27

REVIEW

The intestinal microbiota and its role in human health and

disease
Keiko Kataoka

Department of Microbiology and Genetic Analysis, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, Japan

Abstract : The role of the intestinal microbiota in human health is gaining more attention since clear changes
in the composition of the intestinal bacteria or environment are seen in patients with inflammatory bowel dis-
ease, allergy, autoimmune disease, and some lifestyle-related illnesses. A healthy gut environment is regulated
by the exquisite balance of intestinal microbiota, metabolites, and the host’s immune system. Imbalance of these
factors in genetically susceptible persons may promote a disease state. Manipulation of the intestinal micro-
biota with prebiotics, which can selectively stimulate growth of beneficial bacteria, might help to maintain a
healthy intestinal environment or improve diseased one. In this review, analytical methods for identification
of intestinal bacteria and an update on the correlation of the intestinal microbiota with human health and dis-
ease were discussed by introducing our recent studies to determine the prebiotic effects of a fiber-rich food
in animal model and on healthy people and patients with ulcerative colitis (UC). J. Med. Invest. 63 : 27-37,
February, 2016

Keywords : intestinal microbiota, symbiotic relationship, ulcerative colitis, Bacteroides, organic acid

1. GENERAL FEATURE OF HUMAN INTESTINAL MI- including the host immune system, genetics, and environmental
CROBIOTA elements. Thus, the proper functioning of host systems and the
microbiota is vital to intestinal homeostasis.
Human are borne in a practically germ-free state. Shortly after, Comparing the differences in intestinal microbiota between
various microorganisms derived from the mother or environment healthy and disease states or when diet, lifestyle, or disease con-
start to settle in many places of the body. Bacterial colonization dition are altered clarifies the roles of intestinal bacteria in human
of the intestine is essential for its proper development and health. health. The intestinal bacterial population is complex, and identi-
The relationship between intestinal bacteria and health was real- fication of some species is difficult since they cannot be cultured.
ized with the establishment of anaerobic culture methods and germ- Recent advances in sequencing techniques have improved the
free breeding systems. Studies with axenic animals demonstrate ability to analyze the microbiota composition.
that colonizing microorganisms stimulate the maturation of intes-
tinal tissue, host metabolism, and absorption of nutrients, and
they fortify host protection systems such as mucus production 2. ANALYTICAL METHODS USED TO STUDY THE IN-
and secretory IgA (1). The effects of colonization are particularly
TESTINAL MICROBIOTA
strong in the intestinal tract, where many kinds of bacteria live and
the total amount outnumbers host cells. A recent review by Rajilić - In combination with germfree breeding system, development
Stojanović and de Vos (2) compiled the characteristics of more than of anaerobic culture technique have exceedingly contributed to
1000 species of microorganisms common to the human intestine. clarify the roles of intestinal bacteria in human health. Constantly
Escherichia coli and Enterococcus are first detected just after birth ; advancing technique for DNA sequencing has made analysis of in-
exposure probably occurs in the birth canal and the immediate testinal microbiota more easily within shorter period. Now we will
environment. During nursing, Bifidobacterium and Lactobacillus be able to study intensively about how difference of bacterial com-
become dominant. After weaning, various kinds of bacteria have position influence the pathogenesis of life-style related pluricausal
colonized the intestine and volume and diversity of microbiota in- diseases, why a population of bacteria increased under the patho-
creased to the same level as in an adult. The relationship between genic state, what kind of intervention will improve the patient’s
host and microbiota is symbiotic ; the host’s intestine provides a condition. Characteristics of analytical methods used for intestinal
place for bacteria to grow and supplies nutrition in the form of un- bacteria are described below. Combination of adequate method is
digested food and removed mucus, while the bacteria ensure proper important for deeply understanding the role of intestinal bacteria.
tissue and immune development of the intestine as mentioned
above. These resident bacteria form a complex network that util- Culture method
izes various energy sources from the host or other bacteria to sur- In the method of Mitsuoka et al. (3), diluted fecal samples were
vive in the intestine. Growth, however, does not go unchecked. The spread onto nonselective (e.g. BL agar, EG agar) and selective
composition of intestinal microbiota is affected by many factors media (e.g. Rogosa SL agar, DHL agar), and then were cultured
under aerobic or anaerobic conditions. Physical features of the
Received for publication June 8, 2015 ; accepted November 4, 2015. colonies, Gram staining, and biochemical properties of the isolates
Address correspondence and reprint requests to Keiko Kataoka, PhD,
were used to determine their genus or species. The viable number
Professor, Department of Microbiology and Genetic Analysis, Tokushima of identified bacteria were then calculated. Culture methods for
University Graduate School, 3 - 18 - 15, Kuramoto, Tokushima 770 - 8503, analysis of intestinal bacteria are difficult for several reasons. For
Japan and Fax : +81 - 88 - 633 - 9070. one, an expert is usually required to discriminate between colonies.

The Journal of Medical Investigation Vol. 63 2016

 28 K. Kataoka Intestinal microbiota and human health

In addition, growth of bacteria is influenced by many factors includ- al. (7). The procedure is outlined in Figure 1 and used primers are
ing the constitution of the media or the manner in which the cul- shown in Table 1. The bacterial 16S rDNA was amplified by PCR
tures were pretreated. Despite the difficulties, a small number of using 5’-6 -carboxyfluorescein (6 -FAM) -labeled 27F primer and
bacteria in the intestine can be discovered with the appropriate 1492R primer except for Bifidobacterium (7). Then, PCR products
selective media. Isolated bacteria are then placed in a gnotobiotic were digested with restriction enzymes HhaI and MspI, and 5’-
animal model to investigate its functions. For strict anaerobes that labeled restriction fragments were examined in a genetic analyzer.
are very difficult to culture (e.g. extremely-oxygen sensitive Clos- Polymorphisms of the fragments reflect the constituents of intes-
tridium), a whole fecal sample treated with chloroform was inocu- tinal microbiota. The sizes of 5’-labeled restriction fragments vary
lated into a germ-free animal intestine as described by Momose due to the genus- or species-dependent difference of digestion pat-
et al. (4) terns, so the unique size of the fragments aid in identification.
Although the exact species of changing bacteria cannot be deter-
Culture-independent methods mined, it can be supposed from the size of the T-RF peak by com-
Almost culture -independent methods target 16S ribosomal RNA puter simulation with a phylogenetic assignment database for T-
gene (16S rDNA), which is common among prokaryote and con- RFLP analysis of human colonic microbiota as described by Jin et
sisted from highly conserved and variable regions. Conserved re- al. (8) and Matsumoto et al. (9), or by Microbiota Profiler software
gions are utilized as primer binding site in amplification or sequenc- (Infocom, Tokyo, Japan). By clustering the T-RFLP profiles and
ing of this gene, and difference of DNA sequence in variable regions combining them with individual information such as dietary habits
are important for discrimination of genus or species of bacteria. Re- and disease states, we can consider which bacterial change has an
cently advancing metagenomic analysis targets 16S rDNA or whole important effect on healthy or disease conditions. Because of easy
genome in the samples. Anyway, complete extraction of bacterial operation and comparative inexpensiveness, T-RFLP is suitable for
DNA from samples is important for precise analysis. Physical destruc- screening out changes or differences of microbiota composition.
tion with glass beads, enzymatic hydrolysis (5) or benzyl chloride But PCR bias is the inevitable problem due to fidelity of primers or
(6) were used to destroy the bacterial cell wall. We extracted DNA efficiency of amplification. Nagashima et al. (10) proposed new
from fecal samples by the method of Morita et al. (5). Briefly, fecal primer-enzyme combinations to T-RFLP profiling of bacterial popu-
samples were washed with a solution of 10 mM Tris-HCl and 50 mM lations. They amplified 16S rDNA with using fluorescently labeled
EDTA (pH 8.0) to remove PCR inhibitors such as bile acid and some 516f primer and 1510r primer and then digested with RsaI plus BfaI
food-derived components, and were treated with achromopeptidase, or with BslI. They mentioned that this new protocol made it easy to
lysozyme and proteinase, and finally with SDS for complete lysis. predict what kind of intestinal bacterial group corresponded to each
Complete lysis of bacteria was confirmed by Gram staining. T-RF including Bifidobacterium.
Among 16S rDNA-targeting methods, terminal-restriction frag- To determine the amount of targeted bacteria correctly, genus-
ment length polymorphism (T-RFLP) analysis is good at finding or species-specific real-time PCR is a powerful method. We con-
time -dependent changes or the effect of some food components firmed the results of T-RFLP by genus-specific real-time PCR with
on an individual’s microbiota. In our previous studies, intestinal primers in Table 1. By using cloned 16S rDNA prepared from stan-
microbiota was analyzed according to the method of Sakamoto et dard strains, we determined the copy number of the 16S rRNA gene

Figure 1. Outline for analysis of intestinal microbiota by Terminal - RFLP.

 The Journal of Medical Investigation Vol. 63 February 2016 29

Table 1 Primers used for T - RFLP and quantitative PCR

Assay/object Primer Sequence Reference
27F - FAM 6FAM - AGAGTTTGATCCTGGCTCAG
T - RFLP 7
1492R GGTTACCTTGTTACGACTT
Bif164F CATCCGGCATTACCACCC
Bifidobacterium 11
Bif662R CCACCGTTACACCGGGAA
Sulfate - reducing Des - f CCGTAGATATCTGGAGGAACATCAG
12
bacteria Des - r ACATCTAGCATCCATCGTTTACAGC
Enc - F CCCTTATTGTTAGTTGCCATCATT
Enterococcus 13
Enc - R ACTCGTTGTACTTCCCATTGT
Clostridium CI - F1 TACCHRAGGAGGAAGCCAC
subcluster I CI - R2 GTTCTTCCTAATCTCTACGCAT
Clostridium CXI - F1 ACGCTACTTGAGGAGGA
subcluster XI CXI - R2 GAGCCGTAGCCTTTCACT
14
Clostridium CXIV - F1 GAWGAAGTATYTCGGTATGT
subcluster XIVab CXIV - R2 CTACGCWCCCTTTACAC
Clostridium
Clostridium probe 6FAM - GTGCCAGCAGCCGCGGTAATACG - TAMRA
common probe
AllBac296F GAGAGGAAGGTCCCCAC
Bacteroides AllBac412R CGCTACTTGGCTGGTTCAG 15
AllBac375Probe 6FAM - CCATTGACCAATATTCCTCACTGCTGCCT - TAMRA

from several bacteria (16, 17). Recently, a new quantification sys- of bacterial composition. Intestinal bacteria was perfectly separated
tem based on reverse transcription-quantitative PCR targeting of from epithelium by secreted mucus in the healthy condition, but
multicopy rRNA molecules was established by Matsuda et al. (18). penetration of bacteria into the mucus layer have been observed
They demonstrated the precise detection of subdominant popu- in experimental models and in patients with inflammatory bowel
lations such as Staphylococcus and Pseudomonas or those only de- diseases (23, 24).
tected at lower incidences by quantitative PCR and culture methods.
16S rDNA-targeting clone library method was used for phylo- Analysis of metabolites produced by intestinal microbiota
genetic analysis of complex microbiota including unknown bacte- Intestinal microbiota affects human health directly or indirectly
ria (19, 20). 16S rDNA was amplified by PCR with lower cycles to through their metabolites. Bacteria present in the lower intestinal
reproduce the original composition of microbiota, and PCR products tract metabolize indigestible dietary fiber and mucus components
were cloned and used for sequencing. Clustering of the 16S se- into short chain fatty acids (SCFA) such as propionic acid and bu-
quences into phylum group and the frequency of the clones in tyric acid. These organic acids are absorbed into the colonic epi-
each phylum group entirely described the composition of micro- thelium where they are used for many purposes, including : being
biota. Representative 16S sequence in each group is used for ho- used as an energy source, stimulating growth, differentiation, and
mology search to identify the bacteria. More complicated steps, mucin production of epithelial cells, fortifying intestinal barrier
longer time and more cost were needed compared to T-RFLP or functions, and regulating the immune response (25, 26). SCFA
other methods. However, recent advances in sequencing technol- also functions as modulator in fatty acid metabolism by stimulating
ogy have resolved this problem. secretion of GLP-1 and peptide YY, and in energy expenditure
Next generation sequencer can do large-scale sequencing ac- through enteric nervous system (27). The other absorbable me-
curately and reproducibly. It contributes to rapid analysis of com- tabolites have been associated with systemic diseases. Trimethyl-
plex intestinal microbiota. As summarized by Yamada (21), 16S amine (TMA) produced by intestinal bacteria from dietary choline
rDNA-targeting metagenome analysis is very helpful to know the and L-carnitine, was further metabolized to trimethylamine - N-
difference of complicated microbiota phylogenetically. In a gen- oxide (TMAO) and promoted atherosclerosis (28). Hsiao et al. (29)
eral metagenomics analysis, DNA fragments from whole genome demonstrated through serum metabolome analysis that 4-eth-
are directly sequenced. Enormous sequence data is assembled ylphenylsulfate, a uremic toxin produced by intestinal bacteria, was
into contig, and compared with sequences in common databases absorbed under dysbiotic condition and involved in the autism.
to assign their functions. By comparing the composition of func-
tional genes between healthy and diseased state, we can know
which function of intestinal microbiota have a key role in mainte- 3. EFFECTS OF A FIBER-RICH FERMENTED FOOD
nance of health or in the pathogenesis of many kinds of disease,
ON THE RAT INTESTINAL MICROBIOTA
although a high degree of data processing technique with more
time and cost are needed for this method. We analyzed the effect of fermented brown rice (FBRA), which
Fluorescence in situ hybridization (FISH) can visualize the be- is rich in dietary fiber, on the rat intestinal microbiota. Among
havior of intestinal bacteria in the intestinal environment with cultured bacteria, Lactobacillus significantly increased in the 10%
keeping the tissue structure. Since intestinal bacteria contain fairly FBRA-fed group compared to the basal diet-fed group. T-RFLP
large amount of rRNA, genus- or population-specific probes for 16S analysis also showed that FBRA substantially affected the intestinal
rRNA have been developed to examine their spatial distribution microbiota (30). The T-RF peak corresponding to the Lactobacillus
(22). If we will use multiple probe labeled with different fluorescent genus significantly increased with 10% FBRA feeding, and the frag-
dyes, we can find an abnormality of bacteria’s location and changes ment size of the T-RF peaks suggested an increase of Lactobacillus
 30 K. Kataoka Intestinal microbiota and human health

acidophilus, L. johnsonii, and L. intestinalis species (Figure 2a). effect on formation of ulcers in the rat DSS-induced colitis model.
T-RFLP profiles of fecal microbiota in the 10% FBRA-fed group Myeloperoxidase activity in colonic mucosa, a marker of neutro-
showed a different cluster from the basal diet-fed group (Figure phil infiltration, also significantly decreased in the 10% FBRA-fed
2b). Some lactic acid bacteria were isolated directly from the FBRA rats. DSS treatment caused a decrease in fecal Lactobacillus, but
itself, but they were not the same species as those isolated from the decrease was suppressed in FBRA-fed rats (32).
rat intestine as shown by randomly amplified polymorphic DNA How Lactobacillus correlates with the suppression of colitis was
(RAPD) analysis. These results indicate that addition of FBRA to not further studied in this work, but some strains of Lactobacillus
the rat diet increases the resident Lactobacillus in the intestine. have been reported to fortify intestinal barrier functions and to
Dextran sulfate sodium (DSS) treatment of rats induces colitis regulate excess immune response by inducing regulatory T cells
with similar histological features to human ulcerative colitis (31). (33, 34). FBRA contains a large amount of two types of dietary fiber,
We showed that addition of FBRA to the diet had an inhibitory β-glucan and arabinoxylan, which can be used as a carbon source

Figure 2. Rat fecal microbiota analyzed by Terminal - RFLP. Representative T - RFLP profiles (a) and dendrogram analysis (b) of rats fed a basal
or FBRA - containing diet. (Cited from reference number 30)
 The Journal of Medical Investigation Vol. 63 February 2016 31

by Lactobacillus and could help to maintain a beneficial number of clinical trials with GBF, considerable doses of GBF were used for
the bacteria in DSS-treated rats. Lactic acid produced by Lacto- longer period. Enhanced luminal butyrate production by GBF treat-
bacillus is further metabolized to SCFA, such as butyric acid, by ment (45) might improve the patient’s symptoms, and high water-
metabolic cross-feeding among many kinds of intestinal bacteria. holding capacity of GBF itself could contribute the amelioration.
Members of Negativicutes such as Veillonella and Megasphaera, If a functional component which can improve intestinal environ-
which are gram-negative staining and abundant in gastrointesti- ment was contained, like as GBF-mediated regulation of the fecal
nal tract, utilize lactic acid and acetic acid to produce SCFA (2). water content, effects of prebiotics might appear more clearly. Since
Bacteria-derived organic acids have been shown to induce anti- human intestinal microbiota has individually different composition
inflammatory effects and intestinal barrier fortification (26). even at the start of clinical trials, growth of beneficial bacteria is
stimulated by prebiotics to various degrees. Efficiency of metabolic
cross-feeding between intestinal bacteria also affect the constitu-
4. EFFECTS OF A FIBER-RICH FERMENTED FOOD tion of SCFA in the intestine. Time -, diet- and disease -dependent
change of bacterial composition could possibly interfere the action
ON THE HUMAN FECAL MICROBIOTA
of prebiotics and concentration of effective metabolites. We com-
Based on the increased number of resident Lactobacillus in rats pared bacterial composition and SCFA concentrations in feces in
(30) and the suppressive effect in the DSS-induced colitis model healthy adults before and after experimental food, in vivo effects
(32), we planned to estimate beneficial effects of FBRA in human were difficult to detect due to the large inter-individual variation.
by randomized placebo-controlled crossover trial. In the first study, In UC patients, disease state (remission or clinically active) influ-
effects of FBRA on the fecal microbiota and bowel function in healthy enced the concentration of SCFA. Reduced diversity of intestinal
adults were examined (16). While FBRA supplied the Ministry of microbiota in UC patients (described in section 5) may also be re-
Health, Labour and Welfare, Japan’s recommended daily intake lated to indistinct results in the trials.
of fiber, no significant effects on the intestinal microbiota compo-
sition and organic acids concentration were found after ingestion
of FBRA for 2 weeks. This was in contrast to in vitro results ; ad- 5. COMPARATIVE ANALYSIS OF THE FECAL MICRO-
dition of FBRA to fresh fecal samples showed increase of organic
BIOTA BETWEEN HEALTHY ADULTS AND PATIENTS
acids (SCFAs) and T-RF peaks that corresponded to Clostridium
subcluster XIVab and Bifidobacterium. Probably human adults have
WITH ULCERATIVE COLITIS
very stable intestinal microbiota and is not easily influenced by The healthy gut environment is controlled by a complicated bal-
the dose and ingestion period used in this study. ance of the intestinal microbiota, their metabolites, and the host im-
In another study to estimate the effectiveness of FBRA in UC mune system. Imbalance of these factors can promote disease
patients under leadership of Dr. Hideki Ishikawa (Kyoto Prefec- states like inflammatory bowel disease. Since the two clinical stud-
tural University), we covered to examine the change of fecal micro- ies described above were run at the same time, we compared the
biota. Subjects ingested 21 g of FBRA or control food per day (the microbiota in UC patients before experimental food with those in
same dose as in the healthy adults) for 3 months. Before and after healthy adults and found a reduced diversity and imbalance of fecal
the first-eating period T-RFLP profile of fecal microbiota and bac- microbiota in UC patients (17). The total number of T-RF peaks
terial metabolites showed no significant difference (unpublished was significantly lower in patients in remission than in healthy
data), while fecal microbiota of UC patients before the intervention adults. Clustering analysis of T-RFLP profiles indicated that UC
was different from that of healthy adults as described in section 5. patient’s microbiota formed different clusters from those of healthy
Many clinical trials for UC patients showed beneficial effects of subjects without dependence on disease activity (Figure 3b). T-
probiotics (35, 36), and recently VSL#3 has been demonstrated to RFLP analyses in UC patients showed decreasing peak area which
be effective in maintenance/induction of remission and decrease corresponded to Clostridium and Bacteroides (Figure 3a). Decrease
of clinical disease activity in large -scale, randomized, double -blind, of genus Bacteroides and Clostridium subcluster XIVab was con-
placebo-controlled trial (37). Synbiotics consisted from Bifidobac- firmed by genus- or species-specific real-time PCR (Figure 4a).
terium breve and galacto-oligosaccharide (38) or Bifidobacterium Probably due to the decrease of these dominant anaerobes, we ob-
longum and psyllium (39) also ameliorated colitis or patient’s quality- served an increase of Enterococcus by culture and real-time PCR
of-life. However, only a few clinical trials have suggested beneficial in UC patients. Medical treatment and intake of probiotics did not
effects of prebiotics in UC patients. Oligofructose-enriched inulin affect the differences in the microbiota between healthy and UC
(12 g/day for 2 weeks) was tested in a randomized, placebo-con- subjects.
trolled, double -blind pilot trial (35, 40). Intestinal inflammation Bacteroides and Clostridium subcluster XIVab belong to the domi-
evaluated with a fecal concentration of calprotectin was reduced nant phyla Bacteroidetes and Firmicutes in the human intestinal
significantly at the middle point only in the group receiving oli- microbiota, and they cooperatively ferment undigested food com-
gofructose -enriched inulin. But at the end of the study period, ponents to SCFAs by metabolic cross-feeding (46 -48). Consistent
disease activity scores were significantly reduced in both group. with the reduction of these anaerobes, there was a lower concen-
Germinated barley foodstuff (GBF) is a dietary component high tration of fecal organic acids in UC patients compared to healthy
in glutamine -rich protein and hemi-cellulose-rich dietary fiber, adults (Figure 4b). These results indicate that dysbiosis occurred
and showed suppressive effect in experimental colitis and patients in UC patients. Similar features have been reported for intestinal
with UC (35, 41-45). In small-scale multi-center open trial, patients microbiota in UC and Crohn’s disease patients (49-51). Andoh et
treated with 20-30 g of GBF for 24 week showed significant de- al. (49) showed the altered T-RFLP patterns in UC patients. Some
crease in clinical activity index (CAI) (41). Randomized controlled T-RFs, derived from the unclassified bacteria, Ruminococcus, Eub-
trials also showed decrease of CAI and prolonged remission period acterium, Fusobacterium, gammaproteobacteria, unclassified Bac-
by 20 g of GBF for 12 months (42), reduced level of serum TNF-α, teroides, and unclassified Lactobacillus were detected in the UC
IL-6, IL-8 and serum CRP level by 30 g of GBF for 2 months (43, patients, but not in the healthy individuals. Such difference was
44). However, a large, double-blind, placebo-controlled trial is not also found between the active UC patients and remission patients.
yet reported. Nishikawa et al. (50) compared the mucosa-associated microbiota
Verification of prebiotic potential in human may probably need between UC patients and non-inflammatory bowel disease (IBD)
an adequate dose and ingestion period for individuals. In the above controls by T-RFLP analysis. They showed that active UC patients
 32 K. Kataoka Intestinal microbiota and human health

Figure 3. Comparison of intestinal microbiota between healthy adults and patients with ulcerative colitis. Representative T - RFLP profiles (a) and
dendrogram analysis (b) of fecal microbiota in healthy control and UC patients. (Cited from reference number 16 and 17, and revised)
 The Journal of Medical Investigation Vol. 63 February 2016 33

Figure 4. Decrease of dominant anaerobes and their fermentative metabolites in UC patients. Quantitative PCR for Bacteroides and Clostridium
subcluster XIVab (a) and fecal concentration of organic acids (b) are shown. *Significant difference from healthy control (p !0.05, Mann - Whitney
U - test). (Cited from reference number 16 and 17, and revised)

possessed significantly fewer diverse microbial compositions, but prevent growth of pathogenic bacteria of foreign origin (53). En-
increased diversity of microbiota was observed in remission phase hanced production of mucin, antibacterial peptides, and secretory
of identical patients. Reduced diversity of faecal microbiota in IgA associated with commensal bacteria in the intestine has also
Crohn’s disease (CD) was revealed by Manichanh et al. (51). They been reported (1, 25, 53, 54). These resident bacteria also contrib-
compared two DNA libraries constructed from faecal samples from uted to the enhancing effect through their colonization and their
heathy donors and patients with CD, and identified 125 non-redun- metabolite organic acids (25, 26). Balanced microbiota is neces-
dant ribotypes, mainly represented by the phyla Bacteroidetes and sary for producing organic acids with adequate amount and pro-
Firmicutes. Number of distinct ribotypes belonging to Firmicutes portion because of metabolic cross-feeding among anaerobic in-
was less in library from CD patients than that from healthy donor. testinal bacteria (46 -48). Colonization of some commensals, such
Significant reduction of this phylum was confirmed by fluorescent as Bacteroides and Bifidobacterium, has been reported to fortify the
in situ hybridization directly targeting 16S rRNA in faecal samples. intestinal barrier by stimulating expression of antibacterial sub-
In this study, we compared fecal microbiota at only one time point ; stances and intercellular adhesion molecules, and to suppress in-
however, the intestinal microbiota has been reported to be unsta- flammation by modulating transduction of inflammatory signals or
ble and easily changed during clinical remission (52). Therefore, by inducing regulatory T cells (Treg cells) (34). Clostridium has
further investigation of samples from UC patients at different stages also been demonstrated to suppress an excessive immune response
of remission and of samples from different sites are required to con- by induction of Treg cells, in part through the fermentation me-
firm the microbiota differences between UC patients and healthy tabolite butyrate (55, 56).
individuals seen in this study. As summarized in Figure 5, colonized bacteria stimulate the
maturation of the human intestine and form a symbiotic relation-
ship through interaction with host defense systems. The human
6. CHANGES OF THE INTESTINAL MICROBIOTA IN host provides a place and nutrients for the microbiota to grow while
maintaining an adequate distance from the microbiota through
CHRONIC INFLAMMATORY BOWEL DISEASES AND
innate immune mechanisms. When this exquisite balance is col-
LIFESTYLE-RELATED DISEASES lapsed, the host immune cells attack resident bacteria ; persons
The intestinal tract is an important organ for absorption of nutri- with certain genetic deficiencies in regulation of the immune re-
ents, and it functions as a physical and biochemical barrier against sponse may experience chronic intestinal inflammation when this
food-derived antigens and pathogenic microorganisms. Develop- occurs.
ment of these protective functions is stimulated by colonization Chronic intestinal disease may be caused by a mixture of defects
of commensal bacteria. Closely crowded commensal bacteria in of immune response genes of the host and environmental factors.
the lumen or on the surface of intestinal mucosa competitively Pathogenesis of Crohn’s disease, a chronic inflammatory bowel
 34 K. Kataoka Intestinal microbiota and human health

Figure 5. The symbiotic relationship between the host and the intestinal microbiota contribute to human health.

disease (IBD), includes genetic deficiency in pathogen sensor mole- or probiotics has been reported to reverse high fat diet-induced
cules such as NOD2 and TLR5 and autophagy gene (57 -59). In metabolic disorders through an increase of Akkermansia muciniphila
ulcerative colitis, the protective mucosal layer of the colon is lost (69) and to suppress nonalcoholic steatohepatitis (70) in a rodent
because mucin-producing goblet cells are reduced ; however, the model.
genetic causes have not yet been clarified. NOD2 is a sensor for
intracellular microorganisms. TLR5 recognizes flagellin of pene-
trating bacteria, and it sends signals to induce production of anti- 7. CONCLUDING REMARKS
bacterial peptides and sIgA. Atg16L1 is responsible for the genera-
tion of autophagosome, and plays an important role in degradation The lifestyle of the average person, especially in regards to die-
of intracellular bacteria, and in regulating the secretion of proin- tary habits, has changed dramatically over the past several decades.
flammatory cytokines (58, 60). A parallel increase in patients with inflammatory bowel diseases,
Defects in these molecules reduce certain protective functions irritable bowel disease, allergy, autoimmune diseases, and meta-
in the intestine that maintain the distance between host and com- bolic diseases like type 2 diabetes and fatty liver disease has oc-
mensal bacteria, resulting in an immune response to resident bac- curred. The role of the intestinal microbiota in human health is
teria. In addition to genetic vulnerability, environmental factors apparent now because of research that connects changes of the
such as overwork, stress, and infection may trigger these intestinal gut microbiota with the risk of diseases. The diversity and total
diseases. These factors cumulatively cause a collapse of the sym- amount of intestinal microbiota is continuously influenced by en-
biotic relationship, at which point the host immune system attacks vironmental bacteria, dietary habits, exercises, stress, aging, in-
the intestinal commensal bacteria. Chronic colitis is thought to take of probiotics/prebiotics, medical treatment with antibiotics or
be the result of a combination of continuous inflammation against other drugs, host immune system, and the person’s genetic back-
commensal bacteria, lowered regulation of the immune response, ground (63, 71). While modification of the intestinal microbiota
and reduced tissue repair activity. Decrease of dominant bacteria and intestinal environment including mucosal immune system could
and less diversity in intestinal microbiota are now considered com- affect the risk of many kinds of diseases, the strongest influence
mon features of IBD. Restoration of balance of the intestinal mi- might occur during early stage of life as described elsewhere (63,
crobiota may be one of the only effective treatments for patients. 72 -74). Despite our understanding that the microbiota is a critical
Recently, bacterial transplantation has been demonstrated to be part of health, it remains to be discovered what type of microbiota
effective in patients with UC (61) and in colitis caused by repeated should be present at different stages of life. Further studies should
antibiotic treatments for Clostridium difficile infection (62). focus on how to maintain a healthy composition of the intestinal
Changed intestinal microbiota and dysbiosis are also correlated microbiota.
with lifestyle -related diseases. A markedly reduced diversity and Although 16S rDNA-targeting PCR and sequencing analyses
compositional change of the gut microbiota has been linked to obe- yielded information about microbiota composition at the genus
sity and insulin resistance (63-65). A high fat diet was shown to or species level, variation between individuals was too large to find
affect the composition of gut microbiota through modifying the a functional difference between healthy and disease states. Im-
expression of bacterial genes responsible for nutrient uptake and provement of current sequencing techniques would allow better
adaptation to environmental change in the host intestine (66). A analysis of the complexity of the gut microbiota. Alternatively, we
dysbiotic intestinal environment contributes to the pathogenesis could look for a change in specific bacterial gene functions in dis-
of liver diseases (67, 68). Also, Schnabl and Brenner (68) showed eased persons. Large scale metagenomics studies of disease and
a correlation between altered intestinal microbiota and nonalco- healthy states have begun to point to the kinds of bacteria that cor-
holic fatty liver disease/steatohepatitis. Furthermore, absorbed relate with risk of disease. The NIH “Human Microbiome Project”
bacterial metabolites have the potential to systemically enhance the has steadily been clarifying the relationship between intestinal mi-
development of these metabolic diseases. Treatment with prebiotics crobiota and human health by this method (75). Recently, a different
 The Journal of Medical Investigation Vol. 63 February 2016 35

metagenome -wide association study reported taxonomic and func- samples by real-time PCR. J Appl Microbiol 97 : 1166 -1177,
tional characterization of gut microbiota in type 2 diabetes, and 2004
they correlated the disease with lack of bacterial richness and meta- 14. Song Y, Liu C, Finegold SM : Real-time PCR quantification of
bolic markers (76, 77). Additionally, bacterial metabolites, which clostridia in feces of autistic children. Appl Environ Microbiol
are affected by dietary components, should be analyzed because 70 : 6459 -6465, 2004
these products from dietary can affect human health similar to some 15. Layton A, McKay L, Williams D, Garrett V, Gentry R, Sayler G :
metabolic diseases. Careful studies to clarify the roles of intestinal Development of Bacteroides 16S rRNA gene TaqMan-based
microbiota in human health will bring us great progress in treat- real-time PCR assays for estimation of total, human, and bo-
ment and prevention of many kinds of diseases. vine fecal pollution in water. Appl Environ Microbiol 72 : 4214 -
4224, 2006
16. Nemoto H, Ikata K, Arimochi H, Iwasaki T, Ohnishi Y,
CONFLICT OF INTEREST Kuwahara T, Kataoka K : Effects of fermented brown rice on
the intestinal environments in healthy adult. J Med Invest 58 :
The authors have declared no conflict of interest. 235 -245, 2011
17. Nemoto H, Kataoka K, Ishikawa H, Ikata K, Arimochi H,
Iwasaki T, Ohnishi Y, Kuwahara T, Yasutomo K : Reduced
REFERENCES diversity and imbalance of fecal microbiota in patients with
ulcerative colitis. Dig Dis Sci 57 : 2955 -2964, 2012
1. Smith K, McCoy KD, Macpherson AJ : Use of axenic animals 18. Matsuda K, Tsuji H, Asahara T, Matsumoto K, Takada T,
in studying the adaptation of mammals to their commensal Nomoto K : Establishment of an analytical system for the hu-
intestinal microbiota. Semin Immunol 19 : 59-69, 2007 man fecal microbiota, based on reverse transcription-quan-
2. Rajilić -Stojanović M, de Vos WM : The first 1000 cultured spe- titative PCR targeting of multicopy rRNA molecules. Appl
cies of the human gastrointestinal microbiota. FEMS Microbiol Environ Microbiol 75 : 1961-1969, 2009
Rev 38 : 996-1047, 2014 19. Hayashi H, Sakamoto M, Benno Y : Phylogenetic analysis of
3. Mitsuoka T, Sega T, Yamamoto S : Improved methodology of the human gut microbiota using 16S rDNA clone libraries and
qualitative and quantitative analysis of the intestinal flora of strictly anaerobic culture -based methods. Microbiol Immunol
man and animals. Zentralbl Bakteriol Orig 195 : 455-469, 1965 46 : 535 -548, 2002
4. Momose Y, Maruyama A, Iwasaki T, Itoh K : 16S rRNA gene 20. Suau A, Bonnet R, Sutren M, Godon JJ, Gibson GR, Collins
sequence -based analysis of clostridia related to conversion MD, Dore J : Direct analysis of genes encoding 16S rRNA
of germfree mice to the normal state. J Appl Microbiol 107 : from complex communities reveals many novel molecular
2088-2097, 2009 species within the human gut. Appl Environ Microbiol 65 :
5. Morita H, Kuwahara T, Ohshima K, Sasamoto H, Itoh K, 4799 -4807, 1999
Hattori M, Hayashi T, Takami H : An improved DNA isolation 21. Yamada T : Metagenomics for human gut microbiome. J Intest
method for metagenomic analysis of the microbial flora of the Microbiol 29 : 19-22, 2015
human intestine. Microb Environ 22 : 214-222, 2007 22. Takata T, Kado S, Nomoto K : Analysis of intestinal microflora
6. Zhu H, Qu F, Zhu LH : Isolation of genomic DNAs from plants, by multicolor fluorescence in situ hybridization technology. J
fungi and bacteria using benzyl chloride. Nucleic Acids Res Intest Microbiol 29 : 123 -134, 2015
21 : 5279-5280, 1993 23. Swidsinski A, Loening-Baucke V, Herber A : Mucosal flora in
7. Sakamoto M, Hayashi H, Benno Y : Terminal-restriction frag- Crohn’s Disease and ulcerative colitis- an overview. J Physiol
ment length polymorphism analysis for human fecal micro- Pharmacol 60 Suppl 6 : 61 -71, 2009
・
biota and its application for analysis of complex bifidobacterial 24. Johansson MEV, Gustafsson JK, Holmen-Larsson J, Jabbar
communities. Microbiol Immunol 47 : 133-142, 2003 KS, Xia L, Xu H, Ghishan FK,Carvalho FA, Gewirtz AT, Sj´ óvall
8. Jin JS, Touyama M, Hisada T, Benno Y : Effects of green tea H, Hansson GC : Bacteria penetrate the normally impenetra-
consumption on human fecal microbiota with special refer- ble inner colon mucus layer in both murine colitis models and
ence to Bifidobacterium species. Microbiol Immunol 56 : 729 - patients with ulcerative colitis. Gut 63 : 281 -291, 2014
739, 2012 25. Sartor RB : Microbial influences in inflammatory bowel dis-
9. Matsumoto M, Sakamoto M, Hayashi H, Benno Y : Novel phy- eases. Gastroenterol 134 : 577-594, 2008
logenetic assignment database for terminal-restriction frag- 26. Neish AS : Microbes in gastrointestinal health and disease.
ment length polymorphism analysis of human colonic micro- Gastroenterol 136 : 64 -80, 2009
biota. J Microbiol Methods 61 : 305-319, 2005 27. Deveraj S, Hemarajata P, Versalovic J : The human gut micro-
10. Nagashima K, Hisada T, Sato M, Mochizuki J : Application of biome and body metabolism : Implications for obecity and
new primer-enzyme combinations to terminal restriction frag- diabetes. Clinical Chemistry 59 : 617 -628, 2013
ment length polymorphism profiling of bacterial populations 28. Koeth RA, Wang Z, Levison BS, Buffa JA, Org E, Sheehy BT,
in human feces. Appl Environ Microbiol 69 : 1251-1262, 2003 Britt EB, Fu X, Wu Y, Li L, Smith JD, DiDonato JA, Chen J,
11. Matsuki T, Watanabe K, Fujimoto J, Miyamoto Y, Takada T, Li H, Wu GD, Lewis JD, Warrier M, Brown JM, Krauss RM,
Matsumoto K, Oyaizu H, Tanaka R : Development of 16S rRNA- Tang WH, Bushman FD, Lusis AJ, Hazen SL : Nat Med 19 :
gene -targeted group-specific primers for the detection and 576 -585, 2013
identification of predominant bacteria in human feces. Appl 29. Hsiao EY, McBride SW, Hsien S, Sharon G, Hyde ER, McCue
Environ Microbiol 68 : 5445-5451, 2002 T, Codelli JA, Chow J, Reisman SE, Petrosino JF, Patterson
12. Fite A, Macfarlane GT, Cummings JH, Hopkins MJ, Kong SC, PH, Mazmanian SK : The microbiota modulates gut physiol-
Furrie E, Macfarlane S : Identification and quantification of ogy and behavioral abnormalities associated with autism. Cell
mucosal and faecal desulfovibrios using real time polymerase 155 : 1451 -1463, 2013
chain reaction. Gut 53 : 523 -529, 2004 30. Kataoka K, Kibe R, Kuwahara T, Hagiwara M, Arimochi H,
13. Rinttila T, Kassinen A, Malinen E, krogius L, Palva A : Devel- Iwasaki T, Benno Y, Ohnishi Y : Modifying effects of fermented
opment of an extensive set of 16S rDNA-targeted primers for brown rice on fecal microbiota in rats. Anaerobe 13 : 220 -227,
quantification of pathogenic and indigenous bacteria in faecal 2007
 36 K. Kataoka Intestinal microbiota and human health

31. Elson CO : Experimental models of intestinal inflammation. and diarrhea, and accelerated the repair of the colonic mucosa
New insights into mechanisms of mucosal homeostasis. In : in an experimental colitis. J Gastroenterol Hepatol 16 : 160-
Ogra PL, Mestecky J, Lamm ME, Strober W, Bienenstock J, 168, 2001
McGhee JR, eds. Mucosal Immunology. Academic Press, 46. Duncam SH, Louis P, Flint HJ : Lactate -utilizing bacteria, iso-
1999, pp.1007-1024 lated from human feces, that produce butyrate as a major fer-
32. Kataoka K, Ogasa S, Kuwahara T, Bando Y, Hagiwara M, mentation product. Appl Environ Microbiol 70 : 5810 -5817,
Arimochi H, Nakanishi S, Iwasaki T, Ohnishi Y : Inhibitory ef- 2004
fects of fermented brown rice on induction of acute colitis by 47. Duncan SH, Holtrop G, Lobley GE, Calder AG, Stewart CS,
dextran sulfate sodium in rats. Dig Dis Sci 53 : 1601-1608, 2008 Flint HJ : Contribution of acetate to butyrate formation by
33. Foligne B, Zoumpopoulou G, Dewulf J, Ben Younes A, human faecal bacteria. Br J Nutr 91 : 915 -923, 2004
Chareyre F, Sirard JC, Pot B, Grangette C : A key role of den- 48. Falony G, Vlachou A, Verbrugghe K, Vuyst LD : Cross-feed-
dritic cells in probiotic functionality. PLoS One 2 : e313, 2007 ing between Bifidobacterium longum BB536 and acetate-con-
34. Round JL, O’Connell RM, Mazmanian SK : Coordination of verting, butyrate -producing colon bacteria during growth on
tolerogenic immune responses by the commensal microbiota. oligofructose. Appl Environ Microbiol 72 : 7835 -7841, 2006
J Autoimmun 34 : J220-J225, 2010 49. Andoh A, Sakata S, Koizumi Y, Mitsuyama K, Fujiyama Y,
35. Geier MS, Butler RN, Howarth GS : Inflammatory bowel dis- Benno Y : Terminal restriction fragment length polymorphism
ease : Current insights into pathogenesis and new therapeutic analysis of the diversity of fecal microbiota in patients with
options ; probiotics, prebiotics and synbiotics. International ulcerative colitis. Inflamm Bowel Dis 13 : 955-962, 2007
Journal of Food Microbiology 115 : 1-11, 2007 50. Nishikawa J, Kudo T, Sakata S, Benno Y, Sugiyama T : Di-
36. Sartor RB : Therapeutic manipulation of the enteric microflora versity of mucosa-associated microbiota in active and inactive
in inflammatory bowel diseases : Antibiotics, probiotics, and ulcerative colitis. Scand J Gastroenterol 44 : 180-186, 2009
prebiotics. Gastroenterology 126 : 1620 -1633, 2004 51. Manichanh C, Rigottier-Gois L, Bonnaud E, Gloux K, Pelletier
37. Sood A, Midha V, Makharia GK, Ahuja V, Singal D, Goswami E, Frangeul L, Nalin R, Jarrin C, Chardon P, Marteau P, Roca
P, Tandon RK : The probiotic preparation, VSL#3 induces re- J, Dore J : Reduced diversity of faecal microbiota in Crohn’s
mission in patients with mild-to-moderately active ulcerative disease revealed by a metagenomic approach. Gut 55 : 205 -
colitis. Clin Gastroenterol Hepatol 7 : 1202-1209, 2009 211, 2006
38. Ishikawa H, Matsumoto S, Ohashi Y, Imaoka A, Setoyama H, 52. Martinez C, Antolin M, Santos J, Torrejon A, Casellas F,
Umesaki Y, Tanaka R, Otani T : Beneficial effects of probiotic Borruel N, Guarner F, Malagelada JR : Unstable composition
Bifidobacterium and galacto-oligosaccharide in patients with of the fecal microbiota in ulcerative colitis during clinical re-
ulcerative colitis : a randomized controlled study. Digestion mission. Am J Gastroenterol 103 : 643-648, 2008
84 : 128-133, 2011 53. Buffie CG, Pamer EG : Microbiota-mediated colonization re-
39. Fujimori S, Gudis K, Mitsui K, Seo T, Yonezawa M, Tanaka S, sistance against intestinal pathogens. Nature Reviews Immu-
Tatsuguchi A, Sakamoto C : A randomized controlled trial nology 13 : 790 -801, 2014
on the efficacy of symbiotic versus probiotic or prebiotic treat- 54. Cerf-Bensussan N, Gaboriau-Routhiau V : The immune sys-
ment to improve the quality of life in patients with ulcerative tem and the gut microbiota : friends or foes? Nat Rev Immunol
colitis. Nutrition 25 : 520-525, 2009 10 : 735 -744, 2010
40. Casellas F, Borruel N, Torrejon A, Varela E, Antolin M, 55. Atarashi K, Tanoue T, Shima T, Imaoka A, Kuwahara T,
Guarner F, Malagelada JR : Oral oligofructose-enriched inulin Momose Y, Cheng G, Yamasaki S, Saito T, Ohba Y, Taniguchi
supplementation in acute ulcerative colitis is well tolerated and T, Takeda K, Hori S, Ivanov II, Umesaki Y, Itoh K, Honda K :
associated withlowered faecal calprotectin. Aliment Pharmacol Induction of colonic regulatory T cells by indigenous Clostrid-
Ther 25 : 1061-1067, 2007 ium species. Science 331 : 337 -341, 2011
41. Kanauchi O, Mitsuyama K, Homma T, Takahama K, Fujiyama 56. Furusawa Y, Obata Y, Fukuda S, Endo TA, Nakato G,
Y, Andoh A, Araki Y, Suga T, Hibi T, Naganuma M, Asakura H, Takahashi D, Nakanishi Y, Uetake C, Kato K, Kato T,
Nakano H, Shimoyama T, Hida N, Haruma K,Koga H, Sata M, Takahashi M, Fukuda NN, Murakami S, Miyauchi E, Hino S,
Tomiyasu N, Toyonaga A, Fukuda M, Kojima A, Bamba T : Atarashi K, Onawa S, Fujimura Y, Lockett T, Clarke JM,
Treatment of ulcerative colitis patients by long-term admini- Topping DL, Tomita M, Hori S, Ohara O, Morita T, Koseki H,
stration of germinated barley stuff : multi-center open trial. Kikuchi J, Honda K, Hase K, Ohno H : Commensal microbe -
Int J Mol Med 12 : 701 -704, 2003 derived butyrate induces the differentiation of colonic regu-
42. Hanai H, Kanauchi O, Mitsuyama K, Andoh A, Takeuchi K, latory T cells. Nature 504 : 446-450, 2013
Takayuki I, Araki Y, Fujiyama Y, Toyonaga A, Sata M, Kojima 57. Strober W, Watanabe T : NOD2, an intracellular innate im-
A, Fukuda M, Bamba T : Germinated barley foodstuff pro- mune sensor involved in host defense and Crohn’s disease.
longs remission in patients with ulcerative colitis. Int J Mol Mucosal Immunol 4 : 484 -495, 2011
Med 13 : 643-647, 2004 58. Fritz T, Niederreiter L, Adolph T, Blumberg RS, Kaser A :
43. Faghfoori Z, Navai L, Shakerhosseini R, Somi MH, Nikniaz Z, Crohn’s disease : NOD2, autophagy and ER stress coverage.
Norouzi MF : Effects of an oral supplementation of germi- Gut 60 : 1580-1588, 2011
nated barley foodstuff on serum tumour necrosis factor-alpha, 59. Sheridan J, Mack DR, Amre DK, Israel DM, Cherkasov A, Li
interleukin-6 and -8 in patients with ulcerative colitis. Ann Clin H, Grimard G, Steiner TS : A non-synonymous coding vari-
Biochem 48 : 233-237, 2011 ant (L616F) in the TLR5 gene is potentially associated with
44. Faghfoori Z, Shakerhosseini R, Navai L, Somi MH, Nikniaz Z, Crohn’s disease and influences responses to bacterial flagel-
Abadi A : Effects of an oral supplementation of germinated lin. PLoS One 8 : e61326, 2013
barley foodstuff on serum CRP level and clinical signs in pa- 60. Virgin HW, Levine B : Autophagy genes in immunity. Nat Im-
tients with ulcerative colitis. Health Promotion Perspectives munol 10 : 461-470, 2009
4 : 116-121, 2014 61. Borody TJ, Waren EF, Leis S, Surace R, Ashman O : Treat-
45. Kanauchi O, Iwanaga T, Andoh A, Araki Y, Nakamura T, ment of ulcerative colitis using fecal bacteriotherapy. J Clin
Mitsuyama K, Suzuki A, Hibi T, Bamba T : Dietary fiber frac- Gastroenterol 37 : 42-47, 2003
tion of germinated barley foodstuff attenuated mucosal damage 62. Khoruts A, Dicksved J, Jansson JK, Sadowsky MJ : Changes
 The Journal of Medical Investigation Vol. 63 February 2016 37

in the composition of the human fecal microbiome after bac- 71. Albenberg LG, Wu GD : Diet and the intestinal microbiome :
teriotherapy for recurrent Clostridium difficile -associated associations, functions, and implications for health and disease.
diarrhea. J Clin Gastroenterol 44 : 354-360, 2010 Gastroenterology 146 : 1564-1572, 2014
63. Collado MC, Cernada M, Bäuerl C, Vento M, Pérez-Martínez : 72. Kibe R, Sakamoto M, Hayashi H, Yokota H, Benno Y : Matu-
Microbial ecology and host-microbiota interactions during ration of the murine cecal microbiota as revealed by terminal
early life stages. Gut Microbes 3 : 352-365, 2012 restriction fragment length polymorphism and 16SrRNA gene
64. Larsen N, Vogensen FK, van den Berg FW, Nielsen DS, clone libraries. FEMS Microbiol Lett 235 : 139 -146, 2004
Andreasen AS, Pederson BK, Al-soud WA, Sorensen SJ, 73. Kelly D, King T, Aminov R : Importance of microbial coloniza-
Hansen LH, Jakobsen M : Gut microbiota in human adults tion of the gut in early life to the development of immunity.
with type 2 diabetes differs from non-diabetic adults. PLoS Mutation Res 622 : 58 -69, 2007
One 5 : e9085, 2010 74. Mulder IE, Schmidt B, Stokes CR, Lewis M, Bailey M, Aminov
65. Delzenne NM, Cani PD : Gut microbiota and the pathogene- RI, Prosser JI, Gill BP, Pluske JR, Mayer CD, Musk CC, Kelly
sis of insulin resistance. Curr Diab Rep 11 : 154-159, 2011 D : Environmentally -acquired bacteria influence microbial di-
66. Hildebrandt MA, Hoffman C, Sherrill-Mix SA, Keilbaugh SA, versity and natural innate immune responses at gut surfaces.
Hamady M, Chen Y-Y, Knight R, Ahima RS, Bushman F, Wu BMC Biology 7 : 79, 2009
GD : High fat diet determines the composition of the murin 75. Hattori M, Taylor TD : The human intestinal microbiome : a
gut microbiome independently of obesity. Gastroenterology new frontier of human biology. DNA Res 16 : 1-12, 2009
137 : 1716-1724, 2009 76. Qin J, Li Y, Cai Z, Li S, Zhu J, Zhang F, Liang S, Zhang W,
67. Bajaj JS, Heuman DM, Hylemon PB, Sanyal AJ, White MB, Guan Y, Shen D, Peng Y, Zhang D, Jie Z, Wu W, Qin Y, Xue
Monteith P, Noble NA, Unser AB, Daita K, Fisher AR, W, Li J, Han L, Lu D, Wu P, Dai Y, Sun X, Li Z, Tang A, Zhong
Sikaroodi M, Gillevet PM : Altered profile of human gut mi- S, Li X, Chen W, Xu R, Wang M, Feng Q, Gong M, Yu J,
crobiome is associated with cirrhosis and its complications. Zhang Y, Zhang M, Hansen T, Sanchez G, Raes J, Falony G,
J Hepatol 60 : 940-947, 2014 Okuda S, Almeida M, LeChatelier E, Renault P, Pons N, Batto
68. Schnabl B, Brenner DA : Interactions between the intestinal J-M, Zhang Z, Chen H, Yang R, Zheng W, Li S, Yang H, Wang
microbiome and liver diseases. Gastroenterology 146 : 1513 - J, Ehrlich SD, Nielsen R, Pederson O, Kristiansen K, Wang
1524, 2014 J : A metagenome -wide association study of gut microbiota
69. Everard A, Belzer C, Geurts L, Ouwerkerk JP, Druart C, in type 2 diabetes. Nature 490 : 55 -60, 2012
Bindels LB, Guiot Y, Derrien M, Muccioli GG, Delzenne NM, 77. Le Chatelier E, Nielsen T, Qin J, Prifti E, Hildebrand F, Falony
de Vos WM, Cani PD : Cross-talk between Akkermansia mu- G, Almeida M, Arumugam M, Batto J-M, Kennedy S, Leonard
ciniphila and intestinal epithelium controls diet-induced obe- P, Li J, Burgdorf K, Grarup N, Jorgensen T, Brandslund I,
sity. Proc Natl Acad Sci USA 110 : 9066-9071, 2013 Nielsen HB, Juncker AS, Bertalan M, Levenez F, Pons N,
70. Okubo H, Sakoda H, Kushiyama A, Fujishiro M, Nakatsu Y, Rasmussen S, Sunagawa S, Tap J, Tims S, Zoetendal EG,
Fukushima T, Matsunaga Y, Kamata H, Asahara T, Yoshida Y, Brunak S, Clément K, Doré J, Kleerebezem M, Kristiansen K,
Chonan O, Iwashita M, Nishimura F, Asano T : Lactobacillus Renault P, Sicheritz-Ponten T, de Vos WM, Zucker J-D, Raes
casei strain Shirota protects against nonalcoholic steatohepa- J, Hansen T, MetaHIT consortiam, Bork P, Wang J, Ehrlich
titis development in a rodent model. Am J Physiol Gastrointest SD, Pederson O : Richness of human gut microbiome corre-
Liver Physiol 305 : G911 -G918, 2013 lates with metabolic markers. Nature 500 : 541-546, 2013