of stress in the
aging brain, we subjected primary human cortical neuronal cultures to a variety of stressors.
Incubation with redox-active iron (Fe+2), hydrogen peroxide, the glutathione synthesis

Lu et al. Page 6
inhibitor buthionine sulfoxide (BSO), or Aβ42 induced REST mRNA and protein and
Author Manuscript
increased REST-RE1 site binding (Extended Data Fig. 6a–f). To determine whether secreted
factors might contribute to REST induction, cortical neurons were incubated with H2O2
followed by removal of H2O2 and generation of conditioned medium. Addition of stress-
related conditioned medium to naïve neuronal cultures resulted in a marked induction of
REST mRNA expression (Extended Data Fig. 6g). Thus, a variety of stressors induce REST
expression, which is mediated at least in part through cell non-autonomous signaling.
To explore the role of cell non-autonomous signaling in the aging brain, we generated
extracts of human PFC from young adult and aged samples and assessed their effects on SH-
SY5Y cells. REST was robustly induced by extracts of aged human cortex, but minimally
by extracts of young adult cortex (Extended Data Fig. 6h). Furthermore, extracts of AD
cortex showed reduced REST-inducing activity relative to age-matched controls (Extended
Data Fig. 6h). Since REST has been identified as a target of canonical Wnt-β-catenin
Author Manuscript
signaling18, we examined the role of this cell non-autonomous signaling pathway. Extracts
of aged cortex and conditioned medium from stressed cells treated with H2O2, tunicamycin
or wortmannin induced β-catenin in parallel with REST (Extended Data Figs. 6h, 7a, b).
Induction of REST and β-catenin was partially inhibited by the Wnt signaling antagonist
Dickkopf (Extended Data Fig. 7a, b). REST was also induced by addition of purified Wnt-3a
and Wnt-7a. Moreover, the GSK3-β inhibitors lithium chloride and Chiron 99021 that
activate Wnt signaling induced REST, increased REST-RE1 site binding, and augmented
nuclear translocation (Extended Data Fig. 7c–f). To assess Wnt signaling in the human
brain, we measured nuclear β-catenin levels in the PFC of young adult and aged cases.
Nuclear β-catenin was significantly elevated in aging PFC neurons and co-localized with
REST (Extended Data Fig. 7g, h). These results suggest that Wnt-β-catenin signaling may
contribute to the induction of REST in the aging brain.
Author Manuscript
Autophagy of REST in neurodegenerative disorders

In AD, loss of REST from the nucleus was often accompanied by localization to punctate
cytoplasmic structures that were labeled with the autophagosome markers LC3, ATG7 and
ATG12, but not the lysosomal markers LAMP1 and LAMP2 (Extended Data Fig. 8a). To
determine if autophagy could alter the nuclear-cytoplasmic distribution of REST, autophagy
was activated in SH-SY5Y cells by serum deprivation. This resulted in significantly reduced
nuclear REST, which was reversed by treatment with 3-methyladenine (3-MA) or
bafilomycin, inhibitors of autophagy (Extended Data Fig. 8b, c). Since activation of
autophagy is characteristic of many age-related neurodegenerative disorders, we asked
whether REST is also depleted in other dementing diseases. Examination of cortical sections
Author Manuscript
from patients with frontotemporal dementia (FTD) or dementia with Lewy bodies (DLB)
showed marked depletion of nuclear REST (Fig. 5a).
Induction of autophagy in neurodegenerative disorders has been associated with pathogenic

misfolded proteins such as Aβ19. In AD, many cortical and hippocampal neurons showed a
notable co-localization of REST with Aβ in LC3-positive autophagosomes (Fig. 5b). In
contrast, REST did not colocalize with Aβ in amyloid plaques. Phosphorylated tau and
TDP-43 have been implicated as abnormally folded pathogenic proteins in FTD, whereas α-

Lu et al. Page 7
synuclein has been implicated in DLB. Every case (8) of tau-positive FTD examined
Author Manuscript
showed co-localization of REST with phosphorylated tau (PHF1) in LC3-positive

autophagosomes (Fig. 5b). Similarly, every case (6) of TDP-43-positive FTD showed co-
localization of REST with TDP-43 and LC3 (Fig. 5b). All ten cases of DLB examined
showed partial co-localization of REST with α-synuclein in autophagosomes (Fig. 5b).
Thus, autophagy of REST, together with pathogenic misfolded proteins, may reduce nuclear
translocation in AD and other neurodegenerative disorders.
REST, cognitive preservation and longevity

A central question is whether loss of REST in AD contributes to cognitive decline. We
explored this question by using measures of cognitive function derived from
neuropsychiatric assessments performed longitudinally in the Religious Orders Study and
the Rush Memory and Aging Project (Methods). Linear regression analysis showed that
Author Manuscript
nuclear REST levels in prefrontal cortical neurons are positively correlated with a measure
of global cognition, and separate measures of episodic, semantic and working memory with
high levels of statistical significance (Fig. 6a, Extended Data Fig. 9a). Similar results were
obtained in pyramidal neurons in the hippocampal CA1 region. For both brain regions,
REST levels were most robustly correlated with episodic memory, which typically declines
early in the course of AD. Elevated REST levels also predicted reduced AD neuropathology
(Fig. 6b, Extended Data Fig. 9b).
We then asked if elevated REST levels might confer resistance to AD pathology. Cases with
NIA-Reagan and CERAD pathology scores indicative of pathologic AD, but with mild or no
cognitive impairment, were compared to cases with pathologic AD together with severe
cognitive impairment. Nuclear REST levels were significantly elevated in cognitively
Author Manuscript
preserved cases relative to cognitively impaired cases, despite the fact that both groups met
pathologic criteria for AD (Fig. 6c). Thus, elevated REST levels are associated with
cognitive preservation in individuals who meet pathologic criteria for AD.
Since REST is associated with stress resistance and preservation of cognitive function, we
explored the relationship to human lifespan. Nuclear REST levels in PFC neurons showed a
significant positive correlation with longevity (R=0.53; P<e-4) (Fig. 6d). This relationship
remained significant after multivariate adjustment for cognitive test scores and indices of
neuropathology. Furthermore, the expression of REST target genes showed a highly
significant inverse correlation with longevity (Extended Data Fig. 2a). Examination of the
neuroanatomical distribution of REST in individuals with extreme longevity showed marked
induction in neurons of the PFC and hippocampus, but not in the Purkinje or granule cell
neurons of the cerebellum (Extended Data Fig. 10a). Thus, REST expression in specific
Author Manuscript
neuronal populations correlates with longevity.
We then asked if REST regulates genes that have been implicated in stress resistance and the
aging process. In addition to repressing cell death genes, REST also promoted expression of
the anti-apoptotic gene BCL-2, the antioxidants catalase and SOD1, and the FOXO
transcription factor FOXO1a (Extended Data Figs. 3a, 10b). As FOXO1a has been
implicated in oxidative stress resistance20 and human longevity21, we assessed its regulation

Lu et al. Page 8
by REST at the protein level. REST knockdown by shRNA transduction in SH-SY5Y cells
Author Manuscript
almost completely abolished FOXO1a expression, which was reversed by an shRNA-

resistant mouse REST vector (Extended Data Fig. 10c). Thus, REST may broadly confer
stress resistance during aging.
Discussion
We have demonstrated a striking induction of the developmental transcriptional repressor
REST in specific neuronal populations of the aging human brain together with epigenetic
repression of REST target genes. REST has been investigated extensively as a repressor of
neuronal genes during embryonic development, a function that persists in adult non-
neuronal cells22. Our findings suggest that REST additionally plays a role as a
neuroprotective modulator, in part by repressing genes that promote cell death and the
pathology of AD. Moreover, REST increases the expression of FOXO transcription factors
Author Manuscript
that mediate oxidative stress resistance20, as well as the antioxidant enzymes catalase and
SOD1, possibly through indirect mechanisms such as repression of micro RNAs. Consistent
with these findings, REST confers oxidative stress resistance and protects against toxic
insults associated with AD, including Aβ oligomers and tau phosphorylation. Furthermore,
REST appears to be essential for maintaining neuronal viability in the normal aging cortex
and hippocampus. This protective function is conserved in C.elegans. Previous ChIP-
SACO23 and ChIP-chip24 studies also identified REST target genes involved in cell death.
In addition, a recent study suggests that REST protects against the toxicity of 1-methyl-4-
phenyl-1,2,3,6-tetrahydropyridine (MPTP), a model of Parkinson’s disease25. Thus, REST
may coordinate a stress response that is broadly neuroprotective in the aging brain.
REST dysfunction may contribute to the pathogenesis of a number of different

Author Manuscript
neurodegenerative disorders. In addition to AD, REST was also significantly depleted in

frontotemporal dementia and dementia with Lewy bodies. In each of these disorders, REST
was lost from the nucleus and appeared in autophagosomes together with pathologic
misfolded proteins, including Aβ, phosphorylated tau, TDP-43 and α-synuclein. This may
represent a common pathogenic mechanism that links altered proteostasis to aberrant gene
expression.
Recent studies suggest that epigenetic regulation of chromatin may modulate the cognitive
outcome of a variety of neuropathological states26–28. It is intriguing that aging individuals
who harbor substantial AD pathology do not appear to progress to dementia when neuronal
REST levels are high. This raises the possibility that structural pathology, such as Aβ
deposition and neurofibrillary tangles, may not be sufficient to cause dementia. Rather,
failure of the brain’s stress response system may also be necessary, suggesting new
Author Manuscript
possibilities for therapeutic intervention.
METHODS
Brain sample procurement
Postmortem human brain material was procured in accordance with institutional guidelines
governed by approved protocols. Tissue samples were procured from the Rush University

Lu et al. Page 9
Medical Center, the University of Maryland, Duke University, the Brigham and Women’s
Author Manuscript
Hospital, and the Massachusetts General Hospital. Tissue samples from Rush University
Medical Center were derived from participants in the Religious Order Study (ROS) and
Rush Memory and Aging Project (MAP) at the Rush Alzheimer’s Disease Center, which are
longitudinal, clinical-pathologic studies of aging, cognitive decline and AD30,31. Study
participants agreed to comprehensive annual clinical and neuropsychological evaluation and
brain donation at death. Informed consent was obtained and the study was approved by the
Institutional Review Board (IRB) of Rush University Medical Center.
Cognitive function tests and neuropathology

Measures of cognitive function were derived from neuropsychiatric assessments performed
longitudinally in the Religious Orders Study and the Rush Memory and Aging Project
(MAP). This population includes individuals across the cognitive spectrum, ranging from
Author Manuscript
normal to AD. The last cognitive test scores obtained during life were related to nuclear
REST levels in postmortem prefrontal cortical brain samples by quantitative
immunocytochemistry (111 cases, Fig. 6a) and FACS analysis of isolated neuronal nuclei
(37 additional cases, Extended Data Fig. 9a). Nineteen cognitive function tests were
employed in the present study, including a summary score of all 19 tests used as a measure
of global cognition, and separate measures of episodic, semantic, and working memory, and
perceptual speed. The follow-up rate exceeds 95% and the autopsy rate exceeds 90%.
Autopsy cases in the Religious Orders and MAP studies underwent a uniform structured
neuropathologic evaluation of AD, including assignment of Braak (measure of number and
distribution of neurofibrillary tangles), CERAD (Aβ plaque pathology), and NIA-Reagan
(composite measure of neurofibrillary tangles and amyloid plaques) scores. The clinical
diagnoses of AD and MCI have been described in detail and pathologic confirmation of AD
Author Manuscript
approaches 90%32–34. Frozen brain tissue specimens used in this study were from the
prefrontal cortical grey matter (Brodmann area 9, 10) and were snap-frozen and stored at
−140°C. Paraffin-embedded brain samples were also obtained from the Massachusetts
General Hospital and Brigham and Women’s Hospital. These samples included young adult
cases without neurological abnormalities, aged subjects that did not carry a diagnosis of AD
or another neurodegenerative disease and showed neuropathological findings within the
normal range for age, and cases of AD, FTD and DLB with clinical histories of these
disorders and subsequent pathological confirmation. A total of 364 brain specimens with an
age range from 19–106 years were utilized for molecular and histopathological analyses.
The characteristics of these cases are provided in Supplementary Information Table 1.
Microarray analysis
Author Manuscript
Gene expression profiling using microarrays has been described previously35. Human brain
samples with tissue pH<6.5 or postmortem interval (PMI) >20 hrs were excluded. Prefrontal
cortical samples with acceptable parameters of RNA quality were hybridized to Affymetrix
Human Genome U133plus 2.0 arrays, which were then scanned and expression data
extracted using Affymetrix Microarray Suite Software. The Probe-level Linear Model
(PLM) platform was used for analysis of microarray data36. A subset of the data was
additionally analyzed using RMA or dCHIP platforms yielding similar results. Significance

Lu et al. Page 10
Analysis of Microarrays (SAM) software37 was used for 2-group comparisons of young
Author Manuscript
adult versus aged with the following criteria for identifying age-related expression changes:
1000 permutations and median false discovery rate (FDR) ≤0.01. Age-regulated genes that
overlap with RE1-containing genes38 were visualized by hierarchical clustering using dChip
software39 (Fig. 1a). The display range used was 1.5 (a value greater than 1.5 standard
deviations above the mean is pure red, below is pure blue, and equal to the mean is white.
Real time RT-PCR and PCR

Primers were designed for 90–300-base-pair (bp) segments to span exon boundaries if
possible. PCR or real-time PCR were run for 30–40 cycles (Supplementary Information
Table 2). The purity of both PCR and RT-PCR products were determined by single peak
melting curves, and further confirmed by agarose gel electrophoresis. To extract RNA, the
Cells-to-cDNA™ II Kit was used for cells, and Trizol (Invitrogen) was used for tissue
Author Manuscript
samples. All RNAs were DNase treated. A standard curve for each primer pair was
generated by serial dilution of a pool of titrated RNA or DNA. Beta-actin or GAPDH were
used as internal controls. Positive control primers for the REST ChIP assay, SYN- RE1
primers, were from Millipore (Cat#17-641), and the C-terminal truncated splice variant,
REST4 primers: RES4-F: 5′-GTGAGCGAGTATCACTGGAGG-3′, REST4-R: 5′-
CCATCTAGATCACACTCTGAATG-3′ have been reported previously40. Other primers
used in this study were designed using Primer3.0, and are listed in Supplementary Table 2.
Western blotting
Tissues were homogenized, whereas cells were directly lysed using RIPA-DOC buffer
supplemented with protease and phosphatase inhibitors (Complete and Phosphostop,
Roche). A sonication step was performed prior to centrifugation at 10,200g for 10 min at
Author Manuscript
4°C. The supernatant was removed and the protein concentration determined (BioRad
protein assay). SDS sample buffer containing beta mercaptoethanol was added and 20 μg
protein was loaded per lane and resolved by 4–20% Mini-PROTEAN TGX precast gels
(Biorad). Western blots were quantified by densitometry using the ImageJ software. The
antibodies used for this study are described in Supplementary Table 3.
Immunohistochemical analysis of human brain

Antibodies used in this study are described in Supplementary Information Table 3, The
following REST-specific antibodies were used for immunolabeling studies: (i) a rabbit
polyclonal IgG recognizing a region between residues 1,050 and the C-terminus (residue
1,097) of REST (Bethyl laboratories, IHC-00141); (ii) a rabbit polyclonal IgG recognizing a
region between residues 801 and the C-terminus (residue 1097) of REST (Millipore, 07–
Author Manuscript
579); (iii) a goat polyclonal IgG recognizing an internal region of REST (Santa Cruz,
sc-15118); and (iv) rabbit monoclonal IgG recognizing a region near the N-terminus of
REST (Abcam, ab28018).
Immunohistochemical/immunofluorescence analysis using paraffin-embedded brain sections

was performed in the following regions: (1) the prefrontal cortex (Broadmann areas 9, 10
and 47, (2) the hippocampal formation, including the CA1, CA3, CA4 and DG sectors, and
(3) the cerebellum. Analysis of REST expression by immunohistochemistry using paraffin-

Lu et al. Page 11
embedded sections obtained from the various sources indicated above led to very similar
Author Manuscript
conclusions.
Paraffin-embedded tissue sections were first deparaffinized in xylene, then rehydrated with
decreasing concentrations of ethanol and placed in water. Sections then underwent antigen
retrieval using either citrate buffer (Vectorlabs, USA) or the Diva decloaker (BioCare,
USA). For diaminobenzidine (DAB) labeling, sections were additionally treated with 3%
hydrogen peroxide for 30 minutes. They were then washed and blocked with 3% BSA, 0.2%
Triton X-100 in PBS for 1 hr at room temperature. Primary antibodies were diluted in 2%
BSA, 0.1% Triton in PBS. Following overnight incubations, sections were washed three
times with PBS. Secondary antibodies, diluted in 2% BSA, 0.1% Triton in PBS were either
biotin-coupled (1:200, Vector Labs, USA) or coupled to Alexa fluorophores (1:300,
Invitrogen). For DAB labeling, sections were additionally incubated with a pre-formed
biotin-avidin-horseradish peroxidase complex (1:100, VectorLabs). For
Author Manuscript
immunofluorescence labeling, sections were also incubated with 1% Sudan Black in 70%
ethanol, for 10 minutes, to suppress lipofuscin autofluorescence. Following washes in PBS,
sections were mounted and imaged using confocal or bright field microscopy. To quantify
immunofluorescence or DAB labeling, images were randomly acquired in selected brain
regions. Antigen-expressing areas within each neuron and in cellular compartments (such as
the nucleus) were selected using the Metamorph® image analysis system and the average
signal intensity measured. Values were corrected by subtracting the average slide
background intensity (measured outside of cells). Between 50 –100 neurons were analyzed
for each case. The investigator was blinded to sample origin or diagnosis.
For linear regression analysis of the relationship between nuclear REST and the levels of
proteins encoded by REST targets (BAX, DAXX, PSEN2, calbindin and somatostatin) (Fig.
Author Manuscript
2c, d); the activating histone mark H3K9Ac (Fig. 2c, d), or oxidative DNA damage (8-
oxoguanine) (Extended Data Fig. 4h), we performed double-label immunofluorescence for
REST (Bethyl antibody) and each individual protein or marker. Multiple 40x pictures were
acquired (at various locations) within the prefrontal cortex displaying pyramidal neurons
using an Olympus Fluoview Confocal Microscope. For cases displaying a majority of
pyramidal neurons with very high (or very low) nuclear REST levels, fields were also
included that displayed lower (or higher, respectively) REST levels, to test for potential
correlations between REST and each target. Antigen-expressing areas within each neuron
(such as the nucleus or the cytoplasm) were selected using the Metamorph® image analysis
system and the average signal intensity was measured. Values were corrected by subtracting
the average slide background intensity (measured outside of cells). Between 25 and 75
pyramidal neurons were quantified for each case for linear regression.
Author Manuscript
Image acquisition
Images were acquired using an Olympus Fluoview confocal microscope, or using a bright
field microscope coupled to a CCD camera (Diagnostic Instruments, Inc.). No image
processing was performed on the acquired images, with the exception of (i) Fig. 3c (the
haematoxylin and eosin image) and (ii) Fig, 5b (the DAPI channel in DLB and FTD panels),
which were contrasted to allow better visualization of cell nuclei.

Lu et al. Page 12
Fluorescence-activated cell sorting (FACS)

Author Manuscript
Antibodies against nuclear proteins, as well as isotype-matched control IgGs, were

preconjugated to Allophycocyanin (APC) using lightning-link APC conjugation kit (Innova
Biosciences). The monoclonal antibody against NeuN coupled to Alexa-Fluor 488
(Millipore, MAB 477X) was used for neuron-specific labeling. The antibodies and reagents
used in this study are listed in Supplementary Table 3. Approximately 1–2 μg of antibody
was added to1×106 nuclei/ml and incubated at 4°C for 12 hrs with gentle rocking in the
dark. Labeled nuclei were washed twice by centrifugation and filtered to remove clumps
before performing FACS. The DNA binding dyes DAPI or propidium iodide were used for
gating of nuclei. Aggregate discrimination was achieved based on the height, area and width
parameters for front scattering (FSC) and side scattering (SSC). The purity and identity of
isolated neuronal nuclei was further confirmed by microscopy and epigenetic analysis. For
each antibody, the geometric mean value of single-nuclei events that is above the matched
Author Manuscript
nonspecific IgG control was determined. An average of 10,000 events was acquired for
FACS analysis. For ChIP assays, ~1×106 FACS-sorted neuronal nuclei were collected by
centrifugation.
Chromatin immunoprecipitation (ChIP) and nuclear isolation

The ChIP assay protocol has been described previously41. Cells or tissue homogenates were
cross-linked using 1% formaldehyde (37% solution, sigma) at room temperature for 10min.
Then the reaction was then stopped by adding glycine (1.25M, 10X) and washed twice by
centrifugation. The cell pellet was dissolved in SDS lysis buffer (1% SDS, 10mM EDTA
and 50mM Tris-HCl, pH 8.1). The genomic DNA was sheared into 300–1000bp by
sonication (Bioruptor), followed by centrifugation. The supernatant was removed, diluted
with ChIP dilution buffer (0.01%SDS, 1.1% TritonX-100, 1.2mM EDTA, 167mM NaCl,
Author Manuscript
16.7mM Tris-HCl, pH 8.1), and pre-cleared with Protein A Sephorose beads (Invitrogen)
before adding antibody-conjugated beads. 5% of the sheared DNA was used as input
control. After incubation with rocking at 4°C for 12 hrs, chromatin bound beads were
washed twice with low salt wash buffer (0.1% SDS, 1% Triton X-100, 2mM EDTA,
150mM NaCl, 20mM Tris-HCl, pH 8.1), once with high salt wash buffer (0.1% SDS, 1%
Triton X-100, 2mM EDTA, 500mM NaCl, 20mM Tris-HCl, pH 8.1), once with LiCl wash
buffer (0.25M LiCl, 1% NP-40, 1% deoxycholic acid, 1mM EDTA, 10mM Tris-HCl, pH
8.1), and twice with TE buffer (1mM EDTA, 10mM Tris-HCl pH 8.1). The beads were then
incubated with elution buffer (1% SDS, 0.1M NaHCO3), followed by de-cross-linking at 65
°C for 5 hrs. The eluted preparation was then treated with RNase A and proteinase K
followed by isolation of DNA using the Qiagen PCR purification kit. For ChIP-PCR (Figs.
1f, 2a; Extended Data Figs. 2d, 6f), primers were directed to binding sites identified by
Author Manuscript
ChIP-seq analysis of SH-SY5Y cells.
The isolation of nuclei from human brain tissue was performed using a protocol adapted
from previously described methods42,43. Briefly, 0.5 g of frozen tissue was Dounce-
homogenized in 10 ml of NF1 hypotonic buffer (0.4% Triton X100, 0.3 M Sucrose, 5 mM
MgCl2, 0.1 mM EGTA, 1mM DTT, 10 mM Tris-HCl pH 8.0, supplemented with Complete
protease inhibitors from Roche) on ice, incubated for 30min, and then Dounce-homogenized
with 30 additional strokes. The homogenates were then centrifuged in a swinging-bucket

Lu et al. Page 13
rotor at 180g for 10 min at 4°C. The pellet was washed once with rocking at 4°C for 0.5 hr,
Author Manuscript
and then resuspended in NF1 buffer. Crude nuclei were carefully layered onto a cushion of 5
ml sucrose solution [1.2 M (40%) sucrose, 3 mM MgCl2, 1 mM DTT, 10 mM Tris-HCl, ph
8.0], and centrifuged at 4,700g for 30 min at 4°C. The isolated nuclear preparation was
resuspended in 1 ml NF2 buffer (0.1 M Sucrose, 5 mM MgCl2, 0.1 mM EDTA, 1% BSA,
10 mM Tris-HCl, pH 8.0), filtered with a 40 μm strainer (BD Falcon), and the number of
nuclei was quantified after DAPI labeling, and then diluted to a concentration of 1×106
nuclei/ml. For FACS-ChIP assays, 1g of brain tissue was Dounce-homogenized in 10 ml
PBS with protease inhibitors (Complete, Roche) using pestle A, fixed with 1%
formaldehyde for 10 min at room temperature, and then washed twice with NF1 buffer by
centrifugation and gentle resuspension. The preparation was then treated as described above
for brain tissue samples that did not undergo fixation.
ChIP sequencing
Author Manuscript
For ChIP-seq analysis, 10×15 cm2 dishes of SH-SY5Y cells at 80% confluence were
incubated in the absence or presence of 5 mM LiCl (to induce REST expression) in SH-
SY5Y cell culture medium (see “Cell cultures” below) for 12 hrs. ChIP was performed as
described above, except that genomic DNA was sheared to 150–300 bp fragments –
confirmed by agarose gel electrophoresis. For normalization and analysis of enrichment,
input controls for each sample were sequenced. ChIP-DNA (2 ng) was used for library
preparation followed by deep sequencing at the High Throughput Sequencing Facility of the
University of North Carolina. Approximately 30 million ChIP-seq reads with read length of
36 were aligned to the hg18 genome assembly using ELAND with the default parameters.
Sequence reads within REST binding sites were identified from ChIP-seq data using the
latest version of MACS44 algorithm (1.4) with the default parameters. Genes that harbor
Author Manuscript
REST binding sites within 10 kb of transcription start sites with at least 3-fold enrichment
relative to the input control, statistical q-value<0.01 and P-value<1E-5 were considered as
putative REST targets. Binding sites showed the canonical RE1 motif45, as well as
previously identified noncanonical REST-binding motifs46,47 (Supplementary Information
Table 4a, b). Fisher’s exact test was used to assess the statistical significance of the overlap
between REST targets and genes that are age-regulated in the human prefrontal cortex.
REST-deficient mice
Animal housing and experimental procedures were approved by the Institutional Animal
Care and Use Committees of Harvard Medical School. Mice carrying floxed alleles of REST
flanking exon 2 were described previously48. These mice were crossed to Nestin-Cre
transgenic mice (Jackson laboratory; strain No. 003771) to achieve REST conditional
Author Manuscript
inactivation in the nervous system. The Nes-Cre transgene is in the C57BL/6J background,
and the RESTlx/lx alleles were in a hybrid C57BL/6J and 129Sv/Ev background. The
resulting Nestin-Cre:RESTlx/lx conditional knockout mice (hybrid C57BL/6J and 129Sv/Ev
background), referred to as REST cKO, were born at expected Mendelian ratios, were viable
and fertile, and did not display any visible alterations. The control group included RESTlx/lx
and Nes-Cre mice. Mouse genotyping by PCR was performed using the following primers to
amplify a region in the REST gene flanking exon 2: re08 (5’–
CATGCGAGTACTGCCATACCCAAC-3’), re09 (5’–

Lu et al. Page 14
GTGATGGGGCAGTCTTCTGGAGG–3’), and re11 (5’–

Author Manuscript
GGGCACACCTTTAATCCTAGCTTC–3’); this allowed the identification of WT (220 bp),

floxed (264 bp) or recombined (375 bp) REST alleles48. The experimental groups included
both male and female mice. The REST cKO and REST+/+ control groups were composed of
littermate mice (same genetic background). Mice were identified by eartag numbers, and
were randomly selected for histological processing (perfusion, brain dissection, etc.). The
investigator was blind to age and genotype.
Immunohistochemical and histological analysis of mouse brain

Mice were anesthetized with isofulorane and carbon dioxide and then perfused with cold
PBS buffer for 20 minutes. Brains were rapidly removed and placed in 4% PFA overnight.
They were then processed for paraffin embedding, according to standard procedures.
TUNEL labeling was performed following manufacturer’s instructions. For quantification of
Author Manuscript
neuronal density, randomly selected areas within the hippocampus or the cortex, and at
various depths within these structures, were imaged at 20x magnification. The number of
cells (using either haematoxylin and eosin or NeuN labeling) was determined using the
Metamorph® image analysis software and was then divided by the area occupied by these
cells. The investigator was blind to the genotype.
Cell culture
REST cKO embryos and littermate controls were used to establish primary cortical and
hippocampal cultures as described previously49. Each embryo was individually genotyped
by PCR. Moreover, PCR analysis of DNA isolated from primary E16 embryonic neurons
confirmed the excision of the REST floxed allele by Cre, in contrast to DNA derived from
embryo tails. qRT-PCR was performed on the corresponding neuronal cultures or brain
Author Manuscript
samples for genotype confirmation (RT-PCR: Forward primer: 5′-

CTTTGTCCTTACTCAAGCTCTC-3′ Reverse primer: 5′-
TTCCTGAGACTCGTTTTCAGCC-3′ Product size is 2034 bp).
Embryonic cultures from E16 fetuses were plated on either coverslips or culture dishes that
were pre-coated with both poly-D-lysine (Beckton-Dickinson) and laminin, and maintained
in serum-free neurobasal medium containing B27 supplements and GlutaMAX.
Hippocampal cultures (7 days in vitro (DIV)) or cortical cultures (14 DIV) were treated with
either oligomeric Aβ42 for 24 hrs or H2O2 for 5 hrs. Oligomeric Aβ was prepared as
described previously50 and confirmed by SDS gel electrophoresis with and without boiling.
Neuronal differentiation was comparable in REST cKO and control cultures after 1–2 weeks,
as indicated by immunofluorescence labeling with antibody Tuj1 (MAB1637, Millipore),
and Western blotting for the neuronal differentiation marker NeuN (MAB377, Millipore).
Author Manuscript
The SH-SY5Y neural cell line was maintained in Dulbecco’s Modified Eagle Medium
(DMEM) with 4.5 mg/L D-glucose, 2 mM L-glutamine, 1 mM sodium pyruvate, 100 U/mL
penicillin, 100 μg/mL streptomycin (all from Invitrogen), supplemented with 10% fetal
bovine serum. To induce autophagy, SH-SY5Y cells were maintained in serum-free Opti-
MEM medium (Invitrogen) for 24 hrs, and then treated with inhibitors (5 mM 3-
methyladenine or 150 nM bafilomycin) or maintained in Opti-MEM without inhibitors for

Lu et al. Page 15
an additional 16 hrs prior to fixation and imaging. The cells did not show morphological
Author Manuscript
changes or evidence of reduced viability under these conditions. Human cortical neuronal
cultures (HCNC) were established as previously described51, and were maintained in
neurobasal media with 2 mM L-glutamine and B27 supplements (Invitrogen). Mature
HCNCs (14 DIV) were used for experiments. B27 supplements without added antioxidants
were used for oxidative stress-related experiments.
Assessment of cell viability and apoptosis

Cell viability was assessed using a chromogenic assay that involves the biological reduction
by viable cells of the tetrazolium compound 3-(4,5-dimethylthiazol-2-yl)-5-(3-
carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS). Cells were seeded in
either 48- or 96-well plates and treated at 80% confluence. After adding MTS to culture
medium and incubating for 2 hrs in the dark at 37°C, absorbance was measured at 490 nm
Author Manuscript
against a blank control with a plate reader. For detection of apoptotic cells, cells were
incubated with Annexin V, Allophycocyanin Conjugate (APC Annexin V, Invitrogen) for 15
mins in 1x binding buffer (10 mM HEPES pH7.4, 0.14 M NaCl, 2.5 mM CaCl2). Cells were
washed twice by centrifugation and resuspension and analyzed immediately by FACS.
Analysis of reactive oxygen species (ROS)

ROS levels were measured using the cell-permeable fluorescent indicator CellROX® Deep
Red (#C10422, Invitrogen) with detection by FACS. SH-SY5Y cells were incubated in the
absence or presence of hydrogen peroxide for 1 hr, which was removed followed by
centrifugation and resuspension twice. The cells were then incubated with the CellROX
Deep Red reagent for 30 mins at 37°C, placed on ice and then analyzed by FACS.
Author Manuscript
Immunocytochemical analysis of cultured cells

Cells plated on laminin/polylysine-coated coverslips were fixed by incubation with 4% (v/v)
paraformaldehyde in PBS for 30 minutes at room temperature, followed by three washes in
PBS, and then permeabilized with 0.1% Triton X-100 in PBS for 15 minutes at room
temperature. After 3 additional washes in PBS, cells were blocked with 10% goat serum in
PBS for 1 hour at room temperature. Primary antibodies were diluted to the appropriate
concentration using 10% goat serum, and incubated overnight at 4°C. Cells were then
washed 3 times in 1% goat serum in PBS for 10 minutes before adding fluorophore-
conjugated secondary antibodies for 2 hours at room temperature. Fluorophore labeled cells
were then washed in 1% goat serum in PBS for 3×10 minutes, and then mounted using
Prolong Gold mounting medium with DAPI and anti-fade reagent (Invitrogen). To score
endogenous nuclear REST in SH-SY5Ycells, Pearson correlations between DAPI and REST
Author Manuscript
were generated from 200–300 cells from multiple coverslips using confocal analysis
software. A threshold of R>0.6 was used to indicate positive nuclear localization.
Single cell gel electrophoresis (comet assay)

SH-SY5Y cells were treated with 100 μM hydrogen peroxide for 20 min at 4°C and then
suspended in PBS containing 1 mM EDTA on ice. The alkaline comet assay was then
performed using the CometAssay HT kit (Trevigen) according to the manufacturer’s

Lu et al. Page 16
protocol. The percentage of DNA in the comet tail was measured in 114–132 cells for each
Author Manuscript
sample using CometScore image analysis software (TriTek).
Generation of cell-conditioned medium and cortical extracts

For conditioned medium transfer experiments (Extended Data Figs. 6g,h and 7a, b), cells
were incubated with stress-inducing agents, followed by removal of the medium and 2
changes of fresh medium prior to the final addition of conditioning medium. After a 6 hr
incubation period, the medium was removed and centrifuged twice to remove suspended
cells or debris. The medium was then transferred to a new well containing naïve cells. After
a 10 hr incubation period, the treated cells were harvested and analyzed. To generate
extracts of human prefrontal cortex, ~200 mg cortical grey matter tissue samples were gently
homogenized on ice using a Dounce A pestle in 2 ml of cell culture medium supplemented
with protease inhibitors (Complete, Roche). Brain extracts were cleared by sequential
Author Manuscript
centrifugation and resuspension (2×110g, 2×2,700g and 20,000g spin, each for 10 min at
4°C). The tissue extracts were normalized to the DNA concentration of the starting material,
and added to cultured SH-SY5Y cells at 25% of total medium volume.
Generation of recombinant lentiviruses

Viral particles were generated in HEK293T cells by co-transfection of transfer vectors,
packaging plasmid (pRSV-REV and pMDLg) and envelope plasmid (pCMV-VSVG) using
Lipofectamine 2000 (Invitrogen). Cells were cultured for 2 days and the medium was
collected, centrifuged at 180 g for 5 min, and passed through a 0.45 μm low protein binding
filter (VWR). Viruses were then centrifuged at 110,000 g for 2 hrs at 4°C (Beckman SW28)
and then resuspended in 200 μl of PBS. Viruses were titered by infecting SH-SY5Y cells at
serial dilution. The percentage of transduced cells, identified by enhanced green fluorescent
Author Manuscript
protein (EGFP) fluorescence, was measured by flow cytometry 72 hrs post-infection. Cells
that express REST-IRS-GFP were sorted into low, middle and high expression populations
based on GFP intensity, and the corresponding REST levels were determined by qRT-PCR.
C. elegans strains
The N2 Bristol strain was used as the wild-type background for these studies. C. elegans
strains were cultured at 20°C under standard conditions52. The following mutations and
chromosome rearrangements were used: LGI: spr-4(by105) 53, spr-4(tm465) (this study),
daf-16(mu86)54, hT2[bli-4(e937) qIs48] (I;III); LGII: sod-1(tm776)55; LGV: spr-1(ok2144);
and LGX: spr-3(ok2525) (this study). All strains, except for spr-4(tm465), were provided by
the Caenorhabditis Genetics Center (CGC), which is funded by the NIH Office of Research
Infrastructure Programs (P40 OD010440). Strains obtained from external sources which had
Author Manuscript
been outcrossed previously were outcrossed to our N2 strains twice. Worms which had not
been outcrossed previously were outcrossed six times.
C. elegans RNAi
RNAi feeding experiments were performed at 20°C. HT115 bacterial clones from a C.
elegans RNAi feeding library (Geneservice) were used for spr-4 (C09H6.1), sod-1
(C15F1.7), and sod-2 (F10D11.1). Control RNAi was performed by feeding HT115 bacteria

Lu et al. Page 17
carrying the empty pL440 vector. Clones were sequence validated and knockdown was
Author Manuscript
confirmed by semi-quantitative RT-PCR. The TU3270 (uIs57 [Punc-119::sid-1+

Punc-119::YFP+Pmec-6::mec-6]) strain was also used to assess neuronal loss-of-function56.
C. elegans microinjection and transgenic strains

Transgenic C. elegans lines were generated by microinjecting the relevant constructs into
the gonads of the indicated strains. Prab-3::mCherry (pGH8, Addgene: 19359) was used as
a coinjection marker labeling neurons. Three independent lines that demonstrated reliable
transmission of the marker were propagated as described above for each experiment.
Transgene expression was verified by qRT-PCR (see below), using primers that spanned
exon junctions for spr-4 or human REST, normalized for possible DNA carryover by using
two pairs of primers to the ampicillin resistance gene (present in all plasmids) and a specific
site in pD152.79 (see table below for primer sequences). The spr-4 transgene was
Author Manuscript
overexpressed by 18–24-fold relative to endogenous spr-4 expression in wild-type worms.

The human REST transgene was expressed at levels comparable to the cdc-42 housekeeping
gene.
To analyze RNA from transgenic lines, 100 Prab-3::mCherry positive worms (24 hours
post-L4) of each strain (including controls) were placed into 1.5 ml M9 buffer. Worms were
washed once in M9, pelleted by centrifugation, resuspended in 200 μl Trizol, vortexed for 2
minutes and flash frozen in liquid nitrogen. Worms were then freeze-cracked by thawing in
a 37°C water bath and re-freezing in liquid nitrogen. This was repeated 2 more times. After
the final thaw, 100 μl of Trizol was added and the tubes were maintained at room
temperature for 5 minutes. RNA was then extracted with 140 μl of chloroform, precipitated
with an equal volume of 70% ethanol and transferred to an RNeasy spin column (Qiagen)
and purified. Quantitative RT-PCR was performed directly from isolated RNA, using 1ng of
Author Manuscript
RNA and the Qiagen One Step qPCR mix. All reactions were performed in triplicate.
Analysis of Aβ toxicity in C. elegans

The UA198 Aβ-expressing strain (baIn34 [Peat-4::Abeta42, Pmyo-2::mCherry];
adIs1240[Peat-4::GFP]) was provided by the Caldwell lab57. This strain was crossed to
wild-type males, and the resulting male progeny were crossed to spr-4(by105) homozygotes.
Single F1 progeny bearing both fluorescent markers were each placed on individual plates
(singled) and the subsequent F2 generation was singled and genotyped for spr-4.
Homozygous spr-4(by105) mutants were then singled for several generations to ensure
homozygosity of the transgenes before analysis. To assess toxicity of the Aβ42 transgene,
worms were synchronized by transferring 8–10 young adults (24 hours post-L4) to a fresh
plate, and allowing them to lay eggs for 12–14 hours. The adults were then removed and
Author Manuscript
eggs were allowed to hatch at 20°C. Worms were then aged by transferring adults to fresh,
seeded plates every other day. At days 3 and 7 of adulthood, approximately 25–40 worms
were immobilized with sodium azide on 2% agarose pads on slides. Confocal z-sections
covering the entire depth of the worms were taken on an Olympus Fluoview Confocal
Microscope using the 488 laser and a GFP filter. The image files were then assigned to
randomly named folders to blind the scoring of the number of tail neurons per worm.
Control and mutant worms were always hatched, grown, aged and imaged in parallel, and

Lu et al. Page 18
the assay was repeated three times. Statistical significance was assessed by paired t-test on
Author Manuscript
both the distribution of neuronal number and the mean percent of the population without
neurodegeneration.
SPR-4 localization and induction by paraquat

To create SPR-4::GFP transgenic animals, unc-119(ed3) worms were bombarded with a
cosmid that had been subjected to recombineering to introduce a GFP cassette onto the last
exon of spr-4, creating a C-terminal fusion. Wild-type moving worms were isolated and
singled. GFP signal was examined by confocal microscopy and worms with a bright,
reproducible, and stable fluorescence were propagated. As described for the stress assay,
worms were then transferred to plates containing either 5 mM paraquat and 100 μg/ml
fluorodeoxyuridine (FUdR) or FUdR alone. On day four of treatment, worms were mounted
on 2% agarose pads with sodium azide, and imaged by confocal microscopy at 60x
Author Manuscript
magnification with a 1.5x digital zoom and 488 laser and GFP filter. z-stacks were taken
throughout the head and tail regions of the worms, and fluorescence intensity of the punctate
GFP signal was analyzed in ImageJ58. To assess statistical significance, a paired t-test
between control and treated fluorescence intensity distributions was performed. Images were
taken for at least 15 worms for each condition and each strain was analyzed in an
independent paraquat treatment. For localization, SPR-4::GFP transgenic animals were
mated to wild type males carrying the Prab-3::mCherry extrachromosomal array, and
images were taken by confocal microscopy.
ROS detection in C. elegans

To measure ROS levels, 100 4-day old adult worms, grown as described for the paraquat
survival assays, were transferred to Eppendorf tubes containing 1.5 ml of M9 buffer, washed
Author Manuscript
once in M9, and then stained for 1 hour in 500 μl of M9 containing 25 μM 2′,7′-
dichlorodihydrofluorescein diacetate (DCFDA, Life Sciences/Invitrogen) while rotating in
the dark. Worms were then washed once with M9, and transferred to 1.5% agarose pads on
glass slides, covered, and immediately imaged within 1 hour of washing out the DCFDA.
Imaging was performed on an Olympus Fluoview Confocal Microscope using the 488 laser
and GFP filter. At least 15 images were taken per genotype per replicate. Images were
analyzed in ImageJ, where average intensity of the head region above the terminal
pharyngeal bulb was scored and plotted using the boxplot function in R.
REST cDNA constructs and shRNAs

The pHAGE-CMV-Flag-REST-IRES-ZsGreen and pHAGE-CMV-ZsGreen plasmids were
generously provided by Peter Mulligan59,60. The cDNA for wild type mouse REST in the
Author Manuscript
pCS2+MT vector61 was amplified by high fidelity PCR with BamH I and EcoR I restriction
sites at 5′ and 3′ ends, respectively. The PCR amplicon was digested with BamH I and EcoR
I followed by gel purification and ligation into the FUGW lentiviral vector driven by the
human ubiquitin C gene promoter62, and sequence verified. To generate the nuclear
translocation-defective mutant ΔREST (Fig. 3a, b), a nuclear localization signal (amino
acids 515–525)63 and the fifth zinc finger motif (amino acids 294–324)64 were deleted by
high fidelity PCR using primers listed in Supplementary Table 2. The restriction site Xba I

Lu et al. Page 19
replaces amino acids 515–525 and adds two new amino acids Ser-Arg. The restriction site
Author Manuscript
Nhe I replaces amino acids 294–324 and adds two new amino acids Ala-Ser.
Short-hairpin RNAs against human REST were expressed from the lentiviral plasmid pGIPZ
(Open Biosystems). Mature antisense sequences of effective shRNAs are
TCGATTAGTATTGTAGCCG (663–681) (shRESTa) and TTTGAACTGTAAATATCTG
(392–410) (shRESTb). Numbers in parenthesis indicate the position of mature antisense
sequences corresponding to the coding domain sequence (CDS) of human REST (3294 bp).
As a control, the GIPZ non-silencing shRNAmir was used (Open Biosystems).
For C. elegans studies, full length spr-4 was isolated from fosmid DNA (WRM0628bF09,
from the Sanger Institute collection) by PCR amplification with primers specific to the
promoter regions (1.5 kb upstream of the transcriptional start site) and the UTR. The PCR
product was sequence verified and used directly for injection. Human REST was isolated
Author Manuscript
from cDNA and cloned into the vector pD152.79 MCS, downstream of the dpy-30 promoter
and upstream of GFP. Sequencing verified the correct reading frame. The SPR-4::GFP
fusion fosmid used in bombardment (Clone: 3167840880351681 C09) was provided by the
Transgenome consortium65. Primers for sub-cloning are listed in Supplementary Table 2.
Statistical Analysis
Statistical analysis was performed using Graphpad software and the R program. Student’s t-
tests were used to make comparisons between two groups with a normal distribution of data
points. The Mann-Whitney-Wilcoxon Test was used for multiple samples without
knowledge of their distribution. Age-related gene expression changes were identified by the
Significant Analysis of Microarray (SAM) in R program. SAM identifies differentially
expressed genes between young adult (less than 40 yrs, n=12) and Aged (greater than 70 yrs,
Author Manuscript
n=16) by carrying out gene specific t-tests. Power analysis was used to ensure adequate
statistical power for detecting significant differentially expressed genes in the microarray
analysis. For sample n>12 in each group, there is 80% power to detect 1.5-fold changes at p-
value < 0.01. We therefore report significant age-related gene expression changes using the
cutoff q-value < 0.01 and fold change > 1.5. The overlap of age-regulated genes with REST
targets genes identified by ChIP-seq was assessed using the Hypergeometric test (p-
value=1.65E-12). Age-down-regulated genes are enriched in ChIP-seq targets based on the
binomial test (p-value=3.5E-7). Pathway and upstream regulator enrichment for age-
regulated genes and ChIP-seq target genes were analyzed by the Hypergeometric test using
Ingenuity pathway analysis (IPA). Pearson’s correlation is used in this paper. By the central
limit theorem, the distribution of the correlation coefficient is asymptotically normally
distributed when the sample size is sufficiently large (n>30). Hence, the p-value for the
Author Manuscript
Pearson’s correlation coefficient for Figures 6a, b, and d are calculated based on the normal
distribution. Figure 6a shows plots for REST protein levels vs. cognitive test scores for
multiple individual subjects. The correlation coefficient between REST protein level and
cognitive variables are calculated based on n=111. Figure 6b shows a plot of REST protein
level vs. Braak Score. The correlation coefficient between REST protein level and Braak
Score is calculated based on n=37. Figure 6d shows a plot of REST protein level vs. age at
death. The correlation coefficient between REST protein level and age is calculated based

Lu et al. Page 20
on n=61. Extended Fig. 2a compares the weighted mean expression level of REST target
Author Manuscript
genes vs. age at death. Each point represents the mean of weighted expression of 342 REST
target probe-sets that are age-regulated based on microarray. These mean values were
weighted by the total expression level for each probe-set across all samples and were further
normalized to the youngest adult value (24 yrs; 100%).
Extended Data
Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 1. Neuroanatomical distribution of REST induction in the aging human
brain
a. Representative confocal photomicrographs of hippocampal CA1 pyramidal neurons
(upper panel), dentate gyrus granule neurons (middle panel, DG) and cerebellar Purkinje and

Lu et al. Page 21
granule cell neurons (lower panel), from young, aged or AD cases that were labeled for
Author Manuscript
REST (green). Note the increased expression of REST in hippocampal CA1 pyramidal and
dentate granule cell neurons in aged cases relative to young adult cases. Also note that
nuclear REST is markedly reduced in AD in hippocampal CA1 neurons, but not in dentate
granule cell or cerebellar neurons. b. Specificity of REST immunohistochemistry. Shown
are sections of normal aged PFC labeled with anti-REST (Bethyl) (upper panel), anti-REST
preincubated with a REST blocking peptide (middle panel), and non-specific IgG (lower
panel). REST labeling is green; nuclear labeling with DAPI is blue. c. REST knockdown
(REST shRNA) and overexpession (REST-OE) in SH-SY5Y cells confirm antibody
specificity. Also shown is labeling with antibody preincubated with REST blocking peptide
(REST-OE+blocking). REST knockdown and overexpression were confirmed by Western
blotting (Extended Data Fig. 3b). d. Quantification of nuclear REST levels in hippocampal
CA1, CA3, CA4 regions, in dentate gyrus granule cells (DG), and in cerebellar Purkinje cell
Author Manuscript
neurons. REST is induced with age in CA1, CA3, CA4 and DG neurons, but not in
cerebellar neurons. REST expression is reduced in AD in CA1, CA3, and CA4 neurons, but
not in DG or cerebellar neurons. CA1: young n=11, aged n=30, AD n=33. CA3, CA4, DG
and cerebellum: young n=8–9, aged n=7–8, AD= 9–10. Values are the mean ±S.E.M., *
p<0.05, ** p<0.01 and *** p<0.001 by Student’s unpaired t-test. Scale bar: 25 μm.
Author Manuscript
Author Manuscript

Lu et al. Page 22
Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 2. ChIP-seq analysis of REST target genes shows enrichment for genes
related to cell death and the pathology of AD
a. Genes identified by REST ChIP-seq in SH-SY5Y cells are downregulated in the aging
Author Manuscript
human PFC. Expression of age-regulated REST target genes identified by ChIP-seq shows a
highly significant inverse correlation with age at death. For each case, a weighted expression
index was derived for age-regulated target genes based on microarray analysis. These values
were normalized to the youngest adult value (24 yrs; 100%). N=43, age range 24–106 yrs. b.
Canonical pathways by Ingenuity IPA analysis of REST ChiP-seq targets. c. REST ChIP-
seq binding peaks in genes related to cell death pathways and AD pathology. d.
Confirmation of ChIP-seq targets by quantitative ChIP-PCR following REST

Lu et al. Page 23
overexpression (OE-REST) or REST knockdown (sh-RESTa and sh-RESTb) in SH-SY5Y

Author Manuscript
cells. Shown is ChIP followed by real time PCR using primers that amplify REST binding
sites identified by ChIP-seq. PCR amplification of a region of the actin promoter not
proximal to a known RE1 site was used as a negative control. Values are normalized to the
input control and represent the mean±S.E.M., n=3. *P<0.05 relative to control by Student’s
unpaired t-test.
Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 3. REST regulates expression of genes related to cell death and the
neuropathology of AD
a. REST knockdown with either of two distinct shRNAs (sh-RESTa and sh-RESTb)
significantly increase mRNA expression of ChIP-seq targets related to cell death and AD

Lu et al. Page 24
pathology, whereas REST overexpression (REST) represses gene expression. Values are the
Author Manuscript
mean ± S.D., n=3. *P<0.05 by Student’s unpaired t-test. b. Shown are Western blots of
lysates from SH-SY5Y cells transduced with a control lentiviral vector (CTRL), or 3
separate REST shRNAs (sh-REST; each lane represents a different shRNA) or REST cDNA
(REST) to knockdown or overexpress REST, respectively. c. REST knockdown (sh-REST)
markedly induces phosho-tau epitopes (PHF-1 and AT8). Induction of these epitopes is
blocked by lithium chloride (LiCl), an inhibitor of the tau kinase GSK3β.
Author Manuscript
Author Manuscript
Extended Data Fig. 4. REST protects against oxidative stress

a. Cortical neuronal cultures from REST-deficient (REST cKO) mice show extensive
neuritic degeneration relative to control cultures after incubation with 5 μM oligomeric
Aβ42 for 24 hrs, which is prevented by lentiviral transduction of REST (REST cKO +
REST). Neuritic processes are labeled with antibody TUJ1. Scale bar: 30 μm. b. Pro-
Author Manuscript
apoptotic genes show increased mRNA expression in REST-deficient cortical neuronal

cultures after treatment with hydrogen peroxide (50 μM H2O2, 3 hrs) or oligomeric Aβ42 (5
μM, 8 hrs). Increased expression was reversed by lentiviral transduction of REST (REST
cKO+REST). Values are the mean ±S.E.M., n=4. *P<0.05 by Student’s unpaired t-test. c.
REST knockdown potentiates hydrogen peroxide-induced apoptosis in SH-SY5Y cells.
Increased cell death was prevented by transducing a REST construct (mouse REST)
resistant to the shRNA. Cells were incubated with 800 μM H2O2 for 2 hrs, and apoptotic

Lu et al. Page 25
cells were quantified by FACS analysis of Annexin V-APC. Values represent fold change
Author Manuscript
relative to the untreated control. d. REST knockdown (Sh-REST) increases vulnerability to

oxidative stress in cultured primary human cortical neurons treated with 100 μM H2O2 for 2
hrs relative to control cultures (Sh-CTRL). e. REST knockdown increases generation of
reactive oxygen species (ROS). Shown are FACS profiles of a fluorescent ROS indicator
(CellRox). Note right-ward shift (increased ROS) in H2O2-treated (600 μM, 2 hrs) SH-
SY5Y cells (red) vs untreated controls (blue) following lentiviral transduction of REST
shRNA (Sh-REST). f. Increased ROS levels in SH-SY5Y cells expressing either of two
different REST shRNAs (sh-RESTa and sh-RESTb) is reversed by the antioxidant N-acetyl
cysteine (NAC, 5 mM). g. REST protects against oxidative DNA damage. Shown is a
measure of DNA fragmentation in the Comet Assay following treatment of SH-SY5Y cells
with H2O2. Note increase in DNA damage induced by either of two REST shRNAs (Sh-
RESTa and Sh-RESTb) relative to cells transduced with a control shRNA (Sh-CTRL).
Author Manuscript
Conversely, overexpression of REST reduces oxidative DNA damage relative to

overexpression of GFP (CTRL). Horizontal bars indicate the mean value. **P<0.0001 by the
Mann-Whitney test; n=114–134. Values in b, c, d and f represent the mean ± S.E.M, n=6–
10, *P<0.05, **P<0.01 by Student’s unpaired t-test. h. Inverse correlation between oxidative
DNA damage and nuclear REST levels in normal aging and early AD (AD1). Shown is
double-labeling for REST and 8-oxoguanine (8oxoG) in hippocampal CA1 neurons. Scale
bar, 20μm.
Author Manuscript
Author Manuscript

Lu et al. Page 26
Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 5. Caenorhabditis elegans spr genes and oxidative stress resistance
Author Manuscript
a. Mutations of spr-1, spr-3 and spr-4 reduce survival in the presence of oxidative stress.
Worms were continuously incubated with the superoxide-generating agent paraquat (5 mM).
Shown are representative time courses of survival, and quantification of reduced mean
lifespan relative to wild-type in worms incubated with paraquat. Shown are mutants in spr-1
and spr-3, two different mutants in spr-4, and a double spr-3/spr-4 mutant
[spr-4(by105);spr-3(ok2525)]. The spr-4(by105);spr-3(ok2525) mutant showed similar
survival to wild-type in the absence of paraquat. Values represent the decrease in mean

Lu et al. Page 27
lifespan as % relative to wild-type and represent the mean ± S.D., n=3. *P<0.05 by log-rank
Author Manuscript
test. b. Depletion of spr-4 by RNAi increases sensitivity to oxidative stress and phenocopies
the spr-4(by105) mutation. Worms were fed RNAi against the indicated genes or an empty
vector control and then transferred to plates seeded with standard OP50 bacteria and
containing 5 mM paraquat. Shown is the percent decrease in mean survival relative to the
empty vector control from 3 independent experiments. Two spr-4 RNAi-expressing bacterial
strains were used (Methods). In addition to N2, we also utilized a C. elegans strain
(TU3270) with enhanced dsRNA uptake in neurons (Methods). One of the spr-4 RNAi
strains generated a significantly greater reduction in survival in the TU3270 background
compared with N2. The paraquat sensitivity of worms fed RNAi against the antioxidant
gene sod-1 was used as a positive control. Values are the mean ± S.D., n=3. *P<0.05 by log-
rank test. c. A stably integrated SPR4::GFP construct under the control of the endogenous
spr-4 promoter is expressed predominantly in neurons in adult worms, as indicated by co-
Author Manuscript
localization with the neuronal marker prab-3::mCherry. Upper panels: pharyngeal ring
neurons; lower panels: tail neurons. Scale bar: 20 μm. d. Treatment of adult worms with
paraquat (+PQ) from day 1 to day 4 induces expression of SPR4::GFP. Untreated worms
(−PQ). Upper panels show confocal imaging of a representative strain; the lower panel
graph shows quantitative analysis of SPR4::GFP expression in 3 separate strains. Horizontal
bars indicate the median; boxed areas represent the second and third quartiles. n=3 (15
worms each); ***P<0.001 by unpaired t-test. e. REST represses expression of the presenilin
hop-1 in C. elegans. Expression of hop-1 mRNA was measured by qRT-PCR in 24-hour
post L4 worms of the indicated genotypes. For each replicate, transcript values were
normalized to cdc-42. Note that hop-1 mRNA expression is increased in the spr-4(by105)
mutant, and that repression is partially restored by wild-type spr-4 or human REST (REST).
Values represent fold change relative to the wild-type control (1) and represent the mean ±
S.D., n=3. *P<0.05 by Student’s t-test. Scale bars, 20μm.
Author Manuscript
Author Manuscript

Lu et al. Page 28
Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 6. Induction of REST by stress and cell non-autonomous signaling
a–d. Redox-active Fe+2 (15 μM), Aβ42 (15 μM), H2O2 (indicated concentrations), and the
glutathione synthesis inhibitor BSO (50 μM) increase REST protein levels in primary human
cortical neuronal cultures. Shown are Western blots for REST and actin. e. REST mRNA
levels determined by qRT-PCR. f. Treatment of human neurons with Fe+2 or Aβ42 increase
REST-RE1 site binding in the SNAP25 and calbindin 1 genes as determined by ChIP-qPCR.
g. REST mRNA levels measured by qRT-PCR after addition of conditioned medium from
H2O2-treated (30 μM- H30, 100 μM-H100, 300 μM-H300, 600 μM- H600, 800 μM- H800)
or control neuronal cultures (CTRL CM) to naïve neurons. h. Extracts from aged human
PFC (O) induce REST when added to SH-SY5Y cells. Much lower levels of induction are
induced by extracts derived from young adult (Y) or AD cortex. Shown are Western blots
Author Manuscript
for REST, β-catenin and β-actin. Values in e-g represent the mean±S.D.,
n=3. *P<0.05, **P<0.01 by Student’s unpaired t-test.

Lu et al. Page 29
Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 7. Induction of REST by Wnt signaling

a. Cell non-autonomous induction of REST by aged brain extracts is partially inhibited by
the Wnt antagonist Dickkopf (DKK). Extracts were derived from young adult (Y), aged (O)
or AD PFC of the indicated ages and then incubated with SH-SY5Y cells in the absence (−)
or presence (+) of DKK (250 ng/ml). b. Conditioned medium transferred from SH-SY5Y
cells, treated with either wortmannin (2 μM), tunicamycin (2 μM), H2O2 (100 μM) or LiCl
(10 mM), induce REST when added to naïve cells, which is inhibited by DKK. c. REST
levels are increased by treatment of SH-SY5Y cells with Wnt 3a or 7a (250 ng/ml, 16 hrs;
upper Western blot), and by LiCl (5 or 10 mM, 6 hrs) or Chiron 99021 (20 nM, 6 hrs) (lower
Author Manuscript
Western blot).
d. REST ChIP-seq shows that the Wnt activator LiCl (5 mM) broadly increases REST
binding to target genes. Shown are REST targets P<10−5 with REST-RE1 site binding
within 10 kb of the transcription start site. They include genes related to AD pathology, such
as the gamma secretase presenilin-2 (PSEN2), and pro-apoptotic genes (PUMA, BAX,
DAXX, TRADD and BCL2L11). e, f. SH-SY5Y cells incubated with LiCl (10 mM, 24 hrs) or
Chiron 99021 (100 nM, 24 hrs) exhibit increased nuclear REST. Nuclei are stained dark

Lu et al. Page 30
blue with DAPI, which become light blue when there is overlap with the green REST
Author Manuscript
staining (e). Quantitative analysis of % REST-positive nuclei (f). g. Increased nuclear β-

catenin in the PFC in normal aging, and reduced levels in AD. Shown is FACS analysis of
neuronal nuclei isolated from PFC. Values are the mean±S.E.M. *P<0.05, **P<0.01 by
Student’s unpaired t-test. Young, n=13; Aged, n=18; AD, n=10. h. Co-localization of REST
and β-catenin in the nucleus of aging neurons in the PFC. Aged and AD cases were double-
labeled for REST (green) and β-catenin (red). Scale bars, 20μm.
Author Manuscript
Author Manuscript
Extended Data Figure 8. Autophagy and REST

a. REST is distributed in a vesicular punctate distribution in the cytoplasm of cortical
neurons in AD. Confocal immunofluorescence microscopy shows co-localization of REST
Author Manuscript
with the autophagosome markers LC3, Atg 7 and Atg 12, but not with the lysosomal
markers LAMP-1 or LAMP-2. b. Nuclear REST levels are reduced by activation of
autophagy. SH-SY5Y cells were subject to serum withdrawal (-FBS, 40 hrs) to induce
autophagy and maintained in Opti-MEM to preserve cell viability. Note that serum
withdrawal results in depletion of nuclear REST (loss of green labeling that overlaps with
the blue DAPI nuclear stain), which is restored by bafilomycin (-FBS/Baf). c. The
autophagy inhibitors 3-methyladenine (3-MA, 5 mM) and bafilomycin (Baf, 150 nM)

Lu et al. Page 31
increase nuclear REST. Values represent % of cells positive for nuclear REST, and represent
Author Manuscript
the mean ± S.E.M., n=3; **P<0.01 by Student’s t-test. Scale bars: 15 μm.
Author Manuscript
Author Manuscript
Extended Data Figure 9. Neuronal REST levels are positively correlated with cognitive function
and inversely correlated with AD neuropathology
a. Linear regression analysis shows that nuclear REST levels in PFC neurons are positively
Author Manuscript
correlated with measures of cognition function. REST levels were determined by FACS
analysis of isolated PFC neuronal nuclei. Each point represents an individual case, and is
normalized as fold change relative to the mean value of the young adult group. N=37, age
range 67–90 yrs. b. Nuclear REST levels in prefrontal cortical neurons decrease with
increasing AD pathology. Shown are CERAD (1-frequent plaques, 2–3 sparse/moderate
plaques, 4-no plaques) and NIA-Reagan scores (composite index of neuritic plaques and
neurofibrillary tangles; 1-high likelihood of AD, 2-intermediate likelihood, 3-low

Lu et al. Page 32
likelihood). Values are the mean±S.E.M. CERAD 1, n=20; 2–3, n=11; 4, n=9; NIA-Reagan
Author Manuscript
1, n=12; 2, n=14; 3, n=14. * p<0.05, *** p<0.001.

Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 10. REST, longevity and stress resistance

a. Prefrontal cortical (upper panel), hippocampal CA1 (middle panel) and cerebellar (lower
panel) sections of individuals ranging in age from 57–102 years were double-labeled for
REST (green) and the neuronal marker MAP2 (red). Cases with extreme longevity (98, 102
years) are associated with marked induction of REST in prefrontal cortical and hippocampal
CA1 neurons, but not in cerebellar Purkinje cell (ovals) or granule cell neurons (to the right
of the dashed line). Scale bar: 20 μm. b. REST increases the expression of genes associated

Lu et al. Page 33
with stress resistance and longevity. Shown are fold changes in mRNA levels for catalase
Author Manuscript
(CAT), superoxide dismutase (SOD1) and FOXO1a (FOXO1) following REST knockdown
(sh-RESTa or sh-RESTb) or overexpression (REST). Values represent the mean
±S.D., *P<0.05 by Student’s unpaired t-test. n=3. c. FOXO1a expression is dependent on
REST. Western blotting of SH-SY5Y cells shows that shRNA-mediated REST knockdown
(sh-REST +) almost completely abolishes FOXO1a protein, which is prevented by shRNA-
resistant mouse REST.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgments
Author Manuscript
We thank members of the Yankner laboratory for suggestions and discussion, Monlan Yuan, Allison Harwick,
Kelly Dakin and Gregory Klein for assistance, and Cheng Li and Dana Gabuzda for helpful discussion. We also
acknowledge the Rush Alzheimer’s Disease Center, the Brigham and Women’s Hospital Brain Bank, the
Massachusetts General Hospital ADRC Brain Bank, and the Kathleen Price Bryan Brain Bank at Duke University
for providing tissue samples. This work was supported by an NIH Director’s Pioneer Award (DP1OD006849) and
NIH grants PO1AG27916 and RO1AG26651 to B.A.Y., RO1GM072551 to M.P.C., P30AG10161, R01AG15819
and R01AG17917 to D.A.B, and a grant from the Glenn Foundation for Medical Research to B.A.Y. J.Z. is a
Molecular Biology of Neurodegeneration fellow at Harvard Medical School.
References
1. Gomez-Isla T, et al. Profound loss of layer II entorhinal cortex neurons occurs in very mild
Alzheimer’s disease. J Neurosci. 1996; 16:4491–4500. [PubMed: 8699259]
2. Peters A, Sethares C, Moss MB. The effects of aging on layer 1 in area 46 of prefrontal cortex in the
rhesus monkey. Cereb Cortex. 1998; 8:671–684. [PubMed: 9863695]
3. Yankner BA, Lu T, Loerch P. The aging brain. Annu Rev Pathol. 2008; 3:41–66.10.1146/
Author Manuscript
annurev.pathmechdis.2.010506.092044 [PubMed: 18039130]

4. Kenyon CJ. The genetics of ageing. Nature. 2010; 464:504–512.10.1038/nature08980 [PubMed:
20336132]
5. Spalding KL, Bhardwaj RD, Buchholz BA, Druid H, Frisen J. Retrospective birth dating of cells in
humans. Cell. 2005; 122:133–143.10.1016/j.cell.2005.04.028 [PubMed: 16009139]
6. Chong JA, et al. REST: a mammalian silencer protein that restricts sodium channel gene expression
to neurons. Cell. 1995; 80:949–957. [PubMed: 7697725]
7. Schoenherr CJ, Anderson DJ. The neuron-restrictive silencer factor (NRSF): a coordinate repressor
of multiple neuron-specific genes. Science. 1995; 267:1360–1363. [PubMed: 7871435]
8. Ballas N, Grunseich C, Lu DD, Speh JC, Mandel G. REST and its corepressors mediate plasticity of
neuronal gene chromatin throughout neurogenesis. Cell. 2005; 121:645–657.10.1016/j.cell.
2005.03.013 [PubMed: 15907476]
9. Lu T, et al. Gene regulation and DNA damage in the ageing human brain. Nature. 2004; 429:883–
891. [PubMed: 15190254]
Author Manuscript
10. Loerch PM, et al. Evolution of the aging brain transcriptome and synaptic regulation. PLoS One.
2008; 3:e3329.10.1371/journal.pone.0003329 [PubMed: 18830410]
11. Holtzman DM, Morris JC, Goate AM. Alzheimer’s disease: the challenge of the second century.
Sci Transl Med. 2011; 3:77sr71.10.1126/scitranslmed.3002369
12. Grimes JA, et al. The co-repressor mSin3A is a functional component of the REST-CoREST
repressor complex. J Biol Chem. 2000; 275:9461–9467. [PubMed: 10734093]
13. Shimojo M. Characterization of the nuclear targeting signal of REST/NRSF. Neurosci Lett. 2006;
398:161–166.10.1016/j.neulet.2005.12.080 [PubMed: 16442230]

Lu et al. Page 34
14. Wen C, Levitan D, Li X, Greenwald I. spr-2, a suppressor of the egg-laying defect caused by loss
of sel-12 presenilin in Caenorhabditis elegans, is a member of the SET protein subfamily. Proc
Author Manuscript
Natl Acad Sci USA. 2000; 97:14524–14529.10.1073/pnas.011446498 [PubMed: 11114162]

15. Lakowski B, et al. Two suppressors of sel-12 encode C2H2 zinc-finger proteins that regulate
presenilin transcription in Caenorhabditis elegans. Development. 2003; 130:2117–2128. [PubMed:
12668626]
16. Jarriault S, Greenwald I. Suppressors of the egg-laying defective phenotype of sel-12 presenilin
mutants implicate the CoREST corepressor complex in LIN-12/Notch signaling in C. elegans.
Genes Dev. 2002; 16:2713–2728.10.1101/gad.1022402 [PubMed: 12381669]
17. Treusch S, et al. Functional links between Abeta toxicity, endocytic trafficking, and Alzheimer’s
disease risk factors in yeast. Science. 2011; 334:1241–1245.10.1126/science.1213210 [PubMed:
22033521]
18. Willert J, Epping M, Pollack JR, Brown PO, Nusse R. A transcriptional response to Wnt protein in
human embryonic carcinoma cells. BMC Dev Biol. 2002; 2:8. [PubMed: 12095419]
19. Lipinski MM, et al. Genome-wide analysis reveals mechanisms modulating autophagy in normal
brain aging and in Alzheimer’s disease. Proc Natl Acad Sci USA. 2010; 107:14164–
Author Manuscript
14169.10.1073/pnas.1009485107 [PubMed: 20660724]

20. Tothova Z, et al. FoxOs are critical mediators of hematopoietic stem cell resistance to physiologic
oxidative stress. Cell. 2007; 128:325–339.10.1016/j.cell.2007.01.003 [PubMed: 17254970]
21. Li Y, et al. Genetic association of FOXO1A and FOXO3A with longevity trait in Han Chinese
populations. Hum Mol Genet. 2009; 18:4897–4904.10.1093/hmg/ddp459 [PubMed: 19793722]
22. Ballas N, Mandel G. The many faces of REST oversee epigenetic programming of neuronal genes.
Curr Opin Neurobiol. 2005; 15:500–506.10.1016/j.conb.2005.08.015 [PubMed: 16150588]
23. Otto SJ, et al. A new binding motif for the transcriptional repressor REST uncovers large gene
networks devoted to neuronal functions. J Neurosci. 2007; 27:6729–6739.10.1523/jneurosci.
0091-07.2007 [PubMed: 17581960]
24. Abrajano JJ, et al. REST and CoREST modulate neuronal subtype specification, maturation and
maintenance. PLoS ONE. 2009; 4:e7936.10.1371/journal.pone.0007936 [PubMed: 19997604]
25. Yu M, et al. NRSF/REST neuronal deficient mice are more vulnerable to the neurotoxin MPTP.
Neurobiol Aging. 2013; 34:916–927.10.1016/j.neurobiolaging.2012.06.002 [PubMed: 22766071]
Author Manuscript
26. Fischer A, Sananbenesi F, Wang X, Dobbin M, Tsai LH. Recovery of learning and memory is
associated with chromatin remodelling. Nature. 2007; 447:178–182.10.1038/nature05772
[PubMed: 17468743]
27. Graff J, Tsai LH. Histone acetylation: molecular mnemonics on the chromatin. Nat Rev Neurosci.
2013; 14:97–111.10.1038/nrn3427 [PubMed: 23324667]
28. Ronan JL, Wu W, Crabtree GR. From neural development to cognition: unexpected roles for
chromatin. Nat Rev Genet. 2013; 14:347–359.10.1038/nrg3413 [PubMed: 23568486]
29. Bruce AW, et al. Genome-wide analysis of repressor element 1 silencing transcription factor/
neuron-restrictive silencing factor (REST/NRSF) target genes. Proc Natl Acad Sci U S A. 2004;
101:10458–10463.10.1073/pnas.0401827101 [PubMed: 15240883]
30. Bennett DA, Schneider JA, Arvanitakis Z, Wilson RS. Overview and findings from the religious
orders study. Curr Alzheimer Res. 2012; 9:628–645. [PubMed: 22471860]
31. Bennett DA, et al. Overview and findings from the rush Memory and Aging Project. Curr
Alzheimer Res. 2012; 9:646–663. [PubMed: 22471867]
32. Bennett DA, et al. Decision rules guiding the clinical diagnosis of Alzheimer’s disease in two
Author Manuscript
community-based cohort studies compared to standard practice in a clinic-based cohort study.

Neuroepidemiology. 2006; 27:169–176.10.1159/000096129 [PubMed: 17035694]
33. Bennett DA, et al. Natural history of mild cognitive impairment in older persons. Neurology. 2002;
59:198–205. [PubMed: 12136057]
34. Schneider JA, Arvanitakis Z, Leurgans SE, Bennett DA. The neuropathology of probable
Alzheimer disease and mild cognitive impairment. Ann Neurol. 2009; 66:200–208.10.1002/ana.
21706 [PubMed: 19743450]
35. Loerch PM, et al. Evolution of the aging brain transcriptome and synaptic regulation. PLoS One.
2008; 3:e3329.10.1371/journal.pone.0003329 [PubMed: 18830410]

Lu et al. Page 35
36. Bolstad BM, Irizarry RA, Astrand M, Speed TP. A comparison of normalization methods for high
density oligonucleotide array data based on variance and bias. Bioinformatics. 2003; 19:185–193.
Author Manuscript
[PubMed: 12538238]
37. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing
radiation response. Proc Natl Acad Sci USA. 2001; 98:5116–5121.10.1073/pnas.091062498
[PubMed: 11309499]
38. Bruce AW, et al. Genome-wide analysis of repressor element 1 silencing transcription factor/
neuron-restrictive silencing factor (REST/NRSF) target genes. Proc Natl Acad Sci USA. 2004;
101:10458–10463.10.1073/pnas.0401827101 [PubMed: 15240883]
39. Li C, Wong WH. Model-based analysis of oligonucleotide arrays: expression index computation
and outlier detection. Proc Natl Acad Sci USA. 2001; 98:31–36.10.1073/pnas.011404098
[PubMed: 11134512]
40. Yu M, et al. Alteration of NRSF expression exacerbating 1-methyl-4-phenyl-pyridinium ion-
induced cell death of SH-SY5Y cells. Neurosci Res. 2009; 65:236–244.10.1016/j.neures.
2009.07.006 [PubMed: 19631241]
41. Lu T, et al. Gene regulation and DNA damage in the ageing human brain. Nature. 2004; 429:883–
Author Manuscript
891.10.1038/nature02661 [PubMed: 15190254]

42. Spalding KL, Bhardwaj RD, Buchholz BA, Druid H, Frisen J. Retrospective birth dating of cells in
humans. Cell. 2005; 122:133–143.10.1016/j.cell.2005.04.028 [PubMed: 16009139]
43. Siegmund KD, et al. DNA methylation in the human cerebral cortex is dynamically regulated
throughout the life span and involves differentiated neurons. PLoS One. 2007; 2:e895.10.1371/
journal.pone.0000895 [PubMed: 17878930]
44. Zhang Y, et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol. 2008; 9:R137.10.1186/
gb-2008-9-9-r137 [PubMed: 18798982]
45. Schoenherr CJ, Anderson DJ. The neuron-restrictive silencer factor (NRSF): a coordinate repressor
of multiple neuron-specific genes. Science. 1995; 267:1360–1363. [PubMed: 7871435]
46. Johnson DS, Mortazavi A, Myers RM, Wold B. Genome-wide mapping of in vivo protein-DNA
interactions. Science. 2007; 316:1497–1502.10.1126/science.1141319 [PubMed: 17540862]
47. Otto SJ, et al. A new binding motif for the transcriptional repressor REST uncovers large gene
networks devoted to neuronal functions. J Neurosci. 2007; 27:6729–6739.10.1523/jneurosci.
Author Manuscript
0091-07.2007 [PubMed: 17581960]

48. Mao CA, et al. Neuronal transcriptional repressor REST suppresses an Atoh7-independent
program for initiating retinal ganglion cell development. Dev Biol. 2011; 349:90–99.10.1016/
j.ydbio.2010.10.008 [PubMed: 20969844]
49. Lorenzo A, et al. Amyloid beta interacts with the amyloid precursor protein: a potential toxic
mechanism in Alzheimer’s disease. Nat Neurosci. 2000; 3:460–464.10.1038/74833 [PubMed:
10769385]
50. Kayed R, et al. Fibril specific, conformation dependent antibodies recognize a generic epitope
common to amyloid fibrils and fibrillar oligomers that is absent in prefibrillar oligomers. Mol
Neurodegener. 2007; 2:18.10.1186/1750-1326-2-18 [PubMed: 17897471]
51. Busciglio J, Yankner BA. Apoptosis and increased generation of reactive oxygen species in
Down’s syndrome neurons in vitro. Nature. 1995; 378:776–779.10.1038/378776a0 [PubMed:
8524410]
52. Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974; 77:71–94. [PubMed: 4366476]
53. Lakowski B, et al. Two suppressors of sel-12 encode C2H2 zinc-finger proteins that regulate
Author Manuscript
presenilin transcription in Caenorhabditis elegans. Development (Cambridge, England). 2003;

130:2117–2128.
54. Lin K, Dorman JB, Rodan A, Kenyon C. daf-16: An HNF-3/forkhead Family Member That Can
Function to Double the Life-Span of Caenorhabditis elegans. Science. 1997; 278:1319–
1322.10.1126/science.278.5341.1319 [PubMed: 9360933]
55. Van Raamsdonk JM, Hekimi S. Deletion of the mitochondrial superoxide dismutase sod-2 extends
lifespan in Caenorhabditis elegans. PLoS Genet. 2009; 5:e1000361.10.1371/journal.pgen.1000361
[PubMed: 19197346]

Lu et al. Page 36
56. Calixto A, Chelur D, Topalidou I, Chen X, Chalfie M. Enhanced neuronal RNAi in C. elegans
using SID-1. Nat Methods. 2010; 7:554–559.10.1038/nmeth.1463 [PubMed: 20512143]
Author Manuscript
57. Treusch S, et al. Functional Links Between Aβ Toxicity, Endocytic Trafficking, and Alzheimer’s
Disease Risk Factors in Yeast. Science. 2011; 334:1241–1245.10.1126/science.1213210 [PubMed:
22033521]
58. Abràmoff MD, Magalhães PJ, Ram SJ. Image processing with ImageJ. Biophotonics international.
2004; 11:36–42.
59. Mulligan P, et al. CDYL bridges REST and histone methyltransferases for gene repression and
suppression of cellular transformation. Mol Cell. 2008; 32:718–726.10.1016/j.molcel.2008.10.025
[PubMed: 19061646]
60. Westbrook TF, et al. SCFbeta-TRCP controls oncogenic transformation and neural differentiation
through REST degradation. Nature. 2008; 452:370–374.10.1038/nature06780 [PubMed:
18354483]
61. Shimojo M, Hersh LB. Characterization of the REST/NRSF-interacting LIM domain protein
(RILP): localization and interaction with REST/NRSF. J Neurochem. 2006; 96:1130–
1138.10.1111/j.1471-4159.2005.03608.x [PubMed: 16417580]
Author Manuscript
62. Lois C, Hong EJ, Pease S, Brown EJ, Baltimore D. Germline transmission and tissue-specific
expression of transgenes delivered by lentiviral vectors. Science. 2002; 295:868–872.10.1126/
science.1067081 [PubMed: 11786607]
63. Grimes JA, et al. The co-repressor mSin3A is a functional component of the REST-CoREST
repressor complex. J Biol Chem. 2000; 275:9461–9467. [PubMed: 10734093]
64. Shimojo M. Characterization of the nuclear targeting signal of REST/NRSF. Neurosci Lett. 2006;
398:161–166.10.1016/j.neulet.2005.12.080 [PubMed: 16442230]
65. Sarov M, et al. A genome-scale resource for in vivo tag-based protein function exploration in C.
elegans. Cell. 2012; 150:855–866.10.1016/j.cell.2012.08.001 [PubMed: 22901814]
Author Manuscript
Author Manuscript

Lu et al. Page 37
Author Manuscript
Author Manuscript
Figure 1. Induction of REST in the aging human prefrontal cortex

a. Hierarchical cluster analysis of predicted REST targets, based on the presence of the
canonical RE1 motif29, shows relatively high expression in young adults (red) and lower
expression (blue) in the aging population. Each lane represents an individual prefrontal
cortical brain sample. b. qRT-PCR shows age-dependent induction of REST mRNA in the
PFC. Values represent the mean±S.D., n=3. Shown are p-values indicating significance for
Author Manuscript
the mean of aged (71–95 yrs) versus young (24–29 yrs) cases for each primer. c. Age-
dependent increase in total REST protein level in the PFC of controls but not AD patients.
REST levels were also measured in isolated nuclear (Nuc REST; lower right panel, upper
blot) and cytoplasmic (Cyt REST; lower right panel, lower blot) fractions. Each lane
represents an individual case. Young, n=12; Aged, n=15; AD, n=10. d. Confocal
immunofluorescence labeling for REST (green), the neuronal marker MAP2 (red) and DNA
(DAPI, blue) in the PFC of young adult, aged and AD cases. Scale bar: 25 μm. e.
Quantitative analysis of nuclear REST levels by in situ imaging (left panel: Young, n=11;
Aged, n=77; AD, n=72; MCI=11) or FACS analysis of isolated PFC neuronal nuclei (right
panel: Young, n=11; Aged, n=22; AD, n=11; MCI n=12). For c and e, values are expressed
as fold change relative to the young adult group, and represent the mean
±S.E.M. *P<0.05, **P<0.01, ***P<0.001 by Student’s unpaired t-test. f. ChIP analysis shows
induction of REST-RE1 site binding in normal aging PFC neurons but not in AD.
Author Manuscript

Lu et al. Page 38
Author Manuscript
Author Manuscript
Author Manuscript
Figure 2. Regulation of REST target genes in aging and AD

a. ChIP-qPCR analysis of REST binding to target genes in isolated PFC neuronal nuclei.
Shown are young adult (Young), normal aged (Aged) and AD cases, which were stratified
as AD1 (MMSE score >18) and AD2 (MMSE score <8). Also shown are control ChIP
assays with non-specific IgG, and a REST ChIP with PCR primers directed 10 kb 3′ to the
SNAP25 RE1 site (SNAP25–10K down). Values represent fold change relative to the mean
young adult value, and represent the mean±S.E.M., n=7. *P<0.05 by the Mann-Whitney test.
b. mRNA expression of REST target genes determined by qRT-PCR of PFC. Shown are
Author Manuscript
REST target genes related to cell death pathways and AD pathology (left panel), and
neurotransmission (right panel). Values are normalized to the mean young adult expression
level (100%) and represent the mean±S.E.M. Young, n=9; Aged, n=10; AD1, n=10; AD2,
n=10. Asterisks above the “Aged” bars indicate significance relative to young adults;
brackets indicate significance of Aged vs AD1 or AD2. *P<0.05 by the Mann-Whitney test.
c. Linear regression analysis of nuclear REST versus levels of protein targets or histone
H3K9ac in double-labeled PFC neurons. d. Representative images showing inverse
relationships between nuclear REST and H3K9ac, PS2, DAXX and BAX in AD1 neurons.

Lu et al. Page 39
Scale bar: 20 μm. e. Global epigenetic regulation in aging and AD. Histone modification
Author Manuscript
H3K9ac was determined in isolated PFC neuronal nuclei. Values are normalized to the mean
of the young adult group (100%), and represent the mean±S.E.M., **P<0.005 by Student’s
unpaired t-test. Young, n= 8; Aged, n=11; AD1, n=4; AD2, n=4.
Author Manuscript
Author Manuscript
Author Manuscript

Lu et al. Page 40
Author Manuscript
Author Manuscript
Author Manuscript
Figure 3. REST is neuroprotective

a. REST-deficient cortical neurons cultured from REST cKO mouse embryos show
Author Manuscript
increased vulnerability to H2O2 and oligomeric Aβ42 toxicity. Cell viability is expressed as
percent of the value in untreated cultures. Values represent the mean ± S.E.M., n=6–
8. *P<0.05, **P<0.01 by Student’s unpaired t-test. b. Reduced nuclear translocation of the
ΔREST mutant. c. REST cKO mice exhibit age-related neurodegeneration. Shown are
sections of the hippocampal CA1 subfield from 8 month old REST cKO mice labeled for
TUNEL, cleaved caspase 3 (cl-CASP3) and GFAP, or stained with hematoxylin and eosin
(H&E). d. Neurodegeneration in 8 months but not 1 month old REST cKO mice in the
cortex, and in hippocampal CA1 and dentate gyrus (DG) regions. Values represent the mean

Lu et al. Page 41
± S.E.M., n=6 mice; **P<0.001 relative to control by Student’s unpaired t-test. Scale bars:
Author Manuscript
20 μm.
Author Manuscript
Author Manuscript
Author Manuscript

Lu et al. Page 42
Author Manuscript
Author Manuscript
Author Manuscript
Figure 4. C. elegans SPR-4 protects against oxidative stress and Aβ toxicity

a. Spr-4(by105) worms incubated continuously with paraquat (5 mM) exhibit increased
mortality rescued by wild-type SPR-4 or human REST. Shown is a representative
experiment replicated three times. b. Quantitative analysis of survival in wild-type worms
expressing mCherry or SPR-4 (WT+mCherry and WT+SPR-4), spr-4(by105) mutants, and
spr-4(by105) mutants expressing SPR-4 or human REST [spr4(by105)+SPR4 and
spr4(by105)+REST]. Shown is the percent change in mean survival relative to wild-type.
Values represent the mean ± S.D., n=3 independent replicates of at least 30 animals per
genotype; **P<0.01 relative to wild-type by the log-rank test. c. REST and SPR-4 reduce
levels of reactive oxygen species (ROS). Shown are representative confocal images of
paraquat-treated worms labeled with the ROS-sensitive dye DCFDA. WT, wildtype. Scale
bar: 30 μm. d. Quantitation of ROS levels by DCFDA labeling. Horizontal bars indicate the
Author Manuscript
median; boxed areas represent the second and third quartiles. *P<0.05 relative to wild-type
by analysis of variance with post-hoc Tukey test; n=30 worms. AFU, arbitrary fluorescence
units. e. SPR-4 protects against Aβ neurotoxicity. Shown are Aβ worms (expressing a stably
integrated Aβ1-42 transgene17) and Aβ;spr4(by105) worms. Neuronal degeneration does not
occur in WT worms or spr4(by105) mutants in the absence of the Aβ transgene. Values
represent the % of worms that retain 5 glutamatergic tail neurons at the indicated age (day),
and are the mean±S.D., n=3. *P<0.05 by unpaired t-test.

Lu et al. Page 43
Author Manuscript
Author Manuscript
Author Manuscript
Figure 5. REST, autophagy and proteostasis in AD, DLB and FTD

a. Loss of nuclear REST in DLB and FTD. Left Panel: Immunofluorescence microscopy
with labeling for REST (green), the neuronal marker MAP2 (red) and DNA (DAPI, blue).
Right Panel: Quantitative analysis of immunfluorescence. Values (AFU) represent the mean
±S.E.M., Young, n=11; Aged, n=21; DLB, n=18; FTD, n=16. **P<0.001 by Student’s
unpaired t-test. b. Co-localization of REST with disease-associated misfolded proteins in
autophagosomes. Cortical sections were triple-labeled for REST, LC3, and either Aβ in AD,
α-synuclein (α-syn) in DLB, or phosphorylated tau (PHF1 epitope) or TDP-43 in FTD. Two
Author Manuscript
different representative cases are shown for each disease. Scale bars: 20 μm.

Lu et al. Page 44
Author Manuscript
Author Manuscript
Author Manuscript
Figure 6. Nuclear REST is positively correlated with cognitive function and longevity
a. Linear regression analysis of nuclear REST levels in PFC neurons and cognitive test
scores. Nuclear REST was imaged by anti-REST immunofluorescence and quantified by
Metamorph. Each point represents an individual case. n=111 cases (59 females, 52 males),
age range 71–90 yrs. b. Nuclear REST levels are inversely correlated with Braak stage
(extent of neurofibrillary tangle formation). c. Nuclear REST levels in PFC from cases with
neuropathologic AD (moderate/frequent plaques by CERAD score and intermediate/high
likelihood AD by NIA-Reagan criteria) that had mild or no cognitive impairment (NCI/
MCI), or AD dementia. Values are the mean±S.E.M. *P<0.01 by Student’s unpaired t-test;
Author Manuscript
NCI/MCI n=30, AD dementia n=21. d. Nuclear REST levels in aging neurons correlate
positively with longevity. REST levels were quantified by FACS analysis of isolated PFC
neuronal nuclei in 61 individuals without AD (age range 67–104 years).

Yankner 2014

Uploaded by

Copyright:

Available Formats

Yankner 2014

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Yankner 2014

Uploaded by

Copyright:

Available Formats

HHS Public Access

Published in final edited form as:

REST and Stress Resistance in Aging and Alzheimer’s Disease

Harvard School of Public Health, Boston, MA 02215

REST is a repressor of neuronal genes during embryonic development that is downregulated

REST is induced in the aging human brain and declines in AD

specificity was indicated by ablation of immunoreactivity after antibody preabsorption with

Nature. Author manuscript; available in PMC 2014 September 27.

from the PFC by fluorescence-activated cell sorting (FACS) of NeuN-positive nuclei5

(Methods). ChIP-PCR analysis showed a marked induction of REST binding to canonical

REST represses genes involved in cell death and AD

Nature. Author manuscript; available in PMC 2014 September 27.

REST-deficient mice showed a progressive age-related neurodegenerative phenotype. At

To confirm the findings on REST-deficient neurons, we assessed vulnerability to oxidative

stress after REST overexpression or shRNA-mediated knockdown in neural SH-SY5Y cells.

Nature. Author manuscript; available in PMC 2014 September 27.

Induction of REST by stress and Wnt signaling

Nature. Author manuscript; available in PMC 2014 September 27.

Autophagy of REST in neurodegenerative disorders

Induction of autophagy in neurodegenerative disorders has been associated with pathogenic

Nature. Author manuscript; available in PMC 2014 September 27.

showed co-localization of REST with phosphorylated tau (PHF1) in LC3-positive

REST, cognitive preservation and longevity

neuronal populations correlates with longevity.

Nature. Author manuscript; available in PMC 2014 September 27.

almost completely abolished FOXO1a expression, which was reversed by an shRNA-

REST dysfunction may contribute to the pathogenesis of a number of different

neurodegenerative disorders. In addition to AD, REST was also significantly depleted in

possibilities for therapeutic intervention.

Nature. Author manuscript; available in PMC 2014 September 27.

Cognitive function tests and neuropathology

Nature. Author manuscript; available in PMC 2014 September 27.

Real time RT-PCR and PCR

Immunohistochemical analysis of human brain

Immunohistochemical/immunofluorescence analysis using paraffin-embedded brain sections

Nature. Author manuscript; available in PMC 2014 September 27.

Nature. Author manuscript; available in PMC 2014 September 27.

Fluorescence-activated cell sorting (FACS)

Antibodies against nuclear proteins, as well as isotype-matched control IgGs, were

Chromatin immunoprecipitation (ChIP) and nuclear isolation

ChIP-seq analysis of SH-SY5Y cells.

Nature. Author manuscript; available in PMC 2014 September 27.

Nature. Author manuscript; available in PMC 2014 September 27.

GTGATGGGGCAGTCTTCTGGAGG–3’), and re11 (5’–

GGGCACACCTTTAATCCTAGCTTC–3’); this allowed the identification of WT (220 bp),

Immunohistochemical and histological analysis of mouse brain

samples for genotype confirmation (RT-PCR: Forward primer: 5′-

Nature. Author manuscript; available in PMC 2014 September 27.

Assessment of cell viability and apoptosis

Analysis of reactive oxygen species (ROS)

Immunocytochemical analysis of cultured cells

Single cell gel electrophoresis (comet assay)

Nature. Author manuscript; available in PMC 2014 September 27.

sample using CometScore image analysis software (TriTek).

Generation of cell-conditioned medium and cortical extracts

Generation of recombinant lentiviruses

Nature. Author manuscript; available in PMC 2014 September 27.

confirmed by semi-quantitative RT-PCR. The TU3270 (uIs57 [Punc-119::sid-1+

C. elegans microinjection and transgenic strains

overexpressed by 18–24-fold relative to endogenous spr-4 expression in wild-type worms.