RESEARCH ARTICLE

One step beyond a broad molecular

phylogenetic analysis: Species delimitation of
Adenomera marmorata Steindachner, 1867
(Anura: Leptodactylidae)
Carla S. Cassini ID1☯*, Pedro P. G. Taucce ID2☯, Thiago R. de Carvalho2, Antoine Fouquet3,
Mirco Solé1, Célio F. B. Haddad2, Paulo C. A. Garcia4

1 Departamento de Ciências Biológicas, Universidade Estadual de Santa Cruz, Ilhéus, Bahia, Brazil,
a1111111111
2 Departamento de Biodiversidade, Instituto de Biociências, Centro de Aquicultura (CAUNESP),
a1111111111 Universidade Estadual Paulista ‘Júlio de Mesquita Filho’, Rio Claro, São Paulo, Brazil, 3 Laboratoire
a1111111111 Évolution et Diversité Biologique, UMR5174, CNRS-UPS-IRD, Bâtiment, France, 4 Departamento de
a1111111111 Zoologia, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas
a1111111111 Gerais, Brazil

☯ These authors contributed equally to this work.

* [email protected]

OPEN ACCESS

Citation: Cassini CS, Taucce PPG, de Carvalho TR,

Abstract
Fouquet A, Solé M, Haddad CFB, et al. (2020) One
step beyond a broad molecular phylogenetic
Taxonomists always have had intense discussions about how species should be delimited
analysis: Species delimitation of Adenomera and recently many studies have used integrative approaches by combining molecular, mor-
marmorata Steindachner, 1867 (Anura: phological, and bioacoustic data. Although these studies are paramount for understanding
Leptodactylidae). PLoS ONE 15(2): e0229324.
species diversity, few of them actually formalize species delimitations to the final step of
https://doi.org/10.1371/journal.pone.0229324
nomenclatural acts. Historically, the Neotropical frog genus Adenomera has been consid-
Editor: Stefan Lötters, Universitat Trier, GERMANY
ered as a difficult taxonomic group because it comprises many morphologically similar spe-
Received: December 14, 2019 cies exhibiting high levels of intraspecific polymorphism. A recent work using molecular data
Accepted: February 2, 2020 shed light on the phylogenetic relationships within the genus and identified several lineages
Published: February 21, 2020
that may correspond to undescribed species but did not delimit species boundaries. In the
Atlantic Forest, a clade formed by A. marmorata and two putative species (Adenomera sp. J
Copyright: © 2020 Cassini et al. This is an open
access article distributed under the terms of the
and Adenomera sp. K) were identified. In this paper, we combine morphological, acoustic,
Creative Commons Attribution License, which and molecular data in order to evaluate species limits within this Atlantic Forest Adenomera
permits unrestricted use, distribution, and clade. We provide a redescription of A. marmorata and restrict its type locality to the Tijuca
reproduction in any medium, provided the original
Massif, in the Municipality of Rio de Janeiro, Brazil. Our results do not support A. marmorata
author and source are credited.
and the two candidate species as diagnosable distinct species. Therefore A. marmorata cor-
Data Availability Statement: All relevant data are
responds to a species with pronounced morphological and acoustic variation in the genus
within the paper and its Supporting Information
files. and a complex phylogeographic structure.

Funding: This study was part of C. S. C.’s PhD

degree and postdoctoral research and P. P. G. T.’s
Master’s degree. C. S. C. thanks FAPESP (grant
#2010/51606-8) for doctorate scholarship and
CNPq for current postdoctoral research funding. P. Introduction
P. G. T. thanks for Coordenação de
Aperfeiçoamento de Pessoal de Nı́vel Superior The recent advent of integrative taxonomy (term formally introduced by [1] and [2]) has led to
(CAPES) for MSc fellowship and FAPESP (grant an intensive discussion about how scientists should delimit species (e.g. [3–5]). Consequently,

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 1 / 26

 Species Delimitation of Adenomera marmorata

#2019/04076-8) for current funding. São Paulo many studies have also emerged in the past few years using integrative taxonomy protocols to
Research Foundation (FAPESP) and Programa de delimit species by applying replicable and testable criteria (see [6] for a survey). Molecular anal-
Pós-Graduação em Zoologia da UFMG gave field
yses allow researchers to estimate biodiversity levels more quickly. Therefore, it is paramount to
financing. T. R. C. has received scholarship from
FAPESP (#2012/15763-7, #2015/13404-8, and give a step further and formally describe the biodiversity in order to support a wide range of bio-
#2017/08489-0). This work has benefited from an logical research (e.g., studies of evolution, ecology, and conservation) and to subsidize conserva-
“Investissement d’Avenir” grant managed by tion polices.
Agence Nationale de la Recherche (CEBA, ref. ANR- Among vertebrates, lepidosaurians and amphibians are the most studied taxa through an
10-LABX-25-01). C. F. B. H. thanks FAPESP (grant
integrative framework [6]. Nevertheless, a recent assessment found that more than 50% of
#2013/50741-7) and CNPq for financial support. P.
C. A. G. thanks Fapemig and CNPq for financial
those studies recognized the existence of new species without formally describing them [6],
support. The funders had no role in study design, which means that even though species have been discovered, species descriptions have been
data collection and analysis, decision to publish, or carried out only by a parcel of the systematists and taxonomists in these taxonomic groups.
preparation of the manuscript. The anuran genus Adenomera Steindachner, 1867 occurs in most part of South America
Competing interests: The authors have declared east of the Andes [7]. These small leaf-litter frogs have been neglected by taxonomists because
that no competing interests exist. they are usually associated with morphologically cryptic species complexes (e.g. [8–10]). Ade-
nomera currently comprises 21species [11] and due to its complex taxonomy, most of them
were described (or revalidated) with both morphological and acoustical data assessed to cor-
roborate the taxonomic decisions (e.g. [12–14]). Nevertheless, molecular data has been used to
delimit just a few species in the genus.
Fouquet et al. [7] provided the first comprehensive study using molecular data to delimit
candidate species in Adenomera. These authors sampled across the distribution of the genus
and estimated the existence of at least 20 unnamed (confirmed and unconfirmed) candidate
species throughout Amazonia, Atlantic Forest, Caatinga, Cerrado, and Chaco domains [7].
This study also evaluated other lines of evidence to assess the candidate species status, such as
advertisement calls, and morphology of adults and tadpoles, mostly from the literature. In the
Altantic Forest, they identified a clade formed by A. marmorata and two putative species (Ade-
nomera sp. J and Adenomera sp. K) considered as confirmed on the basis of the concordant
mtDNA and nuDNA data but meager acoustic and morphological data suggesting phenotypic
divergence. Despite the important contribution of Fouquet et al. [7] to the diversity patterns in
Adenomera, it was beyond the scope of that study to formally describe candidate species.
Therefore, a formal taxonomic review based on an integrated approach is still needed to vali-
date the species hypothesis formerly proposed by Fouquet et al. [7] as confirmed candidate
species (hereafter CCS). To avoid confusion between the nominal species Adenomera marmor-
ata and the CCS Adenomera marmorata as defined by Fouquet et al. [7], hereafter we will refer
to the CCSs Adenomera marmorata, Adenomera sp. J, Adenomera sp. K as CCS Ma, CCS J and
CCS K, respectively.
Assigning populations to Adenomera marmorata is a well-known problem due to the high
level of inter and intrapopulation polymorphism, the lack of an exact type locality and a brief
original description. Additionally, there are few available synonyms under the name Adeno-
mera marmorata [11]. Therefore, it is often difficult for herpetologists to confidently associate
populations with species names. Given that A. marmorata is the type species of the genus, clar-
ifying its taxonomical boundaries should be relevant to understand species’ identities in the
genus, especially those distributed across the Atlantic Forest domain. Notwithstanding, taxo-
nomical contributions for the genus Adenomera within this domain are seldom published.
Before the recent description of A. kweti [15], the most recent taxonomical contribution for
the genus in the Atlantic Forest domain was published a decade ago [16].
Herein we aim to delimit the species Adenomera marmorata by evaluating the taxonomic
status of the confirmed candidate species (CCS) defined by Fouquet et al. [7] (herein referred
as CCS J and CCS K), using an integrative taxonomy protocol based on a comprehensive data-
set of phenotypic (morphology and calls) and molecular data.

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 2 / 26

 Species Delimitation of Adenomera marmorata

Taxonomic history
The original description of Adenomera marmorata is brief and based on a single specimen.
The description was the first for the genus and largely agrees with any currently described Ade-
nomera species [17]. Nevertheless, some valuable taxonomic characters were reported later
and used in the taxonomy of the genus, as the expanded toe tips present in the specimen ([18];
and subsequent descriptions of new species). Steindachner designated the species’ type locality
as “Brasilien” (Brazil). However, the holotype was collected during the “Novara Reise” (Novara
Expedition), which visited several localities within the municipality of Rio de Janeiro, state of
Rio de Janeiro, and neighboring municipalities [19, 20]. Some authors agree that the holotype
was collected in Rio de Janeiro or its surroundings [21, 22].
Adolpho Lutz [23] described one Adenomera species, Leptodactylus trivittatus, based on
specimens from “Campo Bello” and “Alto da Serra de Cubatão”, currently the municipalities
of Itatiaia, state of Rio de Janeiro, and Santo André, state of São Paulo, respectively [21] The
species name was given based on one dorsal and two dorsolateral brick red stripes present in
the specimens. At the time, Lutz did not relate L. trivittatus to A. marmorata, but to L. nanus
[24].
Bertha Lutz [25] suggested that L. trivittatus, described by A. Lutz [23], was a junior syno-
nym of L. nanus, considering that the series of L. trivittatus had one of the color morphotypes
of L. nanus. A few years later, Cochran [26] redescribed Adenomera marmorata (as Leptodac-
tylus marmoratus) and considered both L. nanus and L. trivittatus as their synonyms. This
author argued that the coloration pattern of A. marmorata was highly variable and the three
species actually comprised color morphotypes among populations of the same species.
Heyer [18] kept L. nanus and L. trivittatus in the synonymy of Adenomera marmorata and
designed lectotypes for both species. With respect to L. trivittatus, the chosen specimen was a
juvenile, because it was the only among the syntypes possessing the striped pattern that was
used as evidence to give name to the species. However, Heyer [18] was not clear when fixed
the type locality to “Campo Bello, Alto da Serra de Cubatão, Brasil”, since the two localities are
different places, in different mountainous complexes (Serra da Mantiqueira and Serra do Mar
mountain ranges, respectively). Cochran [26] examined the specimen defined as the lectotype
of L. trivittatus and specified the collection site of the specimen as “Montserrat, Campo Bello,
Rio de Janeiro”, which is currently the headquarters of the Itatiaia National Park, municipality
of Itatiaia. More recently, Kwet [13] revalidated L. nanus and kept L. trivittatus in the synon-
ymy of A. marmorata.
Fouquet et al. [7] assigned to the CCS Adenomera sp. J (CCS J) the populations from Santo
André, state of São Paulo ("Alto da Serra de Cubatão”, [23]), and the populations from Itatiaia,
state of Rio de Janeiro (“Campo Bello”; [25]) to Adenomera sp. K (CCS K) based on geographi-
cal distribution data. The junior synonym Leptodactylus trivittatus, if valid, should correspond
to the population from the municipality of Itatiaia, state of Rio de Janeiro, therefore the CCS
Adenomera sp. K (CCS K) [7].

Material and methods

Species delimitation
We conducted field expeditions to previously known occurrence localities of Adenomera
belonging to CCSs Ma, J and K, and additional localities in these regions in an attempt to
increase molecular and phenotypic data. All recorded males had also been genotyped (S1
Table), except a few males recorded only (no sequence) from localities where only one clade
was found. As envisaged by the unified concept of species [27], species should be delimited

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 3 / 26

 Species Delimitation of Adenomera marmorata

based on the following criteria: 1) cladogram topology and 2) identification of at least one
diagnostic phenotypic evidence that supports the independency of evolutionary lineages from
its sister clade.

Molecular analyses
Taxon sampling. We obtained new DNA sequences from 149 tissue samples from CCS
Ma (n = 73), CCS J (n = 51), and CCS K (n = 25). We also obtained sequences from two tissue
samples of A. ajurauna [28] from the municipality of Santo André, state of São Paulo, because
they occur syntopically with A. marmorata and two of A. thomei [22] from the municipality of
Itatiaia, state of Rio de Janeiro, because they occur sympatrically with the CCS K. We also used
sequences analyzed by Fouquet et al. [7] available in GenBank.
We used as outgroup all remaining Adenomera candidate species sequences downloaded
from GenBank, except for A. coca, which has been recovered nested within A. hylaedactyla
clade [7]. For the outgroup we chose sequences from one (if just one sequence was available)
to four terminals of each candidate species, depending on the number of available sequences
of each candidate species subclades [7]. Genera other than Adenomera sampled as outgroup
consisted of sequences obtained from GenBank from one Hydrolaetare caparu [29], one Litho-
dytes lineatus [30], and one Leptodactylus rhodomystax [31].
Laboratory methods. Whole cellular DNA was extracted from ethanol-preserved muscle
(primarily) or liver tissue samples following Lyra et al. [32] or using a DNeasy Qiagen kit fol-
lowing manufacturer’s protocols. PCR amplification was carried out using Taq DNA Polymer-
ase Master Mix (Ampliqon S/A, Denmark) and Axygen Maxygene thermocyclers. We targeted
three mitochondrial (Cytochrome c oxidase subunit 1 [COI], Cytochrome b [CYTB], and 16S
ribosomal DNA [16S]) and two nuclear (Proopiomelanocortin C [POMC] and Recombination
activating gene exon1 [RAG]) gene fragments (primer pairs detailed in Table 1). The standard
PCR program consisted in an initial denaturing step of 2 minutes at 94˚C, 35–40 cycles of 30
seconds at 94˚C, 30 seconds at 48–56˚C, and 2 minutes at 72˚C, followed by a final extension
step of 10 minutes at 72˚C. PCR non-purified products were sent to Macrogen Inc. (South
Korea) where they conducted purification and sequencing in an ABI 3730XL sequencer.
Alignment, partition schemes, and model selection. We performed alignment using
MAFFT v. 7.273 [41] with the FFT-NS-i algorithm, except for the 16S gene fragment, for
which we used the E-INS-i algorithm. This strategy is applicable for regions with conserved

Table 1. Gene fragments and respective primer pairs used in DNA amplification.
Primer Gene Sequence
dgLCO1490 [33] F COI GGTCAACAAAATCATAAAGAYATYGG
dgHCO2198 [33] R COI TAAACTTCAGGGTGACCAAARAAYCA
Cytb2 [34] F Cytb AAACTGCAGCCCCTCAGAAATGATATTTGTCCTCA
MVZ15 [35] F Cytb GAACTAATGGCCCACACWWTACGNAA
CbR2 [36] R Cytb GTGAAGTTRTCYGGGTCYCC
16SAR [37] F 16S CGCCTGTTTATCAAAAACAT
16SWilk2 [38] R 16S GACCTGGATTACTCCGGTCTGA
MartFL1 [39] F RAG AGCTGGAGYCARTAYCAYAARATG
Ad2R [36] R RAG ATTGGCTCTCCATGTTTCATAG
POMC 1 [40] F POMC GAATGTATYAAAGMMTGCAAGATGGWCCT
POMC 2 [40] F POMC TCTGCMGARTCWCCYGTGTTTCC
POMC 3 [40] R POMC TAYTGRCCCTTYTTGTGGGCRTT
POMC 4 [40] R POMC TGGCATTYTTGAAAAGAGTCAT
https://doi.org/10.1371/journal.pone.0229324.t001

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 4 / 26

 Species Delimitation of Adenomera marmorata

domains surrounded by nonalignable regions, such as rDNA. For both algorithms we used
1000 as a maximum for iterative refinements.
We conducted the search for the best partition scheme and best fitting molecular model
using PartitionFinder 1.1.1 [42] with the Corrected Akaike Information Criterion (AICc; [43])
and considering each codon as a separate partition.
Phylogenetic analyses, haplotype network, and genetic distance. We used both Maxi-
mum Likelihood (ML) and Bayesian Inference (BI, concatenated locus approach) for con-
structing the phylogenetic trees. We conducted ML analysis in RAxML v. 8.2.10 [44], with 100
runs for tree search and 1000 non-parametric bootstrap replicates. We constructed BI trees in
MrBayes [45] using two independent runs of 2.0 x 107 generations, starting with random trees
and four Markov chains (one cold), sampled every 2000 generations. We discarded 25% of
generations and trees as burn-in and performed the run with unlinked character state frequen-
cies, substitution rates of GTR model, gamma shape parameters, and proportion of invariable
sites between partitions.
We examined if candidate species display signs of reproductive isolation by analyzing
nuclear DNA (nDNA), allele sharing, and network cohesion. To determine the most probable
alleles for individuals heterozygous for nDNA sequences we used gametic phases recon-
structed through the algorithm implemented in phaSe 2.1.1 software [46], which were inter-
converted to fasta format using SeqPHASE web tool [47]. Using these alignments we
computed statistical parsimony networks using TCS [48] method.
We computed uncorrected pairwise p-distances using R version 3.6.0 [49] with the packages
APE version 5.0 [50] and SPIDER version 1.5.0 [51]. In order to avoid alignment effect, we
ignored sites within missing data (pairwise.deletion = TRUE).

Phenotypic analyses: Morphology and advertisement call

We genotyped all collected and recorded specimens. Thus, we could reliably associate mor-
phological and acoustic data for all specimens of candidate species from the A. marmorata
clade (sensu Fouquet et al. [7]). The morphological analyses followed characters described by
Heyer [18], Heyer et al. [52], and Duellman [53]. For the morphometric variation we used
SVL (snout-vent length) and, additionally, for the holotype description, we measured HL
(head length), HW (head width), ED (eye diameter), TD (tympanum diameter), END (eye to
nostril distance), IND (internarial .distance), IOD (interorbital distance), THL (thigh length),
SL (shank length), and TAL (tarsal length). All measurements were taken to the nearest 0.05
mm with digital calipers under a stereomicroscope. Material examined is given in S1 Table.
Calls were recorded using digital recorders (Marantz PMD 670, PMD 671, and Tascam
DR-40) set at a sampling rate of 44.1 kHz and sample size of 16 bits, and Sennheiser K6/ME66
and K6/ME67 unidirectional microphones. Recordings were stored as mono-channel uncom-
pressed WAVE files. Sound files were deposited in the acoustic repositories of AAG-UFU and
CFBH collections (see S2 Table). Voucher specimens are housed in the following Brazilian col-
lections: Coleção de Anfı́bios do Centro de Coleções taxonômicas da Universidade Federal de
Minas Gerais (UFMG), Belo Horizonte, MG, and Coleção de Anfı́bios Célio F. B. Haddad
(CFBH), at Universidade Estadual Paulista, Rio Claro, SP.
Acoustic analysis was conducted in Soundruler [54], built as a package interfacing with
Matlab scripts [55] through automated procedures that allow for unbiased quantification of
acoustic traits. Grand means (and corresponding standard deviations) were obtained from
averages of each male recorded. Parameters were set as follows: FFT size = 1024 samples, FFT
overlap = 90% or 99%, window type = Hanning, contrast = 70%. Settings for automated recog-
nition were (in sample sizes): detection (smoothing = 500, resolution = 1); delineation (smooth

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 5 / 26

 Species Delimitation of Adenomera marmorata

factor = 1, smoothing = 13, and resolution = 1). In a few cases, raw values for the fundamental
frequency exceeded those of the dominant frequency of a given call. This is because the auto-
mated analysis quantifies those frequency traits differently and may reflect minor sampling
resolution errors in the measurements up to ± 50 Hz. A 1000-Hz high-pass filter was applied
to sound files in Soundruler prior to conducting the acoustic analyses to reduce background
noise. Call rate was quantified manually in Audacity 2.1.1 [56]. Acoustic terminology and defi-
nitions are given in S3 Table.
Sound figures were produced using seewave 2.1.0 [57] and tuneR 1.3.2 [58] in R 3.6.0 [49].
Settings for sound figures were: window Hanning, FFT size = 256 samples, FFT overlap = 90%;
the intensity of frequency components is indicated by their darkness in a relative 36-dB scale.
In order to assess the degree of acoustic differentiation among candidate species, we per-
formed a Principal Component Analysis (PCA) in R 3.6.0 [49] with the function prcomp. We
visualized the PCA using the R packages ggbiplot [59] and factoextra [60].

Results
Alignment, partition scheme, and model selection
We obtained a final dataset of 3322 bp of aligned DNA sequences from nuclear and mitochon-
drial genes: partial 16S rRNA (561 bp), partial COI (657 bp), partial CYTB (666 bp), partial
POMC (608 bp), and partial RAG1 (830 bp). The best-fit partition scheme comprised 11 parti-
tions. The partitions and respective best fitting nucleotide substitution models used in the BI
analysis are listed in Table 2. For the ML analysis we used the GTR model with a γ-distribution
for all partitions, since RAxML does not support estimating different substitution models for
different partitions.

Phylogenetic analyses and genetic distance

The BI and ML analyses yielded the same topology (Fig 1, S1 Fig and S2 Fig). We recovered all
nominal and candidate Adenomera species as monophyletic with high support in both analy-
ses. We will not further comment about the relationships between outgroup species because
this is beyond the scope of the present paper.
We recovered CCS K as the sister group of “CCS J + CCS Ma”. The CCS K is structured in
two well-supported clades (K1 and K2). The clade K1 contains specimens from the northern
coast of São Paulo state (our samples are restricted to the main district of the municipality of

Table 2. Model selection. Best partition scheme and respective best fitting molecular models used in phylogenetic
analyses. Numbers following gene names correspond to the codon position.
Partition Model
16S GTR+I+Γ
COI 1 GTR+I+Γ
COI 2 HKY+I
COI 3 GTR+Γ
CYTB 1 SYM+I+Γ
CYTB 2 GTR+I+Γ
CYTB 3 GTR+Γ
POMC 1 + RAG 1 GTR+I+Γ
POMC 2 GTR+Γ
POMC 3 + RAG 3 GTR+I+Γ
RAG 2 HKY+I+Γ
https://doi.org/10.1371/journal.pone.0229324.t002

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 6 / 26

 Species Delimitation of Adenomera marmorata

Fig 1. Bayesian inference and genetic samples. 50% majority rule consensus tree from Bayesian inference analysis of
concatenated nuclear (POMC and RAG) and mitochondrial (COI, CYTB, and 16S) genes, and map containing
sampled localities for molecular analyses. Numbers above branches indicate Bayesian posterior probabilities (pp) and
numbers below branches indicate non-parametrical bootstrap support. Asterisks indicate clades fully supported (1.0
[pp] or 1000 [bootstrap]). Colors of the clades match colors of the localities.
https://doi.org/10.1371/journal.pone.0229324.g001

Ubatuba and São Luis do Paraitinga, state of São Paulo); the clade K2 contains specimens from
Minas Gerais and southern inland Rio de Janeiro state, including the type locality of Leptodac-
tylus trivittatus.
The CCS J lies in the central and northern coastal areas of São Paulo state and adjacent
Serra do Mar, and is also structured in two major clades, J1 and J2 clades, both well-supported.

Table 3. Partial 16s (light grey) and partial COI (dark grey) average uncorrected pairwise p-distances within and between lineages. Distances among CCSs Ma, J and
K are presented in bold. Data are shown as min—max when applicable.
Within CCS p-distance Between CCS p-distance
16S (n) COI (n) 1 2 3 4 5 6 7 8 9
1. A. ajurauna 0.0–1.8 (3) 0.0–6.7 (7) 12.4–15.7 11.6–14.6 11.2–13.6 7.3–13.6 10.1–12.9 12.2–14.9 7.7–14.2 10.4–12.6
2. A. araucaria ––(1) 0.0–9.8 (9) 5.5–6.4 10.6–16.7 11.4–15.0 12.4–16.1 11.5–14.8 9.8–12.1 11.7–19.1 10.6–15.6
3. A. bokermanni ––(1) 6.5 (2) 9.6–10.2 7.0 8.7–10.0 11.3–14.6 13.2–17.0 11.1–14.4 10.7–17.5 7.9–10.7
4. A. engelsi ––(1) 0.5–3.6 (4) 6.9–7.7 6.3 7.1 11.6–14.8 11.3–15.3 10.5–12.4 10.9–15.4 6.7–8.4
5. CCS J 0.0–3.0 (13) 0.0–6.8 (51) 3.9–4.7 5.5–6.2 7.3–8.1 4.4–6.0 7.0–11.9 12.6–15.9 4.9–12.2 10.3–13.2
6. CCS K 0.0–2.0 (8) 0.0–5.8 (25) 3.7–5.1 5.0–6.2 8.3–8.9 5.2–7.3 2.6–4.1 11.0–14.9 6.2–10.8 11.8–14.9
7. A. kweti ––(1) 0.0–7.3 (8) 5.9–7.4 4.6 5.5 5.6–5.6 5.0–5.6 5.9–8.0 9.6–14.7 9.6–13.0
8. CCS Ma 0.0–4.8 (18) 0.0–8.2 (70) 4.5–6.8 5.0–6.4 8.3–9.1 5.4–6.7 2.8–5.8 2.8–6.7 5.5–6.9 9.9–15.9
9. A. nana ––(1) 3.6–4.6 (3) 6.3–7.2 5.0 3.6 4.6–4.6 4.8–5.4 5.4–7.0 4.8 4.8–5.6
https://doi.org/10.1371/journal.pone.0229324.t003

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 7 / 26

 Species Delimitation of Adenomera marmorata

Specimens from clade J1 are geographically circumscribed within the range of calde J2; i.e.
specimens from clade J1 are restricted to the municipalities of Cubatão and Santo André,
other individuals from these localities were also recovered in clade J2.
The CCS Ma includes two main clades, Ma1 and Ma2, both well-supported. The clade Ma1
lies primarily in the inland eastern São Paulo state, reaching its northern coast (including
Picinguaba, a locality within the municipal limits of Ubatuba); the clade Ma2 lies in the south-
ern coast of Rio de Janeiro state and adjacent Serra do Mar, including the presumed type local-
ity of the species Adenomera marmorata.
The uncorrected pairwise distances between CCS J and its sister clade, CCS Ma, varies from
2.8 to 5.8% (16S, Table 3) and 4.9 to 12.2% (COI). Genetic distances between CCS J and CCS
Ks varies from 2.6 to 4.1% (16S) and 7.0 to 11.9% (COI). Genetic distances between CCS K
and CCS Ma varies 2.8 to 6.7% (16S) and 6.2 to 10.8% (COI).
We recovered 47 haplotypes for POMC and 77 haplotypes for RAG fragments. The TCS
network for POMC gene revealed that the most abundant haplotypes were shared among all
CCSs (J, K, and Ma) and the second most abundant haplotype (h17) was shared between CCS
K (clade K2) and CCS Ma (clade Ma2). Addittionally, CCS K (clade K1) and CCS Ma (clade
Ma1) lineages share two haplotypes (h20 and h23; Fig 2). In the corresponding network for the
RAG fragment, there is essentially no haplotype sharing among lineages, except for three hap-
lotypes (h4, h16, and h18). All CCSs share the haplotype h16 (clades Ma1, J2, and K2); CCS K
and CCS Ma share the haplotype h4 (clades Ma1, Ma2, and J2); and CCS J and CCS Ma share
haplotype h18 (clades Ma1 and J2; Fig 2).

Phenotypic analyses: Morphology and advertisement call

Morphological variation among the CCSs J, K and Ma did not allow us to distinguish them
from each other. The SVL completely overlapped among the three groups of specimens (Fig
3). Dorsolateral stripe was present in specimens in populations of all three CCSs. Tubercles on
the dorsal surface of the tibia were present in CCS Ma and CCS K. Specimens from continental
populations of CCS J did not have tubercles on the tibia. Nevertheless, specimens of CCS J
from the Alcatrazes Island had tubercles on dorsal surface of the tibia similar to CCS Ma and
CCS K (Fig 4). Specimens of CCS J from Alcatrazes Island are also larger (male SVL: 25.6 mm,
n = 1; maximum female SVL: 27.3, n = 3) than those of continental populations of CCS J (max-
imum male SVL: 20.5 mm, n = 5; maximum female SVL: 19.4 mm, n = 9).
We analyzed the advertisement calls of 51 individuals of CCS Ma, J, and K from 10 localities
(municipalities of Guapimirim, Itatiaia, Maricá, Petrópolis, and Rio de Janeiro, state of Rio de
Janeiro, and Mogi das Cruzes, Nazaré Paulista, Santo André, São Luı́s do Paraitinga, and Uba-
tuba, state of São Paulo), totaling 1951 calls. The advertisement calls of the three lineages
showed similar structure: a single, nonpulsed note emitted at regular intervals, having or not a
frequency upsweep along the note (Fig 5). The dominant frequency coincides with the funda-
mental harmonic. Although CCS J tended to have calls with shorter durations and higher in
pitch than those CCS Ma and CCS K, the acoustic traits analyzed usually overlapped among
the them (Table 4).
The call duration varied from 28 to 91 ms in CCS Ma (n = 345 calls of 10 males) and the
dominant frequency ranged from 4070 to 4888 Hz. In the CCS J, call duration from 21 to 45
ms (n = 813 calls of 17 males) and the dominant frequency from 4413 to 5467 Hz, whereas in
CCS K call duration varied from 40 to 114 ms (n = 803 calls of 24 males) and the dominant fre-
quency ranged from 4027 to 4974 Hz. All three CCSs had a frequency upsweep in their calls,
but CCSs J and K also had calls without noticeable frequency modulation.

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 8 / 26

 Species Delimitation of Adenomera marmorata

Fig 2. Statistical parsimony networks of phased nuclear loci for CCS Ma, CCS J and CCS K. (A) POMC; (B) fragment RAG1; (C) map containing RAG1 sampled
localities for CCSs Ma, J and K. Haplotypes are shown as circles proportional in size to haplotype frequency.
https://doi.org/10.1371/journal.pone.0229324.g002

Fig 3. Variation of Snout-Vent Length among CCS Ma, CCS J, CCS K and other Adenomera species. Male (left)
and female (right) specimens.
https://doi.org/10.1371/journal.pone.0229324.g003

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 9 / 26

 Species Delimitation of Adenomera marmorata

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 10 / 26

 Species Delimitation of Adenomera marmorata

Fig 4. Morphological variation regarding the presence or absence of tibial tubercles. (A) CFBH 34402, CCS Ma, Rio de Janeiro,
RJ; (B) CFBH 36131, CCS Ma, Nazaré Paulista, SP; (C) CFBH 17130, CCS J, Alcatrazes Island, SP; (D) CFBH 23923, CCS J, Santos,
SP; (E) CFBH 36001, CCS K, Ubatuba, SP; (F) CFBH 444653, CCS K, Itatiaia, RJ.
https://doi.org/10.1371/journal.pone.0229324.g004

The first three factors of the Principal Component Analysis (PCA) accounted for 71.7% of
the total variance in the acoustic trait space (36.6%, 23.2%, and 11.9%, respectively). The
parameters that contributed the most for the differentiation of the proposed groups (CCSs Ma,
J and K) were call attack frequency, call frequency modulation, call fundamental frequency
and call decay frequency. The parameters ‘call rate’ and ‘rise time’ contributed the least to the
first factor (PC1, Table 5). The graph provided by the PCA did not allow us to distinguish the
lineages as distinct acoustic groups from each other (Fig 6).

Taxonomic decision
Considering acoustic and morphological variation in the CCS Ma, J and K, and the lack of
diagnosable characters between them, we conclude that these three lineages are conspecifics.
In order to clarify the taxonomy of A. marmorata, we now redescribe it based on our results.

Fig 5. Advertisement call of the candidate species CCS Ma, CCS J and CCS K. Spectrogram (above) and oscillogram (bellow) of one call of (A) CCS Ma (clade Ma1),
Tijuca Massif, Rio de Janeiro, RJ; (B) CCS Ma (clade Ma2), Nazaré Paulista, SP; (C) CCS K (clade K1), Itatiaia, RJ; (D) CCS K (clade K2), São Luı́s do Paraitinga, SP; (E)
CCS J (clade J1), Mogi das Cruzes, SP; (F) CCS (clade J2), Santo André, SP.
https://doi.org/10.1371/journal.pone.0229324.g005

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 11 / 26

 Species Delimitation of Adenomera marmorata

Table 4. Advertisement call traits of the candidate species CCS Ma (Ma1 and Ma2), CCS J (J1 and J2), and CCS K (K1 and K2). Data are given as mean ± SD (range);
sample sizes as number of males recorded/number of quantified calls. Repetition rate was quantified once or twice for each male. Temporal call traits are given in millisec-
onds (ms), and frequency traits in Hertz (Hz).
Call traits CCS Ma CCS J CCS K
Ma1 Ma2 J1 J2 K1 K2
n = 2/76 n = 8/269 n = 14/665 n = 3/148 n = 10/205 n = 14/598
TEMPORAL TRAITS
Repetition rate (minute) 51.9 ± 10.6 32.9 ± 17.2 51.0 ± 10.0 44.2 ± 4.1 64.2 ± 15.3 45.4 ± 9.7
(44.3–59.4) (14.4–66.4) (36.0–67.5) (39.6–47.4) (41.8–83.3) (30.6–63.4)
Call duration 40.9 ± 11.6 58.7 ± 14.5 29.0 ± 6.0 33.9 ± 5.1 58.0 ± 9.0 97.2 ± 6.6
(28.3–51.5) (33.5–91.0) (21.0–45.0) (31.0–39.7) (40.0–77.0) (77.7–113.9)
Rise time (%) 6.2 ± 0.8 8.1 ± 5.1 10.5 ± 3.8 8.7 ± 2.3 6.2 ± 1.0 9.4 ± 8.0
(4.2–9.6) (1.8–77.9) (4.8–27.8) (7.2–11.4) (3.1–24.2) (2.3–76.0)
Plateau duration 2.3 ± 0.8 3.1 ± 1.1 3.4 ± 1.2 3.0 ± 0.1 2.0 ± 1.6 6.2 ± 3.2
(1.1–5.2) (0.3–16.1) (1.9–11.0) (2.8–3.1) (0.1–6.7) (0.4–35.5)
Attack duration 1.7 ± 0.8 3.0 ± 2.1 1.8 ± 0.9 1.7 ± 0.5 2.7 ± 0.7 6.6 ± 6.7
(1.0–3.0) (0.7–33.9) (1.0–5.0) (1.2–2.2) (1.2–14.7) (1.3–65.8)
Decay duration 36.9 ± 10.0 52.6 ± 15.6 23.9 ± 5.4 29.2 ± 4.9 53.4 ± 9.4 84.4 ± 12.1
(25.2–46.2) (8.6–87.8) (17.0–40.7) (25.7–34.8) (34.2–72.5) (16.4–106.3)
Attack shape (unitless) 0.35 ± 0.04 0.40 ± 0.06 0.40 ± 0.05 0.37 ± 0.09 0.33 ± 0.05 0.34 ± 0.09
(0.22–0.56) (0.02–0.59) (0.25–0.81) (0.27–0.42) (0.09–0.62) (0.01–0.70)
Decay shape (unitless) 0.33 ± 0.14 0.53 ± 0.15 0.59 ± 0.11 0.55 ± 0.15 0.64 ± 0.14 0.32 ± 0.26
(0.10–0.60) (0.04–0.97) (0.34–0.91) (0.39–0.68) (0.12–0.96) (0.03–0.94)
Crest factor (unitless) 2.24 ± 0.03 2.29 ± 0.17 2.46 ± 0.16 2.47 ± 0.18 2.58 ± 0.24 2.21 ± 0.32
(1.93–2.43) (1.68–3.62) (2.12–3.45) (2.33–2.68) (1.86–3.39) (1.70–3.21)
FREQUENCY TRAITS
Frequency modulation 262.3 ± 63.2 351.0 ± 136.1 101.1 ± 64.7 94.7 ± 40.4 108.4 ± 55.1 97.9 ± 61.3
(172–345) (0–646) (-50–258) (64–141) (-43–345) (-43–258)
Fundamental frequency 4211.6 ± 100.6 4461.6 ± 104.5 4812.0 ± 166.3 4617.0 ± 156.5 4188.9 ± 127.7 4447.8 ± 194.9
(4070–4328) (4242–4931) (4413–5470) (4452–4763) (3941–4414) (4070–4974)
Dominant frequency 4223.0 ± 102.7 4527.7 ± 120.2 4810.4 ± 165.4 4612.8 ± 152.7 4189.6 ± 127.7 4461.6 ± 196.9
(4070–4328) (4242–4888) (4413–5467) (4454–4758) (4027–4414) (4070–4974)
Attack frequency 4203.3 ± 110.8 4444.3 ± 104.4 4815.4 ± 164.9 4615.5 ± 159.4 4189.3 ± 132.8 4429.7 ± 196.7
(4070–4328) (4242–4630) (4417–5473) (4447–4763) (3941–4414) (4070–4931)
Decay frequency 4465.6 ± 47.6 4795.3 ± 139.7 4916.5 ± 154.7 4710.2 ± 120.2 4297+8 ± 137.4 4527.6 ± 203.8
(4328–4587) (4544–5189) (4515–5551) (4587–4828) (4070–4630) (4199–5103)
Bandwidth 228.6 ± 6.9 255.0 ± 33.1 258.4 ± 41.4 249.0 ± 35.2 234.0 ± 23.1 185.8 ± 21.2
(196–306) (158–393) (210–494) (221–289) (159–360) (156–306)
https://doi.org/10.1371/journal.pone.0229324.t004

Nomenclatural acts. Adenomera marmorata Steindachner, 1867 (Figs 6 and 7)

Redescription
Leptodactylus trivittatus Lutz, 1926
Leptodactylus (Parvulus) trivittatus–Lutz, 1930
Leptodactylus (Adenomera) marmorata–Parker, 1932
Leptodactylus marmoratus–Parker, 1935
Leptodactylus marmoratus marmoratus–Rivero, 1961
Adenomera marmorata–Heyer, 1974
Leptodactylus (Lithodytes) marmoratus–Frost, Grant, Faivovich, Bain, Haas, Haddad, de Sá,
Channing, Wilkinson, Donellan, Raxworthy, Campbell, Blotto, Moler, Drewes, Nussbaum,
Lynch, Green, and Wheeler, 2006
Adenomera marmorata–Pyron and Wiens, 2011
Adenomera marmorata–Fouquet, Cassini, Haddad, Pech, and Rodrigues, 2014
Adenomera sp. J–Fouquet, Cassini, Haddad, Pech, and Rodrigues, 2014

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 12 / 26

 Species Delimitation of Adenomera marmorata

Table 5. Results of the PCA of call variables of CCS Ma, CCAs J and CCS K.
PC1 PC2 PC3
Call rate 0.009768 -0.18339 0.149232
Call duration -0.32782 0.079983 0.38707
Rise time -0.00721 0.357624 -0.3493
Attack shape 0.241929 -0.0441 0.316224
Decay shape 0.226465 -0.34494 0.017321
Crest factor 0.179381 -0.38706 0.154748
Dominant frequency -0.02536 0.070557 -0.35227
Call frequency modulation 0.354363 0.253523 0.189933
Fundamental frequency 0.350815 0.267823 0.171745
Attack duration -0.11316 0.418583 0.178111
Decay duration -0.22677 0.317018 -0.16446
Plateau duration -0.31021 -0.00398 0.430529
Call attack frequency 0.362484 0.228637 0.201825
Call decay frequency 0.348989 0.257257 0.049235
Bandwidth 0.295726 -0.16175 -0.32357
Eigenvalue 5.494109 3.484117 1.785174
% Total variance 36.63 23.23 11.9
Cumulative % 36.63 59.86 71.76
https://doi.org/10.1371/journal.pone.0229324.t005

Adenomera sp. K–Fouquet, Cassini, Haddad, Pech, and Rodrigues, 2014

Holotype. NHMW 16453, adult male, Brazil (Fig 8).
Redescription of the holotype. The specimen is completely faded and with both forearms
detached from the body, although some traits are still present. (Fig 8). Head longer than wide;
HW 34% SVL, HL 39% SVL. Snout rounded in dorsal and ventral views; canthus rostralis
indistinct. Loreal region slightly concave. Nostril not protruding, dorsolaterally oriented,
rounded. Eye protruding, eye diameter larger than eye to nostril distance. Tympanum distinct,
rounded, less than half the eye diameter. Supratympanic fold no apparent. Jaw glands absent.
Vocal sac single, internal. Vomerine teeth could not be observed. Choanae moderate, rounded.
Tongue elongate; lateral and posterior margins free. Vocal slits elongate, parallel to jaw,
extending from posterior portion to the first third of the mouth. Arms poorly preserved,
detached from the body. Toes free; toe tips II, III, and IV expanded (toe tips I and V unex-
panded). Inner and outer metatarsal tubercles distinct and slightly protruding, ovoid, approxi-
mately the same size. Due to the degraded condition of the feet, toe formula could not be
observed. Subarticular tubercles rounded and well-developed. Posterior members small and
robust; thigh length slightly smaller than shank length (THL 40% SVL and SHL 44% SVL).
Metatarsal fold absent. Tarsal fold present, poorly developed, extending from the base of outer
metatarsal tubercle to the tibiotarsal junction. Ventral surface of tarsus with few tubercles.
Ventral surface of feet with innumerous small and distinct tubercles. Dorsum smooth; anal
glands present only on left side of the body, rounded.
Measurements of the Holotype. SVL 22.2 mm; HL 8.7 mm; HW 7.5 mm; ED 2.1 mm;
TD 1.0 mm; END 1.3 mm; IND 1.4 mm; THL 8.8 mm; SHL 9.7 mm; TAL 5.3 mm. Measures
of anterior members and feet could not be taken due to specimen condition.
Diagnosis. Adenomera marmorata is distinguished from congeners by the following com-
bination of characters: (1) endotrophic tadpole; (2) toe tips II, III, and IV expanded; (3) side of
the body with dark blotches; (4) antebrachial tubercle absent; (5) nearly solid dark-colored
stripe along the underside of forearm absent; (6) dark-colored spots longitudinally arranged

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 13 / 26

 Species Delimitation of Adenomera marmorata

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 14 / 26

 Species Delimitation of Adenomera marmorata

Fig 6. Principal Component Analysis (PCA) of call characters of CCS MA, CCS J and CCS K.
https://doi.org/10.1371/journal.pone.0229324.g006

on dorsum absent; (7) nonpulsed advertisement call; (8) call duration varying from 21–114
ms; (9) dominant frequency ranging from 4027–5467 Hz; (10) call dominant frequency coin-
ciding with the fundamental harmonic; (11) single-note advertisement call.
Comparisons with other species. Adenomera marmorata differs from A. diptyx, A. saci,
and A. thomei by having endotrophic tadpoles (exotrophic in these species) [14, 22, 10]) The
expanded toe tips (toes II–IV) of Adenomera marmorata distinguishes it from congeners with
unexpanded toe tips (A. bokermanni [18], A. coca, A. cotuba, A. diptyx, A. hylaedactyla, A. jui-
kitam, A. kweti, A. martinezi, A. phonotriccus, A. saci, and A. thomei [8–10, 14, 15, 61]).

Fig 7. Topotype of Adenomera marmorata, CFBH 34403. (A) Dorsal, (B) Ventral, and (C) lateral views. Scale bar = 5 mm.
https://doi.org/10.1371/journal.pone.0229324.g007

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 15 / 26

 Species Delimitation of Adenomera marmorata

Fig 8. Holotype of Adenomera marmorata, NHMW 16453. Photographs by Dr. Heinz Grillitsch.
https://doi.org/10.1371/journal.pone.0229324.g008

Adenomera marmorata differs from A. lutzi and A. phonotriccus by the absence of black
blotches on a yellow, orange, or red background on the posterior surface of the thigh and
inguinal region (present in A. lutzi) and absence of antebrachial tubercle (present in A. lutzi
and A. phonotriccus) [61, 62]; from A. simonstuarti by the absence of a nearly solid dark-col-
ored stripe along the underside of forearm (present in A. simonstuarti) [9]; from A. martinezi
and A. saci by the absence of 4 to 6 symmetrically arranged rows of longitudinal dark-colored
spots on dorsum (rows present in A. martinezi and A. saci) [10]; from A. araucaria and A.
nana by the presence of dark blotches on the side of the body (dark blotches absent or only
small dark spots present in A. araucaria and A. nana).
The advertisement call of Adenomera marmorata distinguishes this species from all conge-
ners, except A. ajurauna [28], by having its dominant frequency always coinciding with the
fundamental harmonic (see Table 5). The calls of Adenomera martinezi [63] and A. saci [10]
have their dominant frequencies coinciding with either the first or the second harmonics [14].
The nonpulsed advertisement call of Adenomera marmorata differs from those of pulsed-call
species (A. andreae, A. araucaria, A. chicomendesi, A. coca, A. cotuba, A. diptyx, A. heyeri, A.
hylaedactyla, A. juikitam, A. martinezi, A. phonotriccus, A. simonstuarti, and A. thomei) [8–10,
11, 12,14, 64, 65, 66, 67]; and from A. ajurauna, A. heyeri, and A. juikitam by a shorter adver-
tisement call (21–114 ms in A. marmorata; 130–190 ms in A. ajurauna [28]; 137–185 ms in A.
heyeri [64]; and 148–202 ms in A. juikitam [10, 14]. From the multi-note call A. cotuba [14] A.
marmorata is distinguished by having a single-note call.
Color and Morphological variation. In life, general coloration of body grey; hind limbs
with dark brown transversal stripes, posterior surface of the thigh with irregularly distributed
melanophores on cream background. Heels with or without orangeade or reddish blotch. Venter
cream, gular region with a few melanophore spots concentrated laterally. Lateral surface of the
body with dark brown or black scattered blotches. Dorsum with marbled blotches irregularly
scattered, without a clear pattern. Some specimens have two dorsolateral stripes, cream, orange,
or red, extending from the posterior portion of the eye to the inguinal region. Dorsal surface of
head with a bar or an inverted triangle homogeneously dark brown. Dark brown stripe contour-
ing the tympanum from posterior portion of the eye to the arm-trunk junction. Forearms with
dark brown transversal stripes or irregular blotches; hand with dorsal surface marbled.
In 70% alcohol preserved specimens, general gray coloration become yellowish or cream
over time, evidencing the dark brown blotches and stripes but, at some point, they fade. Heel
blotches and dorsolateral stripes become cream or white.

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 16 / 26

 Species Delimitation of Adenomera marmorata

Table 6. Comparative advertisement call data for the Atlantic Forest species of Adenomera: call duration, pulses (presence/absence), and frequency peaks at the
first two harmonics (H1 and H2, respectively). 1Based on the call of Adenomera sp. 2 from Joinville, Santa Catarina. Call data for A. marmorata comprise both clades of
the nominal species (Ma1/Ma2) and the clades of the genetic lineages subsumed under the species (sp. J1/J2; sp. K1/K2; [7]). The dominant frequency of the calls of A. ajur-
auna and A. marmorata coincide with the first harmonic (H1); the other species have the dominant frequency of their calls coinciding with the second harmonic (H2).
Species Call duration (ms) Pulses/call H1 frequency (kHz) H2 frequency (kHz) Reference
A. ajurauna 130–190 Nonpulsed 3.72–5.43 — [28]
A. araucaria 102–277 4–18 2.10–2.48 4.11–4.93 [15]
1
A. bokermanni 99–152 Nonpulsed 1.79–1.83 3.40–3.57 [13]
A. engelsi 96–163 Nonpulsed ~2.00 3.46–4.29 [16]
A. kweti 60–84 Nonpulsed 2.36–2.71 4.76–5.41 [15]
A. marmorata 21–114 Nonpulsed 4.03–5.06 — Present study
A. nana 67–122 Nonpulsed 2.30–2.70 4.62–5.44 [13]
A. thomei 120–210 10–21 2.15–2.81 4.57–5.56 [22]
https://doi.org/10.1371/journal.pone.0229324.t006

Tibial tubercles present or absent in some populations (Fig 4). Specimens from Alcatrazes
Island are much larger than specimens from other populations. Snout subelliptical, subovoid,
or rounded; loreal region vertical or oblique. Supernumerary tubercles of palmar region dis-
tinct or not.
Tadpole. The tadpole was described by Heyer et al. [52] and it is endotrophic, remaining
in foam nests throughout the whole development.
Advertisement call. The advertisement call of A. marmorata is composed of single, non-
pulsed notes having or not a frequency upsweep. Call duration varies from 21 to 114 ms, the
dominant frequency coincides with the first harmonic and ranges from 4027 to 5467 Hz
(Tables 4 and 6).
Natural history. Adenomera marmorata occurs mainly along forest edges and is highly
abundant in most of its geographical distribution range. Males call on leaf-litter, exposed or
not, near the constructed chamber for oviposition. The call activity may occur during all day
in rainy days, but mostly from dusk into the first hours of night. On two occasions we observed
males calling at dawn from inside collecting bags.
Geographic distribution and type-locality. Adenomera marmorata is distributed in
Southeastern Brazil, over the “Serra da Mantiqueira” and northern part of the “Serra do Mar”
mountain ranges of the states of Minas Gerais, Rio de Janeiro, and São Paulo, as well as in
north-central coastal São Paulo, southern coastal Rio de Janeiro (see map on Fig 1); ranging in
elevation from sea level up to more than 1200 m.
Steindachner [17] set the type-locality as “Brasilien” [Brazil]. The specimen was collected
during the “Novara Reise” [17] which, in Brazil, only visited the municipality of Rio de Janeiro
and its vicinity [19, 20]. During its brief stay in Brazil (August 5–31, 1857), the expedition crew
went through several localities in the municipality of Rio de Janeiro [20] in the company of the
Brazilian naturalist Dom Antonio Ildefonso Gomes, including the roads connecting the
“Morro do Corcovado” (Corcovado hill) to, presumably, the “Pedra Bonita” (Beautiful Stone),
currently in the Tijuca National Park, Tijuca Massif. The expedition members also went to the
municipality of Petrópolis, going initially by train to the Fragoso station, municipality of
Magé, and then finally to Petrópolis by rail and road transports through “Serra da Estrela”
([19], Fig 9). Since the goal of the travel to Petrópolis was to know and describe the German
occupation at the locality and it was made by train and road transport [19], we consider
unlikely that the holotype was collected at these locations (localities from Magé to Petrópolis
municipalities). Because the objective of the expedition in the Tijuca region, at Rio de Janeiro
city, was to describe the natural aspects of the place and the itinerary was surveyed by foot
[19], we consider very likely that the holotype was collected somewhere on the road and we

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 17 / 26

 Species Delimitation of Adenomera marmorata

restrict the type-locality of Adenomera marmorata to the Tijuca Massif, municipality of Rio de
Janeiro, Brazil.
Remarks. There are probably three species of Adenomera in the state of Rio de Janeiro.
The first is the one we assigned to A. marmorata. Almeida & Angulo [22] reported a species of
Adenomera from the municipality of Teresópolis, whose call duration (minimum call duration
247 ms) is markedly different from A. marmorata (maximum call duration 146 ms). These
authors argued that due to differences in advertisement calls the specimen from Teresópolis
municipality should not be the same species as the specimens from Tijuca Massif, Rio de
Janeiro. We visited many localities also visited during the “Novara Reise” expedition and all
analyzed specimens belongs to clade Ma2 (including the Tijuca Massif, the type locality). Fou-
quet et al. [7] suggested that the population of the CCS Adenomera sp. K (= CCS K) from the
municipality of Itatiaia (Rio de Janeiro State) could either be conspecific with that population
from Teresópolis [22] or correspond to Leptodactylus trivittatus (in this case would be under a
new combination, Adenomera trivittata). Nevertheless, to date, none of the Adenomera species
distributed in the Atlantic Forest has been reported to emit such long-lasting advertisement
calls as reported by Almeida and Angulo [22] (Table 6). We collected and recorded two CCS
from Itatiaia: Adenomera marmorata (formerly CCS K, Figs 1 and 2) and A. thomei. Heyer
[18], when designating the lectotype of Leptodactylus trivittatus (see introduction), selected the
specimen because it was the only one with the striped pattern mentioned by Lutz [23]. Never-
theless, no specimen of A. thomei (n = 75), among the specimens examined by us, had striped
pattern, so we consider A. thomei and L. trivittatus as distinct species, maintaining Cochran’s
[26] and Heyer’s [18] decision that Leptodactylus trivittatus is a junior synonym of Adenomera
marmorata.

Discussion
We used an integrative approach to test the hypothesis that the CCS Ma, CCS J and CCS K
might correspond to different species. We used molecular phylogeny and raised considerably
previous sampling of morphology and call characters. Our phenotypic data did not support
the three lineages as three different species. Despite the genetic distance and reciprocal mono-
phyly, these candidate species are not acoustically or morphologically diagnosable from each
other.

Tree topology and genetic distance thresholds

We recovered the same topology recovered by Fouquet et al. [7] regarding CCSs Ma, J and K
using an extended sampling. The sole difference is the higher support values of the clade “CCS
Ma + CCS J” (0.94 in [7] vs. 1.00 our results). The uncorrected p-distances among the three
CCSs were high for both partial 16S and COI (Table 3). Fouquet et al. [68] suggested a mean
distance of 3% on 16S to identify Neotropical anuran species and Vences et al. [69] found 10–
14% of genetic divergence in mantellid frog species for COI. Even though the genetic diver-
gence among the three lineages of A. marmorata is higher than the genetic distances between
A. bokermanni, A. engelsi, and A. nana, it is known that genetic limits within a given genus
may be very different (e.g. [69–71]). Fouquet et al. [7] tried to address this problem by taking
as threshold the genetic distance between the two nominal species recovered as sister taxa in
their study (A. engelsi and A. nana) as the first step to flag lineages as candidate species. The
authors used additional lines of evidences, such as allele sharing, morphology, and bioacoustics
to classify lineages as confirmed or unconfirmed candidate species. However, their analysis of
acoustic and morphological divergence was superficial and their classification as CCS only
tentative.

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 18 / 26

 Species Delimitation of Adenomera marmorata

Fig 9. Traversed area by the “Novara Reise” [Novara Expedition] crew (August, 1857). In red, route taken for the city of Rio de Janeiro
forested areas recognition, through the Tijuca Massif (type locality of Adenomera marmorata). In blue, route taken via rail and road transports to
the municipality of Petrópolis. Blue dots indicate islands visited during an excursion through Guanabara Bay (image modified from INDE–
Infraestrutura Nacional de Dados Espaciais, available at: https://visualizador.inde.gov.br/).
https://doi.org/10.1371/journal.pone.0229324.g009

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 19 / 26

 Species Delimitation of Adenomera marmorata

Variation in a widespread species in the Atlantic Forest

Adenomera marmorata (as defined here) is one of the most abundant species found through-
out forest edges of the Atlantic Forest in south-eastern Brazil. Although there are many studies
assessing the genetic variation in widespread species (e.g. [72–74]), a few studies have
described its phenotypic variation along all its geographical distribution (e.g. [75–77]). Fur-
thermore, many species descriptions are based on few specimens from the same population
(often because it is the only available material), which can lead to precipitated taxonomic con-
clusions. Our results show the robustness of delimiting species based on phenotypic and
molecular datasets combined. We analyzed more phenotypic data from more localities than
previously known for the A. marmorata clade (sensu Fouquet et al. [7]). The secondary lines
of reproductive isolation evidences overlap among lineages, even those formerly used to distin-
guish one lineage from another (and thus, confirming the status of CCS of each lineage; Fou-
quet et al. [7]). Additionally, our PCA analysis was not able to distinguish any acoustic group.
The specimens of A. marmorata from the clade corresponding to CCS J, despite overlap-
ping with the other two clades, showed a tendency to have a smaller SVL, shorter call length,
and a higher dominant frequency. On the other hand, specimens of A. marmoratafrom Alca-
trazes Island (CCS J) are much larger than specimens from other populations (male minimum
SVL 25.6 mm, n = 1, female minimum SVL 25.7 mm, n = 4; other mainland populations male
maximum SVL 22.4, n = 37, female maximum SVL = 23.4 mm, n = 24). Vertebrate gigantism
on islands has massively been reported in the literature ([78–80]). Nevertheless, Rebouças
et al. [80] found opposite results, (i.e. dwarfism) analyzing populations of A. marmorata from
Ilha Grande Island. Variation in size of isolated insular communities may be related to genetic
drift or to their local ecological processes, such as predation pressure, competition, and avail-
ability of resources [80–82].
Populations from CCSs J, K, and Ma were never found in syntopy. Nevertheless, the north
coast of São Paulo deserves special attention. The northernmost distribution of CCSs J and Ma
(clade Ma1) is on Ilha das Couves Island and Picinguaba, respectively—both localities within
the municipal limits of Ubatuba, state of São Paulo. On the other hand, we identified only CCS
K in the urban vicinities of Ubatuba. We should expect that, if these lineages represent indeed,
distinct species, they should display any reproductive isolation mechanism in this ‘contact
zone’. It is important to notice that Fouquet et al. [7] found spatial overlap among CCS Ma, J
and K but no allele sharing between them. Nevertheless, we found that populations of CCSs
Ma, J and K from Ubatuba and its vicinities share a haplotype (h16). Additionally, all morpho-
logical and acoustic parameters overlapped among these populations and no evidence of such
distinctiveness could be found.
Campos et al. [83] studied the karyotype, among other leptodactylid species, from the three
clades of A. marmorata, and their results corroborate the hypothesis that they are the same
species. We analyzed two specimens from that study: CFBH 11512, from the municipality of
Santa Branca, state of São Paulo (corresponding to CCS Ma) and CFBH 17137, from Alca-
trazes Island, state of São Paulo (corresponding to CCS J). No cytogenetic difference was
found between the two samples [83]. However, their samples from the municipalities of Salesó-
polis and São Luı́s do Paraitinga, state of São Paulo (which correspond J and CCS Ks in our
study, respectively) showed the chromosome pair 12 metacentric, differing from the specimens
from Santa Branca and Alcatrazes Island, which had the same chromosome pair telocentric.
Campos et al. [83] suggested that this difference was due to intraspecific geographic variation
and the data presented herein corroborate that interpretation.
It is important to point out that we assessed the taxonomic status of A. marmorata using
molecular, acoustic, and morphological data, but there are still other character sets to be

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 20 / 26

 Species Delimitation of Adenomera marmorata

assessed (e.g. ecology, behavior, and tadpole morphology). As noted by de Queiroz [27], closely
related species might be in “gray zones” (i.e., time in species evolution where alternative species
concepts and character sets come into conflict, making it difficult for us to recognize species)
and additional characters put into analysis may shed new light on the taxonomy of A. marmor-
ata and lead to a more precise interpretation.
Adenomera marmorata is a widespread species showing rich phylogenetic structure and
remarkable acoustical and morphological variation. These aspects make this species an inter-
esting model to studies on diversification processes in the Atlantic Forest.

Supporting information
S1 Fig. Bayesian inference and genetic samples. 50% majority rule consensus tree from
Bayesian inference analysis of concatenated nuclear (POMC and RAG) and mitochondrial
(COI, CYTB, and 16S).
(TRE)
S2 Fig. Phylogenetic analyses of maximum likelihood.
(TRE)
S1 Table. Sample information of Adenomera species. Corresponding clade, voucher or field
number, locality information (country or State when in Brazil; locality name, coordinates),
and GenBank accession number.
(DOCX)
S2 Table. Information associated with analyzed sound files of the six lineages within Ade-
nomera marmorata (see Methods). Calls were recorded from the Brazilian Atlantic Forest.
(DOCX)
S3 Table. Acoustic terminology and definitions for the automated analysis of acoustic
traits. Temporal traits were obtained from waveforms; spectral traits from spectrograms and
amplitude spectra. RMS = root mean square.
(DOCX)

Acknowledgments
We thank J. P. Pombal Jr., U. Caramaschi (MNRJ), A.A. Giaretta (AAG-UFU), H. Zaher
(MZUSP), and H. Grillitsch (NHM) for access and/or loan of specimens and tissue samples
under their care. H. Grillitsch has also provided photos of Adenomera marmorata holotype.
For logistic support at MZUSP we thank C. Mello, at MNRJ, P. Pinna and M. W. Cardoso, and
at NHM we thank G. Gassner. B. M. Berneck, M. Ávila, M. Walker, M. T. T. Santos, P. D. P.
Pinheiro, and V. G. D. Orrico gave field assistance. We thank to Center for Scientific Comput-
ing (NCC/GridUNESP) of the São Paulo State University (UNESP) and Cyberinfrastructure
for Phylogenetic Research (CIPRES) for technical computational support. Instituto Chico
Mendes de Conservação da Biodiversidade (ICMBio) issued collection permits.

Author Contributions
Conceptualization: Carla S. Cassini, Pedro P. G. Taucce, Antoine Fouquet, Paulo C. A.
Garcia.
Data curation: Carla S. Cassini, Pedro P. G. Taucce.
Formal analysis: Carla S. Cassini, Pedro P. G. Taucce, Thiago R. de Carvalho.

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 21 / 26

 Species Delimitation of Adenomera marmorata

Funding acquisition: Carla S. Cassini, Célio F. B. Haddad.

Investigation: Carla S. Cassini, Pedro P. G. Taucce, Thiago R. de Carvalho.
Methodology: Carla S. Cassini, Pedro P. G. Taucce, Antoine Fouquet.
Project administration: Carla S. Cassini.
Resources: Carla S. Cassini, Pedro P. G. Taucce, Célio F. B. Haddad, Paulo C. A. Garcia.
Software: Pedro P. G. Taucce, Thiago R. de Carvalho.
Supervision: Mirco Solé, Célio F. B. Haddad, Paulo C. A. Garcia.
Validation: Carla S. Cassini, Pedro P. G. Taucce, Thiago R. de Carvalho, Antoine Fouquet.
Visualization: Carla S. Cassini, Pedro P. G. Taucce, Thiago R. de Carvalho.
Writing – original draft: Carla S. Cassini, Pedro P. G. Taucce.
Writing – review & editing: Carla S. Cassini, Pedro P. G. Taucce, Thiago R. de Carvalho,
Antoine Fouquet, Célio F. B. Haddad, Paulo C. A. Garcia.

References
1. Dayrat B. Towards integrative taxonomy. Biological Journal of the Linnean Society. 2005; 85:407–415.
2. Will KW, Mishler BD, Wheeler QD. The perils of DNA barcoding and the need for integrative taxonomy.
Systematic Biology. 2005; 54:844–851. https://doi.org/10.1080/10635150500354878 PMID: 16243769
3. De Salle R, Egan MG, Siddall, M. The unholy trinity: taxonomy, species delimitation and DNA barcod-
ing. Phylosophical Transactions of Royal Society B. 2005; 360:1905–1906.
4. Padial JM, Miralles A, De la Riva I, Vences M. The integrative future of taxonomy. Frontiers in Zoology.
2010; 7(1): 16.
5. Schlick-Steiner BC, Steiner FM, Seifert B, Stauffer C, Christian E, Crozier RH. Integrative taxonomy: a
multisource approach to exploring biodiversity. Annual Review of Entomology. 2010; 55:421–438.
https://doi.org/10.1146/annurev-ento-112408-085432 PMID: 19737081
6. Pante E, Schoelinck C, Puillandre N. From integrative taxonomy to species description: one step
beyond. Systematic Biology. 2014; 64(1):152–160. https://doi.org/10.1093/sysbio/syu083 PMID:
25358968
7. Fouquet A, Cassini CS, Haddad CFB, Pech N, Rodrigues MT. Species delimitation, patterns of diversifi-
cation and historical biogeography of the Neotropical frog genus Adenomera (Anura, Leptodactylidae).
Journal of Biogeography. 2014; 41(5):855–870.
8. Angulo A, Reichle S. Acoustic signals, species diagnosis, and species concepts: the case of a new
cryptic species of Leptodactylus (Amphibia, Anura, Leptodactylidae) from the Chapare region, Bolivia.
Zoological Journal of the Linnean Society. 2008; 152(1):59–77.
9. Angulo A, Icochea J. Cryptic species complexes, widespread species and conservation: lessons from
Amazonian frogs of the Leptodactylus marmoratus group (Anura: Leptodactylidae). Systematics and
Biodiversity. 2010; 8(3):357–370.
10. Carvalho TR, Giaretta AA. Bioacoustics reveals two new syntopic species of Adenomera Steindachner
(Anura: Leptodactylidae: Leptodactylinae) in the Cerrado of central Brazil. Zootaxa. 2013; 3731
(3):533–551.
11. Carvalho TR, Angulo A, Kokubum MN, Barrera DA, De Souza MB, Haddad CF, et al. A New Cryptic
Species of the Adenomera andreae Clade from Southwestern Amazonia (Anura, Leptodactylidae). Her-
petologica. 2019; 75(3):233–46.
12. Kwet A, Angulo A. A new species of Adenomera (Anura, Leptodactylidae) from the Araucaria forest of
Rio Grande do Sul (Brazil), with comments on the systematic status of southern populations of the
genus. Alytes. 2002; 20(1–2):28–43.
13. Kwet A. Bioacoustic variation in the genus Adenomera in southern Brazil, with revalidation of Leptodac-
tylus nanus Müller, 1922 (Anura, Leptodactylidae). Zoosystematics and Evolution. 2007; 83(S1):56–
68.

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 22 / 26

 Species Delimitation of Adenomera marmorata

14. Carvalho TR, Giaretta AA. Taxonomic circumscription of Adenomera martinezi (Bokermann, 1956)
(Anura: Leptodactylidae: Leptodactylinae) with the recognition of a new cryptic taxon through a bioa-
coustic approach. Zootaxa. 2013; 3701(2):207–237.
15. Carvalho TR, Cassini CS, Taucce PPG, Haddad CFB. A new, morphologically cryptic species of Ade-
nomera closely related to Adenomera araucaria from the Atlantic Forest of southern Brazil (Anura, Lep-
todactylidae). Journal of Herpetology. 2019; 53(2):131–143.
16. Kwet A, Steiner J, Zillikens A. A new species of Adenomera (Amphibia: Anura: Leptodactylidae) from
the Atlantic rain forest in Santa Catarina, southern Brazil. Studies on Neotropical Fauna and Environ-
ment. 2009; 44(2):93–107.
17. Steindachner F. Reise der österreichischen Fregatte Novara um die Erde in den Jahren 1857, 1858,
1859 unter den Bafehlen des Commodore B. von Wüllerstorf-Urbair. Zologischer Theil. 1. Amphibien.
Wien: K. K. Hof- und Staatsdruckerei; 1867.
18. Heyer WR. Systematics of the marmoratus group of the frog genus Leptodactylus (Amphibia, Leptodac-
tylidae). Contributions in Science. 1973; 251: 1–50.
19. Scherzer K. Narrative of the circumnavigation of the globe by the Austrian frigate Novara, (Commodore
B. von Wullerstoff-Ubair,) undertaken by order of the imperial government, in the years 1857, 1858, &
1859, under the immediate auspicies of His J. and R. Highness. London: Woodfall and Kinder; 1861.
20. Gans CA. Localities of the herpetological collections made during the ‘Novara Reise’. Annals of the Car-
negie Museum. 1955; 33(17):275–285.
21. Bokermann WCA. Lista anotada das localidades tipo de anfı́bios brasileiros. São Paulo: Serviço de
Documentação, Universidade Rural de São Paulo; 1966.
22. Almeida AD, Angulo A. A new species of Leptodactylus (Anura: Leptodactylidae) from the state of Espı́-
rito Santo, Brazil, with remarks on the systematics of associated populations. Zootaxa. 2006; 1334
(1):1–25.
23. Lutz A. Observações sobre batrachios brasileiros. Parte I: O gênero Leptodactylus Fitzinger. Observa-
tions on Brazilian batrachians. Part I: The genus Leptodactylus. Memorias do Instituto Oswaldo Cruz.
1926; 19:139–157 (Portuguese) + plates 30–37 + 159–174 (English).
24. Müller L. Über eine Sammlung Froschlurche von Sta. Catharina nebst Beschriebung zweier neuer
Arten. Blätter für Aquarien- und Terrarien-Kunde. Stuttgart. 1922; 33:167–171.
25. Lutz B. Trends towards non-aquatic and direct development in frogs. Copeia. 1947; 1947(4):242–252.
26. Cochran DM. Frogs of southeastern Brazil. Bulletin of the U.S. National Museum. 1955; 206:1–406.
27. De Queiroz K. Species concepts and species delimitation. Systematic Biology. 2007; 56(6):879–886.
https://doi.org/10.1080/10635150701701083 PMID: 18027281
28. Berneck B, Costa C, Garcia P. A new species of Leptodactylus (Anura: Leptodactylidae) from the Atlan-
tic Forest of São Paulo State, Brazil. Zootaxa. 2008; 1795:46–56.
29. Jansen M, Gonzales-Álvarez L, Köhler G. New species of Hydrolaetare (Anura, Leptodactylidae) from
Bolivia with some notes on its natural history. Journal of Herpetology. 2007; 41:724–732.
30. Schneider JG. Historia Amphibiorum Naturalis et Literarariae. Fasciculus Primus. Continens Ranas,
Calamitas, Bufones, Salamandras et Hydros in Genera et Species Descriptos Notisque suis Distinctos.
Jena: Friederici Frommanni; 1799.
31. Boulenger GA. On a collection of frogs from Yurimaguas, Huallaga River, Northern Peru. Proceedings
of the Zoological Society of London. 1884; 1883: 635–638.
32. Lyra ML, Haddad CFB, de Azeredo-Espin AM. Meeting the challenge of DNA barcoding Neotropical
amphibians: polymerase chain reaction optimization and new COI primers. Molecular Ecology
Resources. 2017; 17(5):966–980 https://doi.org/10.1111/1755-0998.12648 PMID: 28029226
33. Meyer CP. Molecular systematics of cowries (Gastropoda: Cypraeidae) and diversification patterns in
the tropics. Biological Journal of the Linnean Society. 2003; 79(3):401–459.
34. Kocher TD, Thomas WK, Meyer A, Edwards SV, Pääbo S, Villablanca FX, et al. Dynamics of mitochon-
drial DNA evolution in animals: amplification and sequencing with conserved primers. Proceedings of
the National Academy of Sciences. 1989; 86(16):6196–6200.
35. Moritz C, Schneider CJ, Wake DB. Evolutionary relationships within the Ensatina eschscholtzii complex
confirm the ring species interpretation. Systematic Biology. 1992; 41(3):273–291.
36. Fouquet A, Loebmann D, Castroviejo-Fisher S, Padial JM, Orrico VG, Lyra ML, et al. From Amazonia to
the Atlantic forest: Molecular phylogeny of Phyzelaphryninae frogs reveals unexpected diversity and a
striking biogeographic pattern emphasizing conservation challenges. Molecular Phylogenetics and Evo-
lution. 2012; 65(2):547–561. https://doi.org/10.1016/j.ympev.2012.07.012 PMID: 22842094

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 23 / 26

 Species Delimitation of Adenomera marmorata

37. Palumbi SR, Martin AP, Kessing BD, McMillan WO. Detecting population structure using mitochondrial
DNA. In: Hoelzel AR, editors. Genetic ecology of whales and dolphins. Cambridge: International Whal-
ing Comission; 1991. pp 203–215.
38. Wilkinson JA, Matsui M, Terachi T. Geographic variation in a Japanese tree frog (Rhacophorus arbor-
eus) revealed by PCR-aided restriction site analysis of mtDNA. Journal of Herpetology. 1996; 30
(3):418–423.
39. Hoegg S, Vences M, Brinkmann H, Meyer A. Phylogeny and comparative substitution rates of frogs
inferred from sequences of three nuclear genes. Molecular Biology and Evolution. 2004; 21(7):1188–
1200. https://doi.org/10.1093/molbev/msh081 PMID: 14963093
40. Wiens JJ, Fetzner Jr JW, Parkinson CL, Reeder TW. Hylid frog phylogeny and sampling strategies for
speciose clades. Systematic Biology. 2005; 54(5):778–807. https://doi.org/10.1080/
10635150500234625 PMID: 16243760
41. Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in per-
formance and usability. Molecular Biology and Evolution. 2013; 30(4):772–780. https://doi.org/10.
1093/molbev/mst010 PMID: 23329690
42. Lanfear R, Calcott B, Ho SY, Guindon S. PartitionFinder: combined selection of partitioning schemes
and substitution models for phylogenetic analyses. Molecular Biology and Evolution. 2012; 29
(6):1695–1701. https://doi.org/10.1093/molbev/mss020 PMID: 22319168
43. Hurvich CM, Tsai CL. Regression and time series model selection in small samples. Biometrika. 1989;
76(2):297–307.
44. Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies.
Bioinformatics. 2014; 30(9):1312–1313. https://doi.org/10.1093/bioinformatics/btu033 PMID:
24451623
45. Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höhna S, et al. MrBayes 3.2: efficient
Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology.
2012; 61(3):539–542. https://doi.org/10.1093/sysbio/sys029 PMID: 22357727
46. Stephens M, Donnelly P. A comparison of Bayesian methods for haplotype reconstruction from popula-
tion genotype data. Am J Hum Genet. 2003; 73: 1162–1169. https://doi.org/10.1086/379378 PMID:
14574645
47. Flot JF. SeqPHASE: a web tool for interconverting PHASE input/output files and FASTA sequence
alignments. Molecular Ecology Resources. 2010; 10(1):162–166. https://doi.org/10.1111/j.1755-0998.
2009.02732.x PMID: 21565002
48. Clement MJ, Snell Q, Walker P, Posada D, Crandall KA. TCS: estimating gene genealogies. In ipdps,
2002; 2:184.
49. R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical
Computing, Vienna, Austria. 2019; Available from: https://www.R-project.org/.
50. Paradis E, Schliep K. ape 5.0: an environment for modern phylogenetics and evolutionary analyses in
R. Bioinformatics. 2018; 35(3):526–528.
51. Brown SD, Collins RA, Boyer S, Lefort MC, Malumbres-Olarte JA, Vink CJ, et al. Spider: an R package
for the analysis of species identity and evolution, with particular reference to DNA barcoding. Molecular
Ecology Resources. 2012; 12(3):562–5. https://doi.org/10.1111/j.1755-0998.2011.03108.x PMID:
22243808
52. Heyer WR, Rand AS, Cruz CAG, Peixoto OL, Nelson CE. Frogs of Boraceia. Arquivos de Zoologia.
1990; 31: 235–410.
53. Duellman WE. Hylid frogs of Middle America. Monographs of the Museum of Natural History, University
of Kansas. 1970; 1: 1–753.
54. Gridi-Papp M. SoundRuler: acoustic analysis for research and teaching. 2007. Available at http://
soundruler.sourceforge.Net.
55. MATLAB: The language of technical computing, version 6.5.2. 2004.
56. Audacity team. Audacity(R): Free Audio Editor and Recorder, version 2.2.1. 2017. Available at https://
www.audacityteam.org.
57. Sueur J, Aubin T, Simonis C. Seewave, a free modular tool for sound analysis and synthesis. Bioacous-
tics. 2008; 18(2):213–226.
58. Ligges U, Krey S, Mersman O, Schnackenberg S. tuneR: Analysis of music. Available at http://www.ci.
tuwien.ac.at/Conferences/useR-2004/abstracts/Ligges.pdf.
59. Vu VQ. ggbiplot: A ggplot2 based biplot. R package version 0.55. 2011.
60. Kassambara A, Mundt F. Factoextra: extract and visualize the results of multivariate data analyses. R
package version. 2017; 1(3):2016.

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 24 / 26

 Species Delimitation of Adenomera marmorata

61. Carvalho TR, Giaretta AA, Angulo A, Haddad CFB, Peloso PLV. A new Amazonian species of Adeno-
mera (Anura: Leptodactylidae) from the Brazilian state of Pará: a tody-tyrant voice in a frog. American
Museum Novitates. 2019; 3919(1):1–22.
62. Kok PJR, Kokubum MNC, MacCulloch RD, Lathrop A. Morphological variation in Leptodactylus lutzi
(Anura, Leptodactylidae) with description of its advertisement call and notes on its courtship behavior.
Phyllomedusa. 2007; 6: 45–60.
63. Bokermann WCA. Sobre una nueva especie de Leptodactylus del Brasil (Amphibia). Neotropica. 1956;
2: 37–40.
64. Boistel R, Massary JC, Angulo A. Description of a new species of the genus Adenomera (Amphibia,
Anura, Leptodactylidae) from French Guiana. Acta Herpetologica. 2006; 1: 1–14.
65. Márquez R, De la Riva I, Bosch J. Advertisement calls of Bolivian species of Leptodactylidae. Journal of
Zoology of London. 1995; 237: 313–336.
66. Angulo A, Cocroft RB, Reichle S. Species identity in the genus Adenomera (Anura : Leptodactylidae) in
Southeastern Peru. Herpetologica. 2003; 59: 490–504.
67. Menin M, Almeida AP, Kokubum MNC. Reproductive aspects of Leptodactytus hylaedactylus (Anura:
Leptodactylidae), a member of the Leptodactylus marmoratus species group, with a description of tad-
poles and calls. Journal of Natural History. 2009; 43: 2257–2270.
68. Fouquet A, Gilles A, Vences M, Marty C, Blanc M, Gemmell NJ. Underestimation of species richness in
Neotropical frogs revealed by mtDNA analyses. Plos One. 2007; 2: e1109. https://doi.org/10.1371/
journal.pone.0001109 PMID: 17971872
69. Vences M, Thomas M, Bonett RM, Vieites DR. Deciphering amphibian diversity through DNA barcod-
ing: chances and challenges. Philosophical transactions of the Royal Society of London. Series B, Bio-
logical Sciences. 2005; 360: 1859–1868. https://doi.org/10.1098/rstb.2005.1717 PMID: 16221604
70. Padial JM, Castroviejo-Fisher S, Köhler J, Vilà C, Chaparro JC, De La Riva I. Deciphering the products
of evolution at the species level: the need for an integrative taxonomy. Zoologica Scripta. 2009; 38:
431–447.
71. Blotto BL, Nuñez JJ, Basso NG, Úbeda CA, Wheeler WC, Faivovich J. Phylogenetic relationships of a
Patagonian frog radiation, the Alsodes+Eupsophus clade (Anura: Alsodidae), with comments on the
supposed paraphyly of Eupsophus. Cladistics. 2013; 29: 113–131.
72. Gehara M, Crawford AJ, Orrico VGD, Rodrı́guez A, Lötters S, Fouquet A, et al. High levels of diversity
uncovered in a widespread nominal taxon: continental phylogeography of the Neotropical tree frog Den-
dropsophus minutus. Plos One. 2014; 9: e103958. https://doi.org/10.1371/journal.pone.0103958
PMID: 25208078
73. Zhang YH, Zhao YY, Li XY, Li XC. Evolutionary history and population genetic structure of the endemic
tree frog Hyla tsinlingensis (Amphibia: Anura: Hylidae) inferred from mitochondrial gene analysis. Mito-
chondrial DNA. 2014; 1736: 1–10.
74. Langone JA, Camargo A, de Sá RO. High genetic diversity but low population structure in the frog Pseu-
dopaludicola falcipes (Hensel, 1867) (Amphibia, Anura) from the Pampas of South America. Molecular
Phylogenetics and Evolution. 2016; 95: 137–151. https://doi.org/10.1016/j.ympev.2015.11.012 PMID:
26639101
75. Nabil A, Sarra F, Slim BY, Khaled S. Morphometric and karyological differentiation among populations
of Discoglossus pictus (Discoglossidae: Anura) in eastern north africa. Annales Zoologici. 2010; 60:
158–167.
76. Kaefer IL, Tsuji-Nishikido BM, Lima AP. Beyond the river: Underlying determinants of population acous-
tic signal variability in Amazonian direct-developing Allobates (Anura: Dendrobatoidea). Acta Etholo-
gica. 2012; 15: 187–194.
77. Cassini CS, Orrico VG, Dias IR, Sole M, Haddad CFB. Phenotypic variation of Leptodactylus cupreus
Caramaschi, São-Pedro and Feio, 2008 (Anura, Leptodactylidae). Zootaxa. 2013; 3616(1):073–84.
78. Schoener TW. Size patterns in West Indian Anolis lizards. II. Correlations with the sizes of particular
sympatric species-displacement and convergence. The American Naturalist. 1970; 104: 155–174.
79. Montesinos R, Silva HR, Carvalho ALG. The ‘Island Rule’ acting on anuran populations (Bufonidae: Rhi-
nella ornata) of the southern hemisphere. Biotropica. 2012; 44: 506–511.
80. Rebouças R, Silva HR, Sole M. Frog size on continental islands of the coast of Rio de Janeiro and the
generality of the Island Rule. Plos One. 2018; 13(1):e0190153. https://doi.org/10.1371/journal.pone.
0190153 PMID: 29324790
81. Meiri S, Dayan T, Simberloff D. The generality of the island rule reexamined. Journal of Biogeography.
2006; 33(9):1571–7.

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 25 / 26

 Species Delimitation of Adenomera marmorata

82. Lomolino MV, Sax DF, Palombo MR, Van Der Geer AA. Of mice and mammoths: evaluations of causal
explanations for body size evolution in insular mammals. Journal of Biogeography. 2012; 39(5): 842–
854.
83. Campos JRC, Ananias F, Brasileiro CA, Yamamoto M, Haddad CFB, Kasahara S. Chromosome evolu-
tion in three Brazilian Leptodactylus species (Anura, Leptodactylidae), with phylogenetic consider-
ations. Hereditas. 2009; 146: 104–111. https://doi.org/10.1111/j.1601-5223.2009.02100.x PMID:
19490171

PLOS ONE | https://doi.org/10.1371/journal.pone.0229324 February 21, 2020 26 / 26