A New Species of Eracon (Hesperiidae: Pyrginae)

Substantiated by a Number of Traits, Including Female

Genitalia

Author: Grishin, Nick V.

Source: The Journal of the Lepidopterists' Society, 68(3) : 149-161
Published By: The Lepidopterists' Society
URL: https://doi.org/10.18473/lepi.v68i3.a1

BioOne Complete (complete.BioOne.org) is a full-text database of 200 subscribed and open-access titles
in the biological, ecological, and environmental sciences published by nonprofit societies, associations,
museums, institutions, and presses.

Your use of this PDF, the BioOne Complete website, and all posted and associated content indicates your
acceptance of BioOne’s Terms of Use, available at www.bioone.org/terms-of-use.

Usage of BioOne Complete content is strictly limited to personal, educational, and non - commercial use.
Commercial inquiries or rights and permissions requests should be directed to the individual publisher as
copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit
publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to
critical research.

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 VOLUME 68, NUMBER 3 149

Journal of the Lepidopterists’ Society

68(3), 2014, 149–161

A NEW SPECIES OF ERACON (HESPERIIDAE: PYRGINAE) SUBSTANTIATED BY A NUMBER OF

TRAITS, INCLUDING FEMALE GENITALIA

NICK V. GRISHIN
Howard Hughes Medical Institute and Departments of Biophysics and Biochemistry, University of Texas Southwestern Medical Center,
5323 Harry Hines Blvd, Dallas, TX, USA 75390-9050; e-mail: grishin@chop.swmed.edu

DANIEL H. JANZEN & WINNIE HALLWACHS

Department of Biology, University of Pennsylvania, Philadelphia, PA 19104; e-mails: djanzen@sas.upenn.edu, whallwac@sas.upenn.edu

ABSTRACT. A new species of Eracon Godman & Salvin, 1894 is described from Central America. Eracon sarahburnsae Grishin,
sp. nov. differs from its South American sister species Eracon clinias by wing patterns, male and female genitalia, and DNA bar-
code. Lectotypes for Spioniades clinias Mabille, 1878 and Arteurotia celendris Hewitson, 1878, and a neotype for Arteurotia epipola
Plötz, 1882, are designated to stabilize nomenclature and current usage of these names. The neotype designation makes Arteurotia
epipola an objective junior synonym of Arteurotia celendris, and we confirm the status of A. celendris as a junior subjective synonym
of Spioniades clinias.
Additional key words: cryptic species, biodiversity, caterpillars, skipper butterflies, Area de Conservación Guanacaste, Costa Rica

New data and novel methods of analysis stimulate from South America, are revealed (Grishin et al.
scientific discoveries, especially at field interfaces. 2013b). Here we argue that a Central American Eracon
Comprehensive rearing inventory of the non-leaf miner at first glance similar to Eracon clinias (Mabille, 1878),
species of Lepidoptera of Area de Conservación differs from it in many aspects of morphology
Guanacaste in northwestern Costa Rica (ACG), (including facies, male and female genitalia), as well as
augmented with the analysis of their ecology and DNA DNA barcodes, sufficiently to be recognized as a
barcodes (the 654 base pair region of mitochondrial distinct species. Interestingly, while male genitalia
DNA coding for the C-terminal segment of cytochrome appear to be more visually similar interspecifically and
c oxidase subunit 1 (COI)), has been successful in more variable intraspecifically in these two species of
revealing a large number of undescribed Hesperiidae Eracon, female genitalia offer obvious and simple
species (Hebert et al. 2004, Janzen et al. 2009, 2011, diagnostic characters for separation of the two species.
2012, Burns et al. 2013, Grishin et al. 2013a, b). While It is equally pleasing to see that DNA barcodes are
some of these new species are very different consistent with the species (vs. subspecies) status of the
morphologically from their closest relatives, e.g. new taxon, thus complementing traditional
Porphyrogenes peterwegei Burns, 2010 and the other morphological analysis.
species of Porphyrogenes E. Watson, 1893 (Burns et al.
2010), others are much more similar and require close MATERIALS AND METHODS
scrutiny to distinguish them, e.g. species of Venada Adult specimens used in this study are from the
Evans, 1952 and Perichares Scudder, 1872 (Burns & following collections: National Museum of Natural
Janzen 2005, Burns et al. 2008, 2013). Each of these History, Smithsonian Institution, Washington, DC,
cases benefitted from a large number of specimens USA (USNM); Natural History Museum, London, UK
reared from wild-caught caterpillars (Janzen & (BMNH); Museum für Naturkunde, Berlin, Germany
Hallwachs 2011) for comparative analysis and (ZMHB); and American Museum of Natural History,
evaluation of intraspecific variation, knowledge of New York, NY, USA (AMNH); and McGuire Center
caterpillar morphology, food plants and other aspects of for Lepidoptera and Biodiversity, Florida Museum of
ecology, and comparison of DNA barcodes. This fertile Natural History, Gainesville, FL, USA (MGCL). All
complementary of extensive morphological, ecological specimens reared from wild-caught caterpillars by the
and DNA data is working very well for the ACG inventory are so indicated with a specimen
characterization of complex butterfly biodiversity. voucher code in the format yy-SRNP-x…, where “yy”
Such a comparative analysis reveals new species not are the last two digits of a year and “x…” is the serial
only within ACG, but also on a wider scale. Central number (1 to 5 digits long) of a specimen recorded for
American sibling species, allied to species described that year, e.g., 5289 or 22467. (A 6-digit code means

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 150150 JOURNAL OF THE LEPIDOPTERISTS’ SOCIETY

that the adult specimen was wild-caught instead of specimens, revealed that the ACG specimens were
reared.) This SRNP code can be sought on the darker and with less patterned wings. Costa Rican and
inventory web site (Janzen and Hallwachs 2013) and Panamanian wild-collected E. clinias-like specimens
soon, in general internet search engines. When they are were similar to reared Costa Rican specimens (i.e.
reared, adults are on average slightly smaller than the darker, less patterned) and did not match South
wild-caught ones that usually populate museums. American specimens (Figs. 1–28). These differences
Standard entomological techniques were used for suggest that Central American populations could
dissection (Robbins 1991), i.e. the distal part of adult constitute a species distinct from South American
abdomen was broken off, soaked for 40 minutes (or populations. To address our observations further, we
until ready) in 10% KOH at 60°C (or overnight at room first stabilize the relevant nomenclature and clarify the
temperature), dissected, and subsequently stored in a taxonomy of the three names that could be assigned to
small glycerol-filled vial on the pin under the specimen. E. clinias-like specimens (Evans 1953, Mielke 2005).
Genitalia and wing venation terminology follows We designate lectotypes for two of the names and a
Steinhauser (1981). Length measurements are in neotype for the third. This action assigns defined
metric units and were made from photographs of identities to the three names and opens a way to the
specimens taken with a scale and magnified on a description of a new species without confusion with the
computer screen. Photographs of specimens and dry three existing names.
genitalia were taken by the author with Nikon D200 Lectotype designation for Spioniades clinias
and Nikon D800 cameras through a 105 mm f/2.8G Mabille, 1878: The original description of Spioniades
AF-S VR Micro-Nikkor lens; dissected genitalia were clinias mentions neither the number of specimens, nor
photographed in glycerol with the Nikon D200 camera their variation, and only states a single location (“E
without the lens and through microscopes at 2× and 5× Cayenna” [possibly French Guiana]) (Mabille 1878).
magnifications. Images were assembled and edited in While it is likely that the description was written from a
Photoshop CS5.1. Genitalia photographs were taken in single specimen, it is not possible to prove it. However,
several focus planes and stacked in Photoshop to to stabilize the nomenclature of Eracon in the light of
increase apparent depth of field. DNA sequences were new species described below, in particular because the
downloaded from GenBank http://genbank.gov/ and original description of S. clinias is not sufficient to
BOLD database (Ratnasingham & Hebert 2007), distinguish between it and the new species, it is
aligned by hand since they matched throughout their desirable to have a single specimen as the name-
length without insertions or deletions, and analyzed bearing type. A specimen in the Natural History
using the Phylogeny.fr server at Museum, London, UK (BMNH) that is curated as a
http://www.phylogeny.fr with default parameters type of Spioniades clinias, comes from the Mabille
(Dereeper et al. 2008). Many of these sequences have collection, agrees with the original description and
been reported in Janzen et al. (2011) and photographs bears nine labels: small, round, white with red circle,
of specimens are available from the Area de printed: || Type ||, on front and handwritten: || H | 700 ||,
Conservación Guanacaste (ACG) on-line database on back; white, handwritten in red: || clinias | Mab. ||;
(Janzen & Hallwachs 2013) and BOLD database small red stripe, no data; medium, rectangular, gray,
(Ratnasingham & Hebert 2007) to confirm or suggest handwritten: || = Arteurotia | celendris, Hew. ||; small,
identifications. rectangular, white, printed: || Ex musæo | P. Mabille |
1923 ||; small, round, yellow, handprinted: || 78 ||; white,
RESULTS AND DISCUSSION medium, typed: || R. Oberthür Coll. | Brit. Mus. 1931-
A large-scale collecting and rearing of non-leaf 136 ||; medium, rectangular, white, printed: || R.
mining moths and butterflies from wild-collected Oberthür Coll. | Brit. Mus. 1931-136 ||; long, white,
caterpillars in ACG produce rich datasets for the study printed: || BMNH(E) #982941 || (the last label was
of biodiversity (Janzen et al. 2011). These extensive added by NVG during photography and inventory of
datasets are particularly useful for understanding this specimen), is hereby designated as the lectotype of
intraspecific variation and delineation of species Spioniades clinias. The following red label will be
boundaries. Augmented with mitochondrial DNA COI added to the specimen after publication of this study: ||
barcode sequences, analysis of specimens and their LECTOTYPE | Spioniades clinias | Mabille, 1-II-1878.
ecology is sensitive to discovery of sibling and cryptic | Pet. Nouv. Ent. 2: 201 | designated by Grishin, 2014 ||.
species. Comparison of over 40 ACG Eracon reared This specimen and its labels are illustrated (Figs. 12,
specimens that key out to Eracon clinias using Evans 26). It is a male with minimal scale loss, right antenna
(1953), along with South American E. clinias and tornus of left hindwing missing. This specimen

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 VOLUME 68, NUMBER 3 151

seems to be the only known syntype in collections. This number of specimens in the type series, nor the
lectotype is designated to ensure nomenclatural collection that contained them (Plötz 1882). Both
stability and avoid confusion with the new species Spioniades clinias and Arteurotia epipola were
described below. Spioniades clinias was transferred to described apparently from French Guiana (“E
genus Eracon (type species Eracon biternata (Mabille, Cayenna” and “Cayenne”, respectively) within a few
1889)) by Evans (1953: 36). years of one another. Texts of both descriptions are very
Lectotype designation for Arteurotia celendris similar (Mabille 1878, Plötz 1882), and that of
Hewitson, 1878: The original description of Spioniades clinias also lacks collection information. It is
Arteurotia celendris mentions neither the number of conceivable that these taxa were described from the
specimens, nor their variation, and only states a single same specimen(s). While many Plötz types (of names
location (“Amazons” [Brazil]) and a single collector that he attributed to Maassen) are currently in the
(“Bates”) (Hewitson 1878). To stabilize nomenclature ZMHB collection, we were not able to locate
of Eracon in the light of new species described below, specimens labeled as Arteurotia epipola types there.
in particular because the original description of Only two males of E. clinias were found by NVG after
Arteurotia celendris is not sufficient to distinguish every specimen in every Hesperiidae drawer was
between it and the new species, it is desirable to have a examined. The ZMHB card-catalogue also did not
single specimen as the name bearing type. A specimen contain information about Arteurotia epipola.
in the Natural History Museum, London, UK (BMNH) Likewise, we failed to find the Plötz illustration
that is curated as the type of Arteurotia celendris, referred to by Godman (1907) among the copies of
comes from the Hewitson collection, agrees with the Plötz drawings in BMNH (drawing number 1340 for
original description and bears six labels: small, round, Arteurotia epipola apparently was not copied, as
white with red circle, printed: || Type ||, on front and drawing 1352 follows 1339 on the next page).
handwritten: || H | 679 ||, on back; small, round, white Therefore, the only information about Arteurotia
with red circle, printed: || Type ||, on front and epipola would be that derived from the original
handwritten: || Calendris, | Hew. ||, on back; small, description (Plötz 1882: 256). The original description
rectangular, white, handwritten: || Celendris ||; large, of Arteurotia epipola mentions a narrow, white, crossed
rectangular, white, handprinted and printed: || Amazon. by dark veins transversal band in the middle of both
| Hewitson Coll. | 79-69. | Conognathus | calendris. 1 ||; surfaces of the hindwing, extensive blue overscaling
small, rectangular, white, handwritten: || Amaz ||, glued and a “black rear angle” on the hindwing underside
to the back of the previous label; long, white, printed: || (Plötz 1882). Neither the band, blue overscaling, nor
BMNH(E) #982940 || (the last label was added by NVG the tornal hindwing dark area are pronounced in
during photography and inventory of this specimen), is Central American specimens (Figs. 1–8, 15–22), but
hereby designated as the lectotype of Arteurotia are very noticeable in many E. clinias specimens (Figs.
celendris. The following red label will be added to the 9–14, 23–28). Additionally, the specimens were
specimen after publication of this study: || apparently from French Guiana. This indicates to us
LECTOTYPE | Arteurotia celendris | Hewitson, IV- that the name Arteurotia epipola should not apply to
1878. |Ann. & Mag. Nat. Hist. (5)1: 347–348 | the Central American specimens and is indeed most
designated by Grishin, 2014 ||. This specimen and its likely a synonym of Spioniades clinias, as suggested by
labels are illustrated (Figs. 9, 23). It is a male, mounted Godman (1907) and supported by all subsequent
on a minuten pin, both antennae missing and wings references (e.g. Draudt 1922, Shepard 1934, Evans
with glue, indicating extensive repair. Evidence at hand 1953, Mielke 2005). To ensure this interpretation of the
cannot support Arteurotia celendris as a biologically name followed in the literature for the last 105 years,
distinct species, and its continued treatment as a junior thus preserving stability of nomenclature, a specimen
(by just 2 months!) synonym of Spioniades clinias from French Guiana, which is simultaneously the
appears reasonable at the moment (Shepard 1934, lectotype of Spioniades clinias (designated above), in
Evans 1953, Mielke 2005). The lectotype is designated BMNH collection (BMNH(E) #982941, Figs. 12, 26),
to ensure nomenclatural stability and avoid confusion is hereby designated as the neotype of Arteurotia
with the new species described below. epipola. The following red label will be added to the
Neotype designation for Arteurotia epipola specimen after publication of this study: || NEOTYPE |
Plötz, 1882: After inspection of the original Plötz Arteurotia epipola | Plötz, 1882 (Maassen in litt.). |
drawings, Godman (1907) concluded that Arteurotia Berl. ent. Ztschr. 26: 256 | designated by Grishin, 2014
epipola is a synonym of Eracon clinias. The original ||. This neotype designation makes Arteurotia epipola a
description of Arteurotia epipola mentions neither the junior objective synonym of Spioniades clinias. We

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 152152 JOURNAL OF THE LEPIDOPTERISTS’ SOCIETY

FIGS. 1–28. Eracon specimens. 1–14. dorsal and 15–28. ventral views of the same specimens. 1, 15. E. sarahburnsae holotype m, data in
text. 2–8. and 16–22. E. sarahburnsae [USNM]: 2–4 and 16–18 are paratypes; DNA barcodes for 5–8 and 19–22 are lacking and identifi-
cation is tentative. 9–14. and 23–28. E. clinias: 9, 23. lectotype of Arteurotia celendris Hewitson, 1878, m, Brazil: Amazonas, leg. Bates
[BMNH]; 12, 26. lectotype of Spioniades clinias Mabille, 1878, and, simultaneously, neotype of Arteurotia epipola Plötz, 1882, m, French
Guiana [BMNH] (all three designated herein). Voucher codes for ACG paratypes: 2, 16 - f 05-SRNP-22120; 3, 17 - m 05-SRNP-22467; 4,
18 - f 05-SRNP-22121, data in text. Data for other USNM specimens: 5, 19 - m, Costa Rica: Limón Prov., Guapiles, May, Schaus & Barnes
coll., genitalia NVG130614-44 (genitalia Fig. 29l); 6, 20 - f, Costa Rica: Limón Prov., Banano River, III-1907, Wm. Schaus collection; 7, 21
- m, Panama: Panamá Prov., Distrito de El Llano, Cordillera de San Blas, N of El Llano, ca. 330 m, 10-V-1978, leg. G. B. Small; 8, 22 - f,
Panama: Chiriqui Prov., “Bocas del Toro”, 24-III-1985, leg. G. B. Small; (continued on next page)

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 VOLUME 68, NUMBER 3 153

FIGS. 1–28. (Continued) Eracon specimens. 1–14. dorsal and 15–28. ventral views of the same specimens.10, 24 - m, Brazil: Rondônia,
vic. Caucalandia, 10.533 -62.8, 160-350 m, 9-X-1991, leg. J. Kemner, genitalia X-6056 J. M. Burns 2004 (genitalia Fig. 29q); 11, 25 - f,
Ecuador: Orellana Prov., Yasuni Research Station, Rios Tivacuno & Tiputini, 0.675 -76.397, 220 m, 29-X-1998, leg. D. H. Ahrenholz, geni-
talia NVG120922-14 (genitalia Fig. 30g, h); 13, 27 - m, Peru: Loreto Prov., Rio Amazones, 200 m, Explorama Inn, 25 mi E Iquitos; {9-12&17-
21}-IX-1990, leg. R. Leuschner, genitalia NVG130614-44 [USNM] (genitalia Fig. 29s); 14, 28 - f, Peru: Tambopata Prov., 30 km SW Puerto
Maldonado, 300 m, 30-IV-1984, leg. S. S. Nicolay, genitalia NVG120922-13 (genitalia Fig. 30e, f). Several half-side images have been flipped
and pinholes and some other imperfections have been digitally removed to emphasize actual elements of the pattern in all specimens,
except for the types of E. clinias, E. epipola and E. celendris. Labels for primary type specimens are shown below each specimen, except for
the E. sarahburnsae holotype where labels are also above. Labels are at 1/2 the scale. Species names for each row, names for primary types
(LT - lectotype, NT - neotype, above a specimen), general locations and sexes are shown.

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 154154 JOURNAL OF THE LEPIDOPTERISTS’ SOCIETY

FIG. 29. Male genitalia. a–m. Eracon sarahburnsae: a–i. holotype, voucher code 01-SRNP-5247, genitalia X-6059 J. M. Burns 2004
(Figs. 1, 15) in several views: a. dorsal, b. right dorsolateral, c. posterior, d. anterior, e. left lateral, f. right lateral, g. ventral, h. left ven-
trolateral, i. right posterolateral; j. paratype, genitalia X-6058 J. M. Burns 2004, voucher code 01-SRNP-5289; k. genitalia X-5223 J. M.
Burns 2002, voucher code 02-SRNP-7253; l. Costa Rica: Guapiles, May, Schaus & Barnes coll., genitalia NVG130614-44 (Figs. 5, 19);
m. Panama: Panamá Province, 5mi N of El Llano, 9.283 -79.0, ca. 330 m, 17-V-1978, leg. G. B. Small, genitalia X-6057 J. M. Burns
2004. n. E. sarahburnsaeDHJ02, genitalia X-6869 J. M. Burns 2010, voucher code 05-SRNP-1688. It has a 1.5–1.7% difference in
DNA barcode from other ACG E. sarahburnsae specimens and may represent yet another undescribed cryptic species. o–s. E. clinias:
o–p. Brazil: Pará, Saunders Coll., Godman-Salvin Coll. 1912-23, minislide 651, pinned under the specimen, tegumen squashed in slide
preparation, interior view of left valva is shown in p; q. Brazil: Rondônia, vic. Caucalândia, 10.533 -62.8, 160-350 m, 9-X-1991, leg. J.
Kemner, genitalia No. X-6056 J. M. Burns 2004 (Figs. 10, 24); r. Brazil: Rondônia, vic. Caucalândia, 10.533 -62.8, 160-350 m, 12-X-
1991, leg. J. MacDonald, genitalia X-6073 J. M. Burns 2004; s. Peru: Loreto Province, Rio Amazones, 200 m, Explorama Inn, 40 km
E Iquitos; {9-12&17-21}-IX-1990, leg. R. Leuschner, genitalia NVG130614-45 (Figs. 13, 27). All specimens are at USNM except o–p,
which is in BMNH and copyright (©) Trustees of the Natural History Museum, London (used with permission).

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 VOLUME 68, NUMBER 3 155

FIG. 30. Female genitalia. a–d. Eracon sarahburnsae, e–f. Eracon clinias. a–b. Panama: Colon Prov., Nuevo Tonosi, 17-I-1980,
leg. G. B. Small, genitalia NVG120922-12 [USNM]; c–d. paratype, Costa Rica: Guanacaste Prov., ACG, voucher code 05-SRNP-
1687, data in text, genitalia NVG120922-15 [USNM]; e–f. Peru: Tambopata Prov., 30 km SW Puerto Maldonado, 300 m, 30-IV-
1984, leg. S. S. Nicolay, genitalia NVG120922-13 [USNM] (Figs. 14, 28); g–h. Ecuador: Orellana Prov., Yasuni Research Station,
Rios Tivacuno & Tiputini, 0.675 -76.4, 220 m, 29-X-1998, leg. D. H. Ahrenholz, genitalia NVG120922-14 [USNM] (Figs. 11, 25);
a, e. complete genitalia; b–d, f–h. sterigma with ovipositor lobes and the last tergum; a–c, e–g. ventral views and d, h. ventrolat-
eral view. Smaller scale bar refers to a & e.

believe that there is an exceptional need to designate Eracon sarahburnsae Grishin, new species
the neotype to ensure nomenclatural stability by (Figs. 1–8, 15–22, 29a–m, 30a–d,
unambiguously defining this taxon and thus avoiding a 31, 32 part, 33 part)
possible confusion with a new species described below.
The characters to differentiate this species (as defined Description: Male (n=20, Figs. 1, 3, 5, 7, 15, 17, 19, 21, 33 part)
– holotype forewing length = 14.6 mm. Forewing with very narrow
by Plötz 1882) are discussed above and additional costal fold. Forewing dorsally dark brown with even darker areas in
characters are indicated in Fig. 33 (right, for E. clinias). discal cell, base of Cu1–Cu2 cell and discal part of Cu2–2A cell; discal
Analysis of wing patterns, genitalia and cell with two white spots near the bases of R2 and Cu1 veins,
elongated white spot aligned with these in Sc-R1 cell; zigzag, ξ-
mitochondrial DNA barcode sequences reveals that shaped line of nine postmedian white spots in each cell between R3
Central American E. clinias-like specimens differ and 2A veins (cell Cu2–2A with two spots), these spots nearly
significantly from South American specimens. Central equidistant from each other, except the spot in M3–Cu1 cell closer to
spot in Cu1–Cu2 cell than to spot in M2–M3 cell, spot in Cu1–Cu2 cell
American populations do not fit the above concept of crescent-shaped. Olive and slate-colored (pale bluish) diffuse
E. clinias with its synonyms E. celendris and E. epipola, overscaling, stronger in submarginal area and forming diffuse slate-
and therefore are described here as a new species, colored spot in every cell distally from the white spots. Ventrally
similar to dorsal surface, but paler, without darker areas, slate-colored
similar to, but distinct from, South American E. clinias. overscaling concentrating in submarginal spots more extensive

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 156156 JOURNAL OF THE LEPIDOPTERISTS’ SOCIETY

towards tornus. Fringe brown with pale scales mostly near apex and on A. membranacea. Alajuela Prov.: Sector Rincon Rain Forest: 1m
Cu2–2A cell. Hindwing produced at the tornus, dorsally brown, with site Sendero Rincon, 10.8962 -85.27769, 430 m, collected on 26-VI-
vague marginal band of pale diffuse spots, and even less defined 2001 as last instar, adult eclosed on 05-VIII-2001, voucher code 01-
vestigial submarginal band, slate-colored bluish overscaling, mostly of SRNP-5289, genitalia No. X-6058 J. M. Burns 2004; site Quebrada
hair-like scales in distal half. Ventrally similar to dorsal surface, but Guarumo, 10.90445 -85.28412, 400m: 1m collected on 20-VII-2007 as
the marginal band of white scales more pronounced in and posterior penultimate instar, adult eclosed on 18-VIII-2007, voucher code 07-
to discal cell, very weak to absent anterior of discal cell, slate-colored SRNP-42093; 1m collected on 20-VII-2007 as penultimate instar,
overscaling mostly in and posterior to discal cell, weaker by the adult eclosed on 31-VIII-2007, voucher code 07-SRNP-42094; 1f site
margin, concentrating into inverted-V shaped submarginal spots in Rio Francia Arriba, 10.89666 -85.29003, 400 m, collected on 03-XI-
some cells, wing brown without overscaling near tornus. Fringe 2006 as last instar, adult eclosed on 13-XII-2006, voucher code 06-
brown with pale scales in groups. Head and palpi brown with some SRNP-44151; site Finca Hugo, 10.88068 -85.26968, 540m: 1f
olive and slate-colored scales above, slate-colored below, antennae collected on 16-X-2007 as penultimate instar, adult eclosed on 09-
length two-thirds of costa, mostly black, dull brown-yellow beneath XII-2007, voucher code 07-SRNP-42619; 1m collected on 16-X-2007
near and on club, nudum red-brown, 22–23 segments (n=4), collar as penultimate instar, adult eclosed on 06-I-2008, voucher code 07-
with olive and slate-colored scales. Thorax brown with some olive SRNP-42620; site Finca Aurita, 10.88409 -85.25728, 460m: 1f
scales above and on the sides beneath wings, slate-colored below, collected on 05-XII-2005 as last instar, adult eclosed on 31-XII-2005,
including pectus, legs brown with extensive slate-colored scales. voucher code 05-SRNP-43583; 1m collected on 04-I-2006 as last
Abdomen brown above with indistinct bands of slate-colored scales at instar, adult eclosed on 21-II-2006, voucher code 06-SRNP-40016
the ends of segments, slate-colored below with longer bluish scales (Figs. 31f-i); site Palomo, 10.96187 -85.28045, 96m: 1m collected on
basally and broad central brown line. Male genitalia (Figs. 29, 33 17-IX-2010 as penultimate instar, adult eclosed on 25-X-2010,
part) – tegumen with a pair of small caudal lobes at the base of uncus. voucher code 10-SRNP-67957; 1f collected on 17-IX-2010 as
Uncus shorter than tegumen, undivided, flattened from the sides, penultimate instar, adult eclosed on 05-XI-2010, voucher code 10-
curved in lateral view. Gnathos shorter than uncus, arms spiculose. SRNP-67958; 1f collected on 23-VII-2012 as penultimate instar,
Saccus elongated triangular, length as uncus. Valva broad, ampulla adult eclosed on 04-IX-2012, voucher code 12-SRNP-68151; site
with an oval-shaped rounded process, costa slightly concave before Cabanya, 10.87703 -85.23077, 340m: 1m collected on 23-VII-2008 as
ampulla, cucullus broad, rounded, extending caudad beyond the penultimate instar, adult eclosed on 17-VIII-2008, voucher code 08-
process off ampulla for about half of its length. Sacculus with a poorly SRNP-41449; 1f collected on 23-VII-2008 as penultimate instar,
defined rounded tooth. Aedeagus about the length of tegumen with adult eclosed on 23-VIII-2008, voucher code 08-SRNP-41450; Sector
uncus, no cornuti, and phallobase evenly upcurved. San Cristobal: site Puente Palma 10.9163 -85.37869, 460m: 1m
Female (n=13, Figs. 2, 4, 6, 8, 16, 18, 20, 22) – forewing length = collected on 30-III-2005 as penultimate instar, adult eclosed on 24-
13.5 to 16 mm, similar to male, but without costal fold and with more IV-2005, voucher code 05-SRNP-1714; 1m collected on 30-III-2005
rounded, slightly broader wings, nudum 24–25 segments (n=4). as penultimate instar, adult eclosed on 01-V-2005, voucher code 05-
Female genitalia (Figs. 30, 33 part) – lamella postvaginalis about as SRNP-1713; 1f collected on 30-III-2005 as antepenultimate instar,
long as wide, poorly sclerotized from half of its length near atrium, adult eclosed on 13-V-2005, voucher code 05-SRNP-1687, genitalia
caudal margin with a broad and shallow notch in the middle. Lamella NVG120922-15 (Figs. 30cd); 1f collected on 10-VII-2005 as
antevaginalis thin and narrow, expanding into narrow lateral lobes. antepenultimate instar, adult eclosed on 30-VIII-2005, voucher code
Antrum weakly sclerotized, slightly wider than ductus bursae. Ductus 05-SRNP-3823; site Sendero Huerta: 10.9305 -85.37223, 527 m, 1m
and corpus bursae weakly separated from each other, together about collected on 18-VI-2005 as antepenultimate instar, adult eclosed on
four times sterigma length. 26-VII-2005, voucher code 05-SRNP-3449; 1f collected on 05-VIII-
Barcode sequence of the holotype: Genbank Accession 2005 as penultimate instar, adult eclosed on 18-IX-2005, voucher
DQ292499, 651 base pairs: code 05-SRNP-4520; 1f collected on 25-XI-2005 as penultimate
AACTTTATATTTTATTTTCGGAATTTGAGCCGGAATAGTTGGA instar, adult eclosed on 19-I-2006, voucher code 05-SRNP-7368; 1m
ACATCTTTAAGTTTATTAATTCGAACTGAATTAGGTAATCCAGG collected on 01-VII-2007 as second instar, adult eclosed on 14-VIII-
GTCATTAATTGGGGATGATCAAATTTATAATACTATTGTTACAG 2007, voucher code 07-SRNP-2980; 1m collected on 01-V-2009 as
CTCATGCTTTTATCATAATTTTTTTCATAGTAATACCAATTATAA penultimate instar, adult eclosed on 29-V-2009, voucher code 09-
TCGGTGGATTTGGAAATTGACTTGTACCTCTTATATTAGGAGC SRNP-1734; 1m Sector Brasilia, site Gallinazo, 11.01825 -85.37199,
TCCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGAC 360 m, collected on 22-IV-2008 as antepenultimate instar, adult
TTTTACCCCCTTCTTTAATATTATTAATTTCAAGAAGTATTGTT eclosed on 23-V-2008, voucher code 08-SRNP-65365. Guanacaste
GAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCTTTA Prov.: Sector Del Oro: 1msite Quebrada Lajosa, 11.03306 -85.42876,
TCTGCTAATATTGCCCACCAAGGATCTTCTGTTGACTTAGCTA 400 m, collected on 30-VI-2008 as antepenultimate instar, adult
TTTTTTCCTTACATTTAGCAGGAATTTCATCTATTTTAGGAGCT eclosed on 02-VIII-2008, voucher code 08-SRNP-21838; site
ATTAATTTTATTACTACAATCATTAATATACGTATTAATAATCTTT Margarita, 11.03234 -85.43954, 380m: 1m collected on 28-XI-2003 as
CCTTCGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTAC last instar, adult eclosed on 06-I-2004, voucher code 03-SRNP-37802;
AGCTTTATTATTACTTTTATCTTTACCTGTATTAGCTGGAGCAA 1f collected on 13-VI-2005 as last instar, adult eclosed on 06-VII-
TCACAATACTTTTAACTGATCGAAATTTAAATACATCATTCTTT 2005, voucher code 05-SRNP-22121 (Figs. 4, 18, 31de); 1f collected
GATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACA on 13-VI-2005 as antepenultimate instar, adult eclosed on 18-VII-
Types: Holotype male has the following labels: white printed & 2005, voucher code 05-SRNP-22120 (Figs. 2, 16); 1m collected on 29-
hand-printed: || Voucher: D. H. Janzen & W. Hallwachs | caterpillar VI-2005 as antepenultimate instar, adult eclosed on 03-VIII-2005,
(Lepidoptera) database, | Area de Conservación Guanacaste, || Costa voucher code 05-SRNP-22467 (Figs. 3, 17); 1m collected on 24-VI-
Rica. http://janzen.sas.upenn.edu | 01-SRNP-5247 ||; white printed: || 2005 as antepenultimate instar, adult eclosed on 10-VIII-2005,
Genitalia No. | X-6059 | J. M. Burns 2004 ||; yellow printed - || LEGS voucher code 05-SRNP-22396; 1m collected on 24-VI-2005 as
AWAY | FOR DNA ||; red printed: || HOLOTYPE m | Eracon antepenultimate instar, adult eclosed on 26-VII-2005, voucher code
sarahburnsae | Grishin ||. Holotype data: Costa Rica: Area de 05-SRNP-22364; Sector Pitilla, site Medrano, 11.01602 -85.38053,
Conservación Guanacaste, Alajuela Province, Sector Rincon Rain 380m: 1m collected on 05-VII-2012 as antepenultimate instar, adult
Forest, Sendero Rincon, GPS: 10.8962 -85.27769, elevation 430 m, eclosed on 13-VIII-2012, voucher code 12-SRNP-71669; 1f collected
collected as penultimate instar by Freyci Vargas on 24-June-2001, fed on 05-VII-2012 as preantepenultimate instar, adult eclosed on 22-
on Apeiba membranacea Spruce ex. Benth. (Malvaceae), caterpillar VIII-2012, voucher code 12-SRNP-71670; 1m collected on 17-VII-
prepupal date 09-July-2001, adult eclosed 26-July-2001, voucher 2012 as preantepenultimate instar, adult eclosed on 22-VIII-2012,
code 01-SRNP-5247. Paratypes: 20 mm and 13 ff, all from Costa Rica, voucher code 12-SRNP-71781.
Area de Conservación Guanacaste, reared from caterpillars feeding Deposition of types: The holotype is in the National Museum of

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 VOLUME 68, NUMBER 3 157

FIG. 31. Immature stages of Eracon sarahburnsae. a–o caterpillars, ultimate instar; p–s pupa; in dorsal (b, e, i, o, s), dorsolateral (a,
d, h, j–l, n), ventral (q), ventro-lateral (r) and dorso-anterior (m, p) views, caterpillar heads in approximately anterior view are shown
in c, f, and g. Larval skin with a head capsule is visible in p and s. All specimens are from Costa Rica: Area de Conservación Guanacaste
(Janzen & Hallwachs 2013), voucher codes for them are: a–c - 06-SRNP-42043; d–e - 05-SRNP-22121 (paratype); f–i - 06-SRNP-
40016 (paratype); j–m - 05-SRNP-22393; n–o - 07-SRNP-42141; p–s - 06-SRNP-43593, data in text and additional information is avail-
able from Janzen & Hallwachs (2013). Some specimens lacking DNA barcodes (a–c & j–s) may be Eracon sarahburnsaeDHJ02.

Natural History, Smithsonian Institution, Washington, DC (USNM). taxonomic status. Therefore, only specimens with a known barcode
Two paratypes (05-SRNP-3449 & 05-SRNP-43583) are deposited in matching the holotype of E. sarahburnsae (termed Eracon
the Natural History Museum, London, UK (BMNH). Two paratypes cliniasDHJ01 in Janzen et al. 2011) were used as paratypes. The
(05-SRNP-22396 & 05-SRNP-22120) are deposited in the McGuire following 11 mm and 8 ff without sequenced DNA barcodes possess
Center for Lepidoptera and Biodiversity, Florida Museum of Natural the morphological (and where available) food plant characters of E.
History, University of Florida, Gainesville, FL (MGCL). All other sarahburnsae and are tentatively assigned to this species, but are also
paratypes remain in USNM. excluded from the type series: Costa Rica, Area de Conservación
Specimens excluded from the type series: Three specimens Guanacaste, reared from caterpillars feeding on Apeiba
from Costa Rica: ACG (voucher codes 05-SRNP-1688 (m), 09-SRNP- membranacea (Malvaceae): Alajuela Prov.: Sector Rincon Rain
40707 (f) & 12-SRNP-68843 (f) (Janzen & Hallwachs 2013), Forest: 1m site Sendero Rincon, 10.8962 -85.27769, 430 m, collected
baptized with the interim name Eracon cliniasDHJ02 in Janzen et al. on 20-V-2002 as second instar, eclosion date lost, genitalia No. X-5223
(2011), corrected to Eracon sarahburnsaeDHJ02 here, since they are J. M. Burns 2002, voucher code 02-SRNP-7253 [USNM]; 1m site
not E. clinias), which otherwise would be identifiable as E. Vado Rio Francia, 10.90093 -85.28915, 400 m, collected on 09-IX-
sarahburnsae by wing patterns and genitalia, differed by 1.3%–1.7% 2006 as last instar, adult eclosed on 29-IX-2006, voucher code 06-
in their DNA barcode sequence from other E. sarahburnsae SRNP-43416 [MGCL]; site Sendero Llano, 10.90276 -85.28996, 400
specimens and therefore are excluded from the type series. These m: 1m collected on 27-IX-2006 as antepenultimate instar, adult
three specimens sharing the same DNA barcode sequence may eclosed on 22-XI-2006, voucher code 06-SRNP-43702 [MGCL]; 1f
represent another cryptic Eracon species or extreme variation of the collected on 27-IX-2006 as antepenultimate instar, adult eclosed on
barcode. More specimens with this DNA barcode sequence are 08-XI-2006, voucher code 06-SRNP-43703 [MGCL]; 1f site
needed to assess morphological variation, and evaluate their Montanya Figueres, 10.88367 -85.29081, 460 m, collected on 25-

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 158158 JOURNAL OF THE LEPIDOPTERISTS’ SOCIETY

FIG. 32. DNA-derived data. DNA barcode distance matrix is shown on the right and a BioNJ (Dereeper et al. 2008) distance tree
corresponding to it is on the left. The 2% difference scale bar is placed below the tree. The first sequence is that of the Eracon sarah-
burnsae holotype. All distinct haplotypes of E. sarahburnsae are included. The sequence of 05-SRNP-3449 is significantly shorter
than the rest (549 vs. about 654 nucleotides), which accounts for anomalous statistics in the matrix. Eracon sarahburnsae DHJ02 is
one of the three specimens with identical barcodes that tree away from other E. sarahburnsae specimens, and called Eracon clinias
DHJ02 in Janzen et al. (2011). They may represent yet another undescribed cryptic species. Bootstrap support values are shown by
each node in the tree (except within the cluster of almost identical E. sarahburnsae sequences) and ACG voucher codes (with SRNP,
Janzen & Hallwachs 2013), GenBank accessions (with JN, http://genbank.gov/), or Olaf H. H. Mielke collection voucher code (with
OM) are indicated for each sequence. Bootstrap values near and below 0.5 may correspond to incorrect topology, thus the precise
phylogenetic position of E. biternata within Eracon is not confidently resolved (i.e. only trichotomy of the E. clinias, E. biternata and
E. paulinus groups is confidently supported). The Eracon tree was rooted with Spioniades abbreviata (Mabille, 1888) and Spioni-
ades artemides (Stoll, 1782) sequences. Percent difference, the number of different nucleotides and sequence length are shown be-
low, above and on the diagonal of the matrix, respectively. Values corresponding to differences between sister species (E. sarah-
burnsae vs. E. clinias and E. paulinus (Stoll, 1782) vs. E. lachesis (Dyar, 1918)) are shown in bold face font. E. clinias and E. paulinus
specimens are males and are from Brazil: Pará, Belem and E. biternata is a female from Brazil: Rondônia, near Cacaulândia,
Fazenda Rancho Grande, 21-VII-1991, leg. Mielke & Miers. All other specimens are from Costa Rica, Area de Conservación Gua-
nacaste, data in text and in Janzen & Hallwachs 2013.

VIII-2006, adult eclosed on 12-X-2006, voucher code 06-SRNP- Etymology: The name of the species honors Sarah
43125 [MGCL]; site Finca Aurita, 10.88409 -85.25728, 460m: 1f
collected on 08-VI-2006 as second instar, adult eclosed on 22-VII-
Burns, the wife of Dr. John M. Burns, Curator of
2006, voucher code 06-SRNP-42043 [Tree of Life Database] (Figs. Lepidoptera (emeritus) Department of Entomology,
31a-c); 1m collected on 08-VI-2006 as second instar, adult eclosed on National Museum of Natural History, Smithsonian
20-VII-2006, voucher code 06-SRNP-42042 [MGCL]; 1f site Finca
Hugo, 10.88068 -85.26968, 540 m, collected on 25-VII-2007 as
Institution, Washington, DC. John has identified and
antepenultimate instar, larva died of disease, discarded, voucher code curated more than 17,000 reared and DNA barcoded
07-SRNP-42141 (Figs. 31n–o); 1m site Sendero Tucan, 10.90424 - ACG inventory specimens of Hesperiidae, within
85.2712, 410 m, collected on 19-IX-2006 as second instar, pupa died
of disease, discarded, voucher code 06-SRNP-43593 (Figs. 31p-s). 1m
which this species and these specimens are embedded.
Guanacaste Prov.: Sector Del Oro, Margarita, 11.03234 -85.43954, Sarah shares John's passion for Hesperiidae and has
380 m, collected on 24-VI-2005 as antepenultimate instar, larva died helped him in all possible ways throughout his career.
of disease, discarded, voucher code 05-SRNP-22393 (Figs. 31j-m).
Costa Rica: Limón Prov.: 1m Guapiles, May, Schaus & Barnes coll.,
The name is a feminine noun in the genitive case.
genitalia NVG130614-44 [USNM] (Figs. 5, 19, 29l); 1f Banano River, Distribution and phenology: Currently, the
III-1907, Wm. Schaus collection [USNM] (Figs. 6, 20); 1m species is known from Costa Rica (Alajuela,
Manzanillo - Gandoca Trail, up to 9.6089 -82.6431, 13-IX-2004,
[Ichiro Nakamura collection]. Panama: 1f Chiriqui Prov., "Bocas del
Guanacaste, Limón Provinces) and Panama (Chiriquí,
Toro", 24-III-1985, leg. G. B. Small [USNM] (Figs. 8, 22); Colon Colon, Panamá Provinces), and has been reared in
Prov.: 1f east of Colon, Santa Rita Ridge, 9.367 -79.717, 460 m, 5-I- Costa Rica to eclose in all months of the year except
1969, S. S. Nicolay [USNM]; 1f Nuevo Tonosi, 17-I-1980, leg. G. B.
Small, genitalia NVG120922-12 [USNM] (Figs. 30a,b); Panamá
March and June (Janzen & Hallwachs 2013). Free-
Prov.: 1m Barro Colorado Island, 50 m, [eclosed] 15-III-1988, N. flying adults have been encountered by other collectors
Greig, rearing #137 (P. DeVries), dissection GTA#10192 [MGCL]; 1m in January, March, May and September.
Distrito de El Llano, Cordillera de San Blas, N of El Llano, ca. 330
m, 10-V-1978, leg. G. B. Small [USNM] (Figs. 7, 21); 1m 5mi N of El
Diagnosis: Evident similarities to South American
Llano, 9.283 -79.0, ca. 330 m, 17-V-1978, leg. G. B. Small, genitalia E. clinias place the new species in Eracon. The
No. X-6057 J. M. Burns 2004 [USNM] (Fig. 29m). combination of: (a) presence of a costal fold in males
Type locality: COSTA RICA: Area de Conservación Guanacaste,
Alajuela Province, Sector Rincon Rain Forest, site Sendero Rincon,
(vestigial in some specimens); (b) a hyaline spot over
GPS: 10.8962 -85.27769, 430 m. the cell spot mid costa; (c) lack of conspicuous dark

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 VOLUME 68, NUMBER 3 159

FIG. 33. Visual keys to species in the Eracon clinias group. Eracon sarahburnsae is in the left panel and Eracon clinias is in the
right panel. Dorsal and ventral aspects of each species as exemplified by males are shown above on the left and right of the species
name, respectively. Genitalia are shown below, male on the left and female on the right. Characters deemed to be most reliable in
separating the species are in red font.

bands on dorsal hindwing; (d) lack of a defined black elongated along anterior-posterior axis), with deeper
ocellus on dorsal forewing cell; (e) wings, especially notch on the distal margin, less sclerotized in the
hindwings with some pale-bluish scaling, differentiates anterior half (antrum and areas around less sclerotized
E. sarahburnsae and E. clinias from all other known than those in E. clinias, antrum is relatively narrower
species of Eracon. (Fig. 30)); (6) male genitalia (differences are more
E. sarahburnsae is distinguished from E. clinias by subtle) with cucullus protruding further back from the
the following characters (Fig. 33): (1) ventral hindwing obtuse process off the ampulla than in E. clinias, costa
base of cell Rs-M1 has white scales mixed with brown slightly concave near ampulla vs. almost straight in E.
scales forming a diffuse spot, vs. white spot with clearly clinias, with process of the ampulla less robust, slightly
defined edges in E. clinias; (2) ventral hindwing brown smaller and narrower than that in E. clinias, a small
tornal area less contrasting with the surrounding pale- tooth-like projection at the base of the valva off
bluish background than that in E. clinias; (3) dorsal and sacculus, which is well-developed in E. clinias, rounded
ventral hindwing with more restricted areas of pale- and almost lacking; phallobase relatively shorter with
bluish overscaling and weaker defined discal band of evenly curved ventral side vs. longer and bottle-shaped
white spots than those in E. clinias fresh specimens; (4) with a broad but definitive bulge in E. clinias (Fig. 29).
on the fore wing, the white spot in the cell M3–Cu1 cell Characters (1) and (5) are most readily observed in
is closer to the white spot in cell Cu1–Cu2 than to the distinguishing the two species (Fig. 33). Variation of
spot in cell M2–M3, vs. spot in the cell M3–Cu1 cell, male genitalia characters in both Eracon species can be
which is further from the white spot in cell Cu1–Cu2 assessed in Fig. 29. Additional illustrations of male and
than from the spot in cell M2–M3, or positioned half female genitalia of E. clinias are published by Austin
way between the two spots in E. clinias; (5) female (1997). Barcode sequences of the two species differ by
genitalia with lamella postvaginalis narrower (i.e. more about 3.5% (Fig.32). E. clinias is currently known only

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 160160 JOURNAL OF THE LEPIDOPTERISTS’ SOCIETY

from South America (Ecuador, Peru, the Guianas, Fund of Canada, Jessie B. Cox Charitable Trust, Blue Moon
Fund, Guanacaste Dry Forest Conservation Fund, Area de Con-
northern Brazil); E. sarahburnsae is known only from servación Guanacaste, Permian Global, USNM/Smithsonian and
Costa Rica and Panama. the University of Pennsylvania.
Immatures (Fig. 31) and foodplants: All ACG
rearings of E. sarahburnsae are from caterpillars LITERATURE CITED
feeding on mature leaves of the secondary forest rain AUSTIN, G. T. 1997. Hesperiidae of Rondônia Brazil: Eracon and a
new related genus, with descriptions of two new species (Lepi-
forest tree, Apeiba membranacea (Malvaceae). Its doptera: Hesperiidae: Pyrginae). Trop. Lepid. 8: 22–28.
absence from any other food plants in among the tens of BURNS, J. M. & D. H. JANZEN. 2005. Pan-Neotropical genus Venada
thousands of other ACG Hesperiidae caterpillars found (Hesperiidae: Pyrginae) is not monotypic: Four new species oc-
cur on one volcano in the Area de Conservación Guanacaste,
and reared (Janzen et al. 2011) suggests that it is a Costa Rica. J. Lepid.’ Soc. 59: 19–34.
specialist on this species of tree. However, in places BURNS, J. M., D. H. JANZEN, M. HAJIBABAEI, W. HALLWACHS & P. D.
where ACG rain forest grades into ACG dry forest, N. HEBERT. 2008. DNA barcodes and cryptic species of skipper
butterflies in the genus Perichares in Area de Conservación Gua-
Apeiba membranaceae is parapatric with Apeiba nacaste, Costa Rica. Proc. Nat. Acad. Sci. 105: 6350–6355.
tibourbou (Malvaceae) its dry forest analogue, and it is BURNS, J. M., D. H. JANZEN & W. HALLWACHS. 2010. Of many similar
possible that E. sarahburnsae may also feed on this species in the Neotropical genus Porphyrogenes (Lepidoptera:
Hesperiidae), a new one, repeatedly reared in Costa Rica, is rela-
second species of Apeiba. tively distinct. Proc. Entomol. Soc. Wash. 112: 32–42.
Ecology: Eracon sarahburnsae is clearly a denizen of BURNS, J. M., D. H. JANZEN, W. HALLWACHS & M. HAJIBABAEI. 2013.
ACG lowland to intermediate elevation rain forest, as is DNA barcodes reveal yet another new species of Venada (Lepi-
doptera: Hesperiidae) in northwestern Costa Rica. Proc. Ento-
its food plant. While the inventory has found and mol. Soc. Wash. 115: 37–47.
attempted to rear over 90 caterpillars of E. DEREEPER, A., V. GUIGNON, G. BLANC, S. AUDIC, S. BUFFET, F.
sarahburnsae, we have never seen an adult in nature. CHEVENET, J. F. DUFAYARD, S. GUINDON, V. LEFORT, M. LESCOT,
J. M. CLAVERIE & O. GASCUEL. 2008. Phylogeny.fr: robust phylo-
However, the inventory has not made an explicit effort genetic analysis for the non-specialist. Nucleic Acids Res. 36
to locate all food sources for adult butterflies in any part (Web Server issue): W465–W469.
of ACG. Being reared, adults are on average slightly DRAUDT, M. W. K. 1922. B. Grypocera, breitköpfige Tagfalter. 1. Fam-
ilie : Hesperidae, Dickköpfe. In: Seitz, A. (Ed)., Die Gross-
smaller than wild caught adults. Only three of the wild- Schmetterlinge der Erde. Stuttgart, Alfred Kernen. 5: 881–888.
caught caterpillars were parasitized—two by an EVANS, W. H. 1953. A catalogue of the American Hesperiidae indicat-
undescribed species of Hyposoter Forster, 1869 ing the classification and nomenclature adopted in the British
Museum (Natural History). Part III (Groups E, F, G) Pyrginae.
(Ichneumonidae: Campopleginae) and one by an Section II. London, British Museum (Natural History). v + 178
unidentified tachinid fly. pp., pls. 26–53.
GODMAN, F. D. 1907. Notes on the American species of Hesperiidae
ACKNOWLEDGMENTS described by Plötz. Annal. Mag. Nst. Hist. (7)20: 132–155.
GRISHIN, N. V., J. M. BURNS, D. H. JANZEN, W. HALLWACHS & M. HA-
We are indebted to the ACG parataxonomists for finding and
JIBABAEI. 2013a. Oxynetra: facies and DNA barcodes point to a
rearing the caterpillars; to ACG for providing a place for them to
new species from Costa Rica (Hesperiidae: Pyrginae: Pyrrhopy-
work and rear caterpillars; to the Biodiversity Institute of On-
gini). J. Lepid. Soc. 67: 1–14.
tario at the University of Guelph, Canada, as well as BOLD of
GRISHIN, N. V., D. H. JANZEN & W. HALLWACHS. 2013b. Hiding be-
iBOL (http://www.boldsystems.org/) for sequencing and analyz-
hind gaudy looks, a new Central American species of Phareas
ing the DNA barcodes. We are grateful to Robert K. Robbins,
(Hesperiidae: Eudaminae). J. Lepid. Soc. 67: 161–174.
John M. Burns, and Brian Harris (National Museum of Natural
HEBERT, P.D. N., E. H. PENTON, J. M. BURNS, D. H. JANZEN & W.
History, Smithsonian Institution, Washington, DC), David Lees
HALLWACHS. 2004. Ten species in one: DNA barcoding reveals
and Blanca Huertas (Natural History Museum, London, UK),
cryptic species in the neotropical skipper butterfly Astraptes ful-
Andrew D. Warren and Andrei Sourakov (McGuire Center for
gerator. Proc. Nat. Acad. Sci. 101: 14812–14817.
Lepidoptera and Biodiversity, Gainesville, FL), Wolfram Mey
HEWITSON, W. C. 1878. Descriptions of twenty new species of Hes-
(Museum für Naturkunde, Berlin, Germany), Andrew Johnston,
peridae from his own collection. Annal. Mag. Nst. Hist. (5)1:
David A. Grimaldi, and Suzanne Rab Green (American Mu-
340–348 {1 April}.
seum of Natural History, New York, NY) for granting access to
JANZEN, D. H. & W. HALLWACHS. 2011. Joining inventory by paratax-
the collections under their care and stimulating discussions; to
onomists with DNA barcoding of a large complex tropical con-
John M. Burns for first identifying the ACG Eracon as Eracon
served wildland in northwestern Costa Rica. PLoS ONE 6(8):
nr. clinias; to Donald Harvey (National Museum of Natural His-
e18123.
tory, Smithsonian Institution, Washington, DC) for preparations
JANZEN, D. H. & W. HALLWACHS. 2013. Dynamic database for an in-
of genitalia from the John M. Burns X-series; to Ernst Brock-
ventory of the macrocaterpillar fauna, and its food plants and par-
mann for DNA barcode sequences of Eracon clinias and E.
asitoids, of Area de Conservación Guanacaste (ACG), northwest-
paulinus; to Olaf H. H. Mielke for discussions and legs of Era-
ern Costa Rica. <http://janzen.sas.upenn.edu/>.
con biternata used to obtain its DNA barcode; to Bernard Her-
JANZEN, D. H., W. HALLWACHS, P. BLANDIN, J. M. BURNS, J.-M. CA-
mier for many enlightening discussions, and numerous sugges-
DIOU, I. A. CHACÓN, T. DAPKEY, A. R. DEANS, M. E. EPSTEIN, B.
tions; Andrew D. Warren for insightful discussions and
ESPINOZA, J. G. FRANCLEMONT, W. A. HABER, M. HAJIBABAEI, J. P.
specimen data; and two anonymous reviewers for helpful com-
W. HALL, P. D. N. HEBERT, I. D. GAULD, D. J. HARVEY, A. HAUS-
ments and corrections. The study has been supported (DHJ and
MANN, I. KITCHING, J. D. LAFONTAINE, J.-F. LANDRY, C. LEMAIRE,
WH) by U.S. National Science Foundation grants BSR 9024770
J. Y. MILLER, J. S. MILLER, L. D. MILLER, S. E. MILLER, J. J.
and DEB 9306296, 9400829, 9705072, 0072730, 0515699, and
MONTERO, E. G. MUNROE, S. RAB GREEN, S. RATNASINGHAM, J.
grants from the Wege Foundation, International Conservation

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)
 VOLUME 68, NUMBER 3 161

E. RAWLINS, R. K. ROBBINS, J. J. RODRIGUEZ, R. ROUGERIE, M. J. hespérides. Petites Nouv. Entomol. 2(189): 201–202 {1 February}.
SHARKEY, M. A. SMITH, M. A. SOLIS, J. B. SULLIVAN, P. THIAU- MIELKE, O. H. H. 2005. Catalogue of the American Hesperioidea:
COURT, D. B. WAHL, S. J. WELLER, J. B. WHITFIELD, K. R. WILL- Hesperiidae (Lepidoptera). Sociedade Brasileira de Zoologia,
MOTT, D. M. WOOD, N. E. WOODLEY & J. J. WILSON. 2009. Inte- Curitiba, Paraná, Brazil, xiii + 1536 pp.
gration of DNA barcoding into an ongoing inventory of complex PLÖTZ, C. 1882. Einige Hesperiinen-Gattungen und deren Arten.
tropical biodiversity. Mol. Ecol. Res. (Supplement 1): 1–26. Berliner Entomol. Zeit. 26: 253–266 {December}.
JANZEN, D. H., W. HALLWACHS, J. M. BURNS, M. HAJIBABAEI, C. RATNASINGHAM, S. & P. D. N. HEBERT. 2007. BOLD : The Barcode of
BERTRAND & P. D. N. HEBERT. 2011. Reading the Complex Skip- Life Data System (www.barcodinglife.org). Mol. Ecol. Notes 7:
per Butterfly Fauna of One Tropical Place. PLoS ONE 6(8): 355–364.
e19874. ROBBINS, R. K. 1991. Evolution, comparative morphology, and identi-
JANZEN, D. H., W. HALLWACHS, D. J. HARVEY, K. DARROW, R. fication of the Eumaeine butterfly genus Rekoa Kaye (Ly-
ROUGERIE, M. HAJIBABAEI, M. A. SMITH, C. BERTRAND, I. C. caenidae: Theclinae). Smithsonian Contributions to Zoology
GAMBOA, B. ESPINOZA, J. B. SULLIVAN, T. DECAENS, D. HERBIN, #498, 64 pp.
L. F. CHAVARRIA, R. FRANCO, H. CAMBRONERO, S. RIOS, F. QUE- SHEPARD, H. H. 1934. Hesperiidae: Subfamilia Pyrginae II. Lepi-
SADA, G. PEREIRA, J. VARGAS, A. GUADAMUZ, R. ESPINOZA, J. HER- dopterorum Catalogus 64: 145–272.
NANDEZ, L. RIOS, E. CANTILLANO, R. MORAGA, C. MORAGA, P. STEINHAUSER, S. R. 1981. A revision of the proteus group of the genus
RIOS, M. RIOS, R. CALERO, D. MARTINEZ, D. BRICEÑO, M. CAR- Urbanus Hübner. Lepidoptera: Hesperiidae. Bull. Allyn Mus. 62:
MONA, E. APU, K. ARAGON, C. UMAÑA, J. PEREZ, A. CORDOBA, P. 1–41.
UMAÑA, G. SIHEZAR, O. ESPINOZA, C. CANO, E. ARAYA, D. GAR- WARREN, A. D., K. J. DAVIS, E. M. STANGELAND, J. P. PELHAM & N. V.
CIA, H. RAMIREZ, M. PEREIRA, J. CORTEZ, M. PEREIRA, W. MED- GRISHIN. 2013. Illustrated Lists of American Butterflies. [18-X-
INA & P. D. N. HEBERT. 2012. What happens to the traditional 2013] <http://www.butterfliesofamerica.com>.
taxonomy when a well-known tropical saturniid moth fauna is
DNA barcoded? Invert. System. 26: 478–505. Submitted for publication on 15 September 2013; revised and
MABILLE, P. 1878. Diagnoses de lépidoptères nouveaux du groupe des accepted 14 January 2014.

Downloaded From: https://bioone.org/journals/The-Journal-of-the-Lepidopterists'-Society on 28 Jul 2022

Terms of Use: https://bioone.org/terms-of-use Access provided by Universidade Estadual de Campinas (UNICAMP)