Last Leap 3

https://neetforsure.blogspot.
com/
https://neetforsure.blogspot.com/
!"#$%#$&
S. NO. PARTICULARS PAGE NO.
1. Preface ................................................................................................. (i) – (i)
2. Chemistry .......................................................................................... 01 – 112
3. Botany .............................................................................................. 113 – 266
4. Answers........................................................................................... 267 – 280
Preface
Dear NEET Aspirants,
I am pleased to release this package “Last Leap” for NEET 2020. This package
contains selected and important questions which has been prepared and
compiled by our expert faculties who have been teaching AIPMT/NEET since
decades. This package is available in 2 parts viz. Part (I) and Part (II).
When a student will try to solve these questions, he/she can have a real feel
of the examination. These questions will open the different layers of the brain
and will stimulate the deepest nervous tissue to think and recall as well as
analyze the trick in the questions. I am very confident that if a student
sincerely solves these questions independently, there is no reason why he/she
cannot be among the top rankers in the country in the NEET. The “Last Leap”
is going to be the winning Leap for every student who puts his heart and mind
on the questions given in this package.
Wishing you a brighter career.
J.C. CHAUDHRY
Chairman
Aakash Educational Services Limited
(i)
CHEMISTRY
CHAPTER No. TOPIC PAGE No.
1. Structure of Atom ....................................................................... 01 – 16
2. Chemical Bonding and Molecular Structure .............................. 17 – 34
3. Equilibrium .................................................................................. 35 – 54
4. Electrochemistry ........................................................................ 55 – 66
5. p-Block Elements (Group 15 - 18) ............................................ 67 – 74
6. Organic Chemistry : Some Basic Principles

and Techniques .......................................................................... 75 – 92
7. Hydrocarbons ............................................................................. 93 – 112
Chapter 1
Structure of Atom
5. Radius of the second orbit of an element is
SECTION - A
0.070 nm. The energy associated for this orbit will
Objective Type Questions be
1. If the uncertainty in position, momentum, energy, (1) 2952 J/atom
time, angular momentum and angular displacement (2) 52 × 10–15 J/atom
are x, P, E, t, and respectively. Which
(3) 4.9 × 10–18 J/atom
of the following is correct about Heisenberg’s
uncertainty principle? (4) 5.45 × 10–19 J/atom
6. Splitting of spectral line in the magnetic field is
! ! called
(1) " #$" %$ (2) " #$" %$
& &
(1) Stark effect (2) Zeeman effect
! (3) Photoelectric effect (4) All of these
(3) " #" # (4) All of these
$ 7. Choose the orbital having two nodal planes
2. If ‘x’ is the radius of first Bohr’s orbit of the (1) py (2) px
hydrogen atom. Then the ratio of radius of 2nd, 4th (3) dyz (4) pz
and 6th orbit is 8. Total number of electrons that can be
(1) 1 : 2 : 3 (2) 1 : 4 : 9 accommodated in the sub-shell (l = 2) are
(1) 6 (2) 10
(3) 3 : 2 : 1 (4) 2 : 4 : 8
(3) 14 (4) 2
3. If the velocity of an electron in a Bohr’s orbit (n)
of hydrogen is given by ‘V’, then the value of n is 9. If the ionization energy of hydrogen atom is
equal to 160 eV, Find the shell having energy – 40 eV.
(1) n = 1 (2) n = 2
! " !# ! "!# (3) n = 4 (4) n = 3
(1) (2)
$ $%
10. Select the correct statement
!"# !!" (1) The number of maxima in radial probability
(3) ! (4) distribution curve of 2s orbital are two
$ % #$%
(2) At the node, the value of the radial function
4. For energy of the orbitals in same subshell, which changes from positive to negative
is correct?
(3) !! ! ! has 3 angular nodes
(1) E2s (H) > E2s (Li) > E2s (Na) > E2s (K)
(4) Both (1) & (2)
(2) E2s (K) > E2s (Na) > E2s (Li) > E2s (H)
11. Electronic configuration of Palladium (Z = 46) is
(3) E2s (H) = E2s (Li) = E2s (Na) = E2s (K) (1) [Kr] 4d8 5s2 (2) [Kr] 4d9 5s1
(4) E2s (K) > E2s (Li) > E2s (Na) > E2s (H) (3) [Kr] 4d10 5s0 (4) [Kr] 4d9 5s2
Aakash Educational Services Limited - Regd. Office : Aakash Tower, 8, Pusa Road, New Delhi-110005 Ph. 011-47623456
2 Structure of Atom Last Leap for NEET (Part-I)
12. Wavelength of third spectral line in Balmer series 20. The frequency of the spectral line emitted when
for hydrogen is the electron in n = 3 in H-atom de-excites to ground
state
!"" !"#
(1) (2)
#!$ "$$ (1) 2.92 × 1015 s –1 (2) 1.62 × 10 –15 s –1
!" !" (3) 13.6 × 1012 s –1 (4) 3.90 × 10 –12 s –1
(3) (4)
#! "#
21. The momentum of radiations of wavelength 0.33 nm
13. If kinetic energy of electron is increased 9 times, is
the de Broglie wavelength associated with it
becomes (1) 2.01 × 1024 kg ms–1 (2) 2.01 × 10–24 kg ms–1
(1) 9 times (2) 3 times (3) 6.63 × 10–34 kg ms–1 (4) 6.63 × 1034 kg ms–1
! 22. Which of the following is the incorrect set of
(3) times (4) 81 times
" quantum number? [where x is positive integer]
14. The ratio of the difference in energy of electron
#
between the first and second Bohr’s orbits to that (1) n = x, l = (x – 1), m = (x – 1), s = +
"
between second and third Bohr’s orbits is
#
! !" (2) n = (x – 1), l = (x – 2), m = (x – 2), s = –
(1) (2) "
" #
! ! #
(3) (4) (3) n = (x + 1), l = x, m = x, s = +
" " "
15. How many electrons in an element with atomic #
(4) n = (x – 2), l = x, m = (x – 1), s = –
number 28 have (n + l) = 4? $
(1) 6 (2) 8 23. If 0 is the threshold wavelength of a metal and
(3) 7 (4) 10 is the wavelength of the incident radiation. The
16. The wave number of first line of Balmer series of maximum velocity of the ejected electrons from the
hydrogen is 15200 cm–1. The wave number of the metal would be
first Balmer line of Li2+ ion is
!"# !"#
(1) 15200 cm–1 (2) 136800 cm–1 ! ! # $" ! !"# # $"
$ $
(1) % ' (& (2) % ' (&
(3) 60800 cm–1 (4) 78000 cm–1 "# )' ( $ ') (&
+% $ * ,& +% $ *,
17. The ratio of specific charge of a proton and an
-particle is !"# !"#
!! " ! $"# "
(1) 2 : 1 (2) 1 : 2 (3) # $ $ (4) # $ $
% "# & % ! &
(3) 1 : 4 (4) 1 : 1
18. Which of the following is incorrect about Bohr’s 24. If and K.E are the frequency of incident light and
model of an atom? kinetic energy of photo electrons in the given
graph. The slope of the line will be
$%
(1) Orbit angular momentum = & '
(2) It is applicable for H– and H-like species

(3) It is defined for hydrogen molecule only
(4) All of these !"#"
19. If the kinetic energy of an electron in the nth
shell !
(1)
is x kJ/atom then its potential energy in the same "
shell will be #
(2)
!
(1) x kJ / atom (2) kJ / atom
"
(3) h
!
(3) –2x kJ / atom (4) – kJ / atom (4)
" 0
Last Leap for NEET (Part-I) Structure of Atom 3
25. If the angular momentum of an electron in a Bohr’s 32. An electron in an atom jumps in such a way that
orbit of the hydrogen atom is 3.164 × 10–34 kg m2/s. !
The energy of the electron in the same orbit is its kinetic energy changes from x to . The
$
(1) –3.4 eV (2) 3.4 eV change in potential energy will be
(3) –1.5 eV (4) –13.6 eV ! %

(1) " (2) !
( &
26. The probability distribution curve for 2 s electron
appears like ! %
(3) " (4) !
& #
! !
! !
33. Line spectra is characteristic of
(1) (2)
(1) Atoms (2) Compounds
" "
(3) Molecules (4) All of these
! !
! ! 34. The magnetic quantum number for valence
electron of Ba (atomic number 56) is
(3) (4)
(1) 0 (2) ± 1
" "
(3) ± 2 (4) All of these
27. Which of the following d-orbital will have only two
lobes? 35. The ratio of the number of lines obtained in Paschen
series to Pfund series when electron jumps from sixth
(1) dxy (2) dxz
excited state to first excited state is
(3) ! ! ! "! (4) ! ! (1) 3 (2) 4
!
(3) 5 (4) 2
28. Which of the following line in hydrogen spectrum
36. If one orbital can accommodate maximum of three
is obtained corresponding to second line of
electrons then last electron of calcium will be filled in
Brackett series in He+ ion spectrum having same
wavelength? (1) s-orbital (2) p-orbital
(3) d-orbital (4) f-orbital
(1) First line of Lyman series
37. Which of the following has minimum number of
(2) Second line of Lyman series
angular nodes?
(3) First line of Balmer series
(1) 2px (2) 3py
(4) Second line of Balmer series
(3) !! " ! !! (4) !! ! !
29. The ratio of number of revolutions of electron per
38. Radius of first orbit of hydrogen atom is a0. Then
second in 2nd and 3rd orbit of H-atom is
the wavelength associated with electron in the 3rd
!! " " ! ! ""
orbit will be
(1) " ! (2) " !
! " ! "
$ &!
!! !" !! !" (1) 2 a0 (2)
(3) " " (4) '
! "
"! "" (3) 4 a0 (4) 6 a0
30. The total number of exchanges of electrons in d5 39. Which of the following statements about spectral
system (degenerate orbitals) is series is incorrect?
(1) 7 (2) 8 (1) The lines in the Balmer series corresponds to
(3) 9 (4) 10 electron transitions from energy levels higher
than n = 2 energy level
31. The electronic transition from n = 2 to n = 1 will
(2) Paschen series appears in the infrared region
produce shortest wavelength in
(3) The lines of Lyman series appear in the visible
(1) H
region
(2) He+
(4) Transitions from higher energy levels to 5th
(3) Be3+ energy level produce Pfund series which falls
(4) Li+2 in the infrared region
40. To which electronic transition of hydrogen, the 47. One unpaired electron in an atom contributes a
second line in the Balmer series belongs? magnetic moment of 1.1 BM. The magnetic
(1) 3 2 (2) 4 2 moment for Mn (Z = 25) is
(3) 5 2 (4) 6 2 (1) 4.4 BM (2) 1.1 BM
41. The ratio of kinetic energy and potential energy of (3) 5.5 BM (4) 6.6 BM
an electron in a Bohr orbit of a hydrogen like 48. The nuclear radius of an atom whose mass
species is number is 125 is
# " (1) 1.4 × 10–15 m (2) 5 × 10–15 m
(1) (2)
$ ! (3) 7.0 × 10–15 m (4) 125 × 10–15 m
(3) 1 (4) –1
49. If the energy of an electron in 3rd Bohr orbit is
42. The radius of hydrogen atom in the ground state is –E, what is the energy of the electron in 2nd Bohr
0.53 Å. The radius of Be3+ ion in a similar state is orbit?
(1) 0.17 Å (2) 1.06 Å (1) –2.25 E (2) –9 E
(3) 0.132 Å (4) 0.265 Å (3) –4.75 E (4) – E
43. Potential energy of Be3+ electron is 50. Which of the following statement is correct for
" orbital angular momentum of 2p and 3p-electron?
"
(1) (1) Orbital angular momentum of 2p-electron is
!!
more than that of 3p-electron
$# "
(2) (2) Orbital angular momentum of 3p-electron is
" !!
more than that of 2p-electron
#" (3) Orbital angular momentum of 2p-electron is
(3)
" !! same as that of 3p-electron
$# " (4) Orbital angular momentum of 2p electron is
(4) equal to 2s electron and 3p electron is equal
" !!
to 3s electron
44. If threshold wavelength ( 0) for ejection of electron
from metal is 330 nm, then work function for the 51. The distance of separation between the second
photoelectric emission is and third orbits of hydrogen atom is
(1) 1.2 × 10–18 J (2) 1.2 × 10–20 J (1) 2.645 Å (2) 3.156 Å
(3) 6 × J 10–19 (4) 6 × J 10–12 (3) 0.529 Å (4) 1.12 Å
45. Which of the following has no angular node? 52. Which state of Be3+
has the same orbit radius as
(1) ! !
that of the ground state of hydrogen atom?
!
(2) pz (1) First orbit (2) Second orbit
(3) ! (3) Third orbit (4) Fourth orbit
!! ! " !
(4) dxy 53. A species having only one electron has ionization
46. Which of the following set of quantum numbers is energy of 11810 kJ mol–1. The number of protons
correct? in its nucleus will be
" (1) 1 (2) 2

(1) n = 7 l=0 m = +1 #
! (3) 3 (4) 4
" 54. Which of the following match is incorrect?
(2) n = 3 l=3 m = –2 #
! (1) 5px orbital (4 radial nodes)
"
(3) n = 2 l=0 m = –1 # (2) 3dxy orbital (2 nodal planes)
!
(3) 4s orbital (3 radial nodes)
"
(4) n = 5 l=1 m=0 # (4) 5f orbital (maximum 2 electrons)
!
55. Among the species given below which one is 61. The number of possible lines obtained in Balmer
isoster of N2? series when electron jumps from 5th excited state
(1) CO (2) O2 to ground state in H-atom are
(3) O2– (4) CO+ (1) 3 (2) 4

56. The correct set of quantum numbers for last filled (3) 5 (4) 6
electron of Cr-atom is given by 62. The total amount of energy released when electron
" jumps from 3rd excited state to ground state in
(1) n = 4 l=4 m=0 s= 10 g atom of Hydrogen is [NA = Avogadro’s number]
!
" (1) 34 NA eV (2) 121 NA eV
(2) n = 3 l=0 m=0 s=
!
(3) 127.5 NA eV (4) 150 NA eV
"
(3) n = 3 l=2 m=0 s= 63. If the energy given by photons to a metal is 20%
!
higher than its work function, then the kinetic
" energy will be
(4) n = 3 l=2 m = +2 s=
!
(1) 6 times of work function
57. The ratio of maximum spectral lines in Balmer
series and maximum number of spectral lines #
produced when electrons jump to 1st excited state (2) times of work function
%
form 5th excited state in H-atom sample will be
(3) 6 times of energy of photons
$ #
(1) (2) #
# !" (4) times of energy of photons
%
# !
(3) (4) 64. No shielding effect is observed in
!" !"
58. The electron in Li2+ ion transit from an excited (1) He (2) He+
state to ground state. Then its (3) Li+ (4) O–2
(1) Kinetic energy decreases but potential and 65. Which have the same number of s-electrons as the
total energy remains same d-electrons in Fe+2?
(2) Kinetic energy increases but potential and total (1) Ca (2) Na
energy decreases
(3) N (4) P
(3) Kinetic energy and total energy decreases and
potential energy increases 66. Which orbital is represented by 4, 2, 0 ?
(4) Kinetic, potential and total energy decreases (1) (! ! ! (2) !! ! ! " !
59. Which of the following statement is incorrect?
(3) 4dxy (4) 4s
(1) Energy of 2s orbital of hydrogen atom is not
equal to 2s orbital of lithium 67. The ratio between K.E. and total energy of the
(2) The net positive charge experienced by the electrons of hydrogen atom according to Bohr’s
electron from the nucleus is known as effective model is
nuclear charge (1) 1 : –1 (2) 1 : 1
(3) For hydrogen atom, the energy of orbital is in (3) 1 : 2 (4) 2 : 1
the order 1s < 2s < 2p < 3s < 3p < 4s < 3d
68. An ion M+n (Z = 25) has the magnetic moment
(4) The total number of nodes = (n – 1)
equal to 4.9 B.M. The value of n is
60. The total exchange of electron in d 5 system is
(1) 3
(1) 5
(2) 4
(2) 6
(3) 7 (3) 2
(4) 10 (4) 5
69. An electron in an atom undergoes transition in 76. For an electron in He+, the product of number of
such a way that its K.E. changes from x to x/4. revolution per second and the time taken for one
The change in P.E. will be revolution in the third orbit is
) ! (1) 3 (2) 2
(1) " (2) " !
( # (3) 4 (4) 1
% '
& ! 77. Radiations of wavelength 253.7 nm strikes the
(3) ' (4) !
# plate of a metal and energy required to stop the
70. The ratio of slopes of maximum kinetic energy ejection of electron from the plate is 0.40 eV then
versus frequency and stopping potential (V0) vs work function of metal is
frequency, in photoelectric effect gives (1) 0.40 eV (2) 4.49 eV
(1) Charge of electron (2) Planck's constant
(3) 6.25 eV (4) 0.75 eV
(3) Work function (4) Threshold frequency
78. The incorrect statement regarding photoelectrons
71. The value of wave number in terms of is
Rydberg’s constant, when transition of electrons (1) Kinetic energy of photoelectrons depends upon
takes place between two levels of He+ ion whose the frequency of the radiation
sum is 4 and difference is 2
(2) Kinetic energy of photoelectrons is
!! #$! independent to the intensity of radiation
(1) (2)
" "
(3) Photoelectrons will be ejected when energy of
)# !!
(3) ( (4) the radiation is greater than threshold energy
"
(4) Number of photoelectrons emitted
72. How many times does light travels faster in Frequency of radiation
vacuum than an electron in Bohr’s first orbit of
hydrogen atom? 79. Number of spectral lines produced in Lyman series
when an electron jumps from 4th excited state to
(1) 13.7 times (2) 67 times 1st excited state is
(3) 137 times (4) 97 times
(1) 6 (2) 15
73. An excited electron of H-atoms emits photon of
(3) 3 (4) Zero
wavelength and returns in the ground state. The
principal quantum number of excited state is given 80. Which of the following radial probability density
by curve is correct representation?
! #$ !
(1) (2) !
"! !
#!
! ! !"
(1) (2)
!
(3) " " "# (4) ! !" ! !
74. If it is assumed that the electron exist within the

nucleus then the minimum uncertainty in the velocity ! "!
of electron is approximately
(3) (4) All of these
(1) 3 1014 m/s (2) 4.8 108 m/s
!
(3) 5.7 1010 m/s (4) 6 1012 m/s
81. An electron is moving in an orbit of He+ having
75. The number of peaks obtained for 3d and 4s
!
orbital respectively when a graph plotted radial angular momentum is . The velocity of electron
probability function versus distance from the
nucleus (r) is in this orbit is
(1) 1, 4 (2) 2, 3 (1) 4.36 × 108 cm/s (2) 1.9 × 108 cm/s
(3) 2, 4 (4) 3, 4 (3) 2.18 × 108 cm/s (4) 13.6 × 106 cm/s
82. The wavelength of an electron moving in the 3rd 88. How many lines in the spectrum corresponds to
shell of hydrogen is Paschen, Brackett, Pfund and Humphery series
(1) Å (2) 3 Å will be observed when an electron returns from 6th
excited state to 1st excited state of a hydrogen
(3) 6 Å (4) 3.174 Å
atom?
83. The first emission line of Lyman series for
hydrogen spectrum has the wave number equal to (1) 20 (2) 13
% * (3) 15 (4) 10
(1) (2)
#& # 89. The ratio of velocity of an electron present in 1st
)# Bohr’s orbit of hydrogen atom to 2nd Bohr’s orbit
(3) (4) R
( of He ion
84. If we plot a graph between radial probability (1) 1 : 1 (2) 1 : 2
function and radial distance for 2p subshell, then
number of peaks obtained will be (3) 2 : 1 (4) 1 : 4
(1) 2 90. A ball has a mass of 40 g and a speed of
(2) 1 45 m/s. If the speed can be measured within
accuracy of 2%, then uncertainty in the position
(3) 0
(1) 1.46 × 10–33 m (2) 1.46 × 10–30 m
(4) 3
(3) 1.7 × 10–31 m (4) 2.5 × 10–33 m
!! "! "" #!
85. 91. For d orbital which of the following statement is
correct about radial and angular nodes?
The above electronic configuration of an atom (1) (n – 3) radial nodes (2) 2 angular nodes
violates
(3) (n – 2) radial nodes (4) Both (1) & (2)
(1) Hund’s rule
92. The number of orbitals in a shell n is given by
(2) Pauli’s exclusion principle
(1) n2 (2) 2n2
(3) Aufbau principle
(3) n (4) 2n
(4) All of these
86. Total number of revolutions per second possessed 93. When a certain metal was irradiated with light of
by an electron in a Bohr’s orbit is directly wavelength 1, the photoelectrons emitted had
proportional to thrice the K.E. as did the photoelectrons emitted
when same metal was irradiated with light of
!! "" wavelength 2 . Then which of the following
(1) (2) relation is true, if 0 is the threshold wavelength?
"" !!
(1) 3 1( 0 – 2) = 2( 0 – 1)
+ !!
(3) (4) (2)
$ "! 1( 0 – 2) = 3 2( 0 – 1)
87. Find the correct statement about Bohr’s theory (3) 1( 0 – 2) = 2( 0 – 1)
(1) The stationary orbits are arranged around the (4) 3( 1 – 2) =( 0 – 1)

nucleus concentrically 94. Choose the incorrect statement among the
(2) When the electron move from a lower energy following
state to higher energy state energy is emitted (1) 2 represents an atomic orbital
(3) The angular momentum of electron in 3 rd
(2) A node is a point in 3-dimensional region
!
Bohr orbit is where wave function is zero
#
(3) A d orbital contains 10 e–
(4) Electron becomes stationary in orbit so these
orbits are called stationary orbits (4) 3d, 4d and 5d orbitals differ in energy
95. The change in orbit angular momentum 101. The number of radial nodes in 3s and 2p orbitals
corresponding to an electron transition from 4th are respectively
excited state to ground state of a hydrogen atom (1) 2, 0 (2) 0, 2
can be given by
(3) 1, 2 (4) 2, 1
! #$ 102. For d electron, the orbital angular momentum is
(1) (2)
%
! ,%
(1) " (2)
#
$ %$
(3) (4) ( !
% (3) ) (4) "
96. For hydrogen atom which sequence is correct for 103. The atomic spectrum of Li2+ arises due to the
energy? transition of an electron from n 2 to n 1 level. If
(1) 1s < 2s < 3s (2) 1s < 2s < 2p n1 + n2 is 4 and n2 – n1 is 2, then wave number of
(3) 2s < 2p < 3s (4) 3s < 3p < 3d this transition is (RH = 105 cm–1)
97. The correct outer electronic configuration of Cr+3 (1) 105 cm–1 (2) 8 × 105 cm–1
is (3) 2.7 × 105 cm–1 (4) 5 × 105 cm–1
"" !! 104. Find the set of quantum numbers which are
(1) possible
"" !! *
(1) n = 0, ! = 0, m = 0, s =
(2) &
*
"" !! (2) n = 1, ! = 0, m = 0, s =
&
(3)
*
"" !! (3) n = 1, ! = 1, m = 0, s =
&
(4)
*
(4) n = 1, ! = 0, m = +1, s =
98. Which of the following configuration is associated &
with maximum exchange energy? 105. The size of isoelectronic species O2–, F–, Ne, Na+,
(1) d 4 (2) d 5 Mg2+ is affected by
(3) d 9 (4) d 10 (1) Nuclear charge
99. The ratio of velocity of CH4 and O2 molecules so (2) Principal quantum number
that they are associated with de Broglie waves of (3) Number of electrons in the outermost shell
equal wavelengths, is (4) Penetration effect
(1) 2 : 1 (2) 1 : 2 106. Which pair of orbitals given below for H atom are
(3) 1 : 4 (4) 4 : 1 degenerate?
100. Which of the following correctly represents (1) 1s, 2s (2) 2s, 3s
Heisenberg’s uncertainity principle? (3) 3s, 3p (4) 4s, 3d
! 107. The permissible values of azimuthal quantum

(1) "# $ number (!) for electron belonging to fourth energy
%
level are
!
(2) # (for angular motion) !
% (1) "# #$
$
! (2) ± 1, ± 2, ± 3
(3) "# $
% (3) 0, 1, 2, 3
(4) All of these (4) Any value between 0 and 3
108. Which of the following electron transitions in a 115. Number of electrons in Mg(Z = 12), having ! = 0
hydrogen atom will require the largest amount of "
energy? and ! are equal to
!
(1) From n = 1 to n = 2 (2) From n = 2 to n = 3 (1) 6 (2) 3
(3) From n = to n = 1 (4) From n = 3 to n = 5 (3) 4 (4) 2
109. If 0 and be the threshold wavelength and the *

116. An electron has a spin quantum number and
wavelength of incident light, the velocity of &
photoelectrons ejected will be a magnetic quantum number –1, it cannot be
present in
&% &%0
(1) - " . (2) - " . (1) s-orbital (2) p-orbital
/ /
(3) d-orbital (4) f-orbital
&%0 ! * * " !" ! # #" 117. Sum of total lines which are present in UV and
(3) # $ (4) # $ visible region during transition from 8th energy state
/ % " & $% ! &
to IInd energy state
110. Kinetic energy of electron of H-atom is maximum (1) 6 (2) 13
in (3) 15 (4) Zero
(1) First orbit 118. Total number of electrons with clockwise spin, for
Mn in the orbitals with n + l = 3,
(2) Second orbit
(1) 2 (2) 4
(3) Third orbit
(3) 6 (4) 8
(4) Infinite orbit
119. Which has maximum energy for H-atom?
111. Sequence of increasing screening effect in a
(1) 4 s (2) 4 p
particular shell is
(3) 4 d (4) All have same energy
(1) s < p < d < f (2) s < p > d < f
120. Which of the following set of quantum number is
(3) s > p > d > f (4) s > p > d < f not-possible?
112. In the hydrogen atom if the total number of n l m s
spectral lines produced by n th excited state to
*
ground state are six, then energy of the nth shell (1) 2 1 0
&
is
*
(1) –13.6 eV/atom (2) –10.2 eV/atom (2) 3 0 0
&
(3) –0.85 eV/atom (4) –3.4 eV/atom *
(3) 3 2 –1
113. Which of the following statement is incorrect? &
(1) If uncertainty in momentum of electron is zero *
(4) 4 0 –1
then uncertainty in position will be infinite &
121. Orbital angular momentum for the electron present
(2) The number of angular nodes in dz2 orbital is
in 4p orbital is
zero
!" #
(3) The uncertainty in position and uncertainty in (1) (2)
momentum can be equal in magnitude $
! ( "
(4) Heisenberg’s uncertainty principle has no (3) " (4) )
significance in everyday life $
122. Which is true regarding e/m for electron?
114. Which value of n, l, m, s are not permissible?
(1) It is 1.76 × 1011 C/kg
* *
(1) 3, 3, 1, 1 (2) 3, 2, –2, 1 (2) It is 1.6 × 10–19 C/g
& &
(3) It is 2.5 × 1011 C/g
* *
(3) 3, 2, 0, (4) 3, 2, 1, 1 (4) It is 9.1 × 10–19 C/kg
& &
123. The correct electronic configuration of Pd (Z = 46) 131. Information conveyed by principal quantum
! " numbers
(1) !"#$%! &" (2) !"#$%! ! &""
(1) Energy of orbit
(3) !"#$%!!" &"" (4) !"#$%! ! &""%# "
(2) Number of angular nodes
124. In which of the following arrangement, filling of e–
in orbital, obey’s Aufbau principle, Hund’s rule and (3) Orbital angular momentum
Pauli's principle? (4) All of these
(1) (2) 132. Correct graph between radial probability
(3) (4) distribution (4 r2 2) and radial distance (r) for 2s
is shown by
125. If the kinetic energy for hydrogen in a given energy
state is 1.50 eV, then the potential energy for
hydrogen in the same energy state will be ! !
! "
(1) –1.51 eV (2) 3 eV (1)
(3) – 3 eV (4) –0.75 eV
"
126 Number of revolution per second for electron in a
unielectron atom according to Bohr’s theory is
! !
given by ! "
! " ! (2)
(1) (2)
# " #
"
(3) 2 rV (4) 2 r + V
127. Maximum wavelength for transition in visible region ! !
! "
for He+ will be given by
(3)
*
(1) R (2) "
#
"# 2
(3) (4)
2 "# ! !
! "
128. Correct order of energy in visible region is shown (4)
by
"
(1) Violet < Blue < Yellow < Red
133. Value of all quantum numbers for 20th electron of
(2) Red < Yellow < Blue < Violet
zinc (at number 30) will be
(3) Yellow < Red < Blue < Violet
n l m s
(4) Yellow < Red < Violet < Blue
*
129. Which of the following is incorrect match? (1) 3 2 –2
&
!"# !"$
(1) !%! " #$%& – Isodiaphers *
(2) 3 2 –2
!" !# &
(2) !$ " #% – Isotones
*
!" !" (3) 4 0 0
(3) !"#" # $%$% – Isobar &
(4) CO2 & N2O – Isoelectronic *
(4) 4 0 1
130. de Broglie wavelength of an electron, having &
kinetic energy of 0.35 J 134. If the radius for the 2nd Bohr’s orbit is given by
0.529 Å, the unielectron species having above
!"! #$ !"# !
(1) $%
% (2) !"
" radius is
$"& #$ #$% &#
(1) H (2) He+
!" !
!"# $!
(3) % (4) !"
" (3) Li+2 (4) Be+3
& #$% &#
135. Circumference of the orbit depends upon 144. Which of the following radiation is of highest wave
(1) Energy of orbit (2) No. of the orbit length?
(1) X-rays
(3) Both (1) & (2) (4) Neither (1) nor (2)
(2) UV-rays
136. Which is the first shell to have 7 fold degenerate
orbital? (3) Red light of visible part
(1) K-shell (2) L-shell (4) Violet light of visible part

145. Which of the following spectral line of H-atom
(3) M-shell (4) N-shell
having same wavelength as second line of He+
137. The energy of electron in the 2nd Bohr orbit of H spectrum of Balmer series?
atom is –E, the energy in the first shell of He+ is
(1) First line of Lyman series
(1) –16 E (2) –4 E
(2) First line of Balmer series
(3) 2 E (4) 4 E (3) Second line of Lyman series
138. The ratio of kinetic energy and total energy of (4) Second line of Paschen series
electron in the 2nd shell of He+ is
146. Maximum number of electron in a sub-shell is
* (1) (4l + 2) (2) (4l – 2)
(1) –1 (2)
&
(3) (4n + 2) (4) (4n + 1)
& 147. Which of the following electronic transition occurs
(3) (4) 1
* in H-spectrum having same wavelength as in He+
ion spectrum when electron jumps from 3rd excited
139. The volume of the nucleus is about
state to first excited state
(1) 10–4 times to that of atom (1) n = 3 to n = 1 (2) n = 4 to n = 1
(2) 10–15 times to that of atom (3) n = 2 to n = 1 (4) n = 4 to n = 2
(3) 10–5 times to that of atom 148. Spin angular momentum of valence electron of
(4) 10–10 times to that of atom copper is
140. Which of the following line is of largest (1) 2 " (2) %"
wavelength? ! !
(3) " (4) "
(1) First line of Lyman series " #
(2) First line of Balmer series 149. According to Bohr’s theory, which is not the correct
formula?
(3) First line of Paschen series
(1) Potential energy of e – in 1 st shell for
(4) First line of Pfund series
H = –27.2 eV
141. The pair in which both species have equal (2) Kinetic energy of electron of H-atom in first
magnetic moment is orbit is maximum
(1) Fe2+, Mn2+ (2) Cu2+, Ni2+ (3) Radius of 1st orbit for H = 0.529 Å
(3) Fe3+, Ni2+ (4) Fe3+, Mn2+ (4) Velocity of e– in 1st orbit for H = 4 × 108 m/s
142. Possible set of quantum number n, l, m and s 150. Incorrect match is
respectively is (1) 4p – 3 nodes
* (2) 3d – 2 angular nodes
(1) 3, 2, 3, (2) 3, 2, –2, –1
& (3) d orbital – Accommodates 10
electrons
* *
(3) –3, 2, –2, (4) 3, 2, –2, (4) 2s orbital – 1 radial node
& &
151. If Aufbau rule is not obeyed, 19th electron in
143. Aufbau principle is violated in Sc(Z = 21) will have
(1) [Ne] 3s1, 3p3 (2) [Ar] 4s2, 3d0, 4p3 (1) n = 3, l = 0 (2) n = 3, l = 1
(3) [Ne] 3s0, 3p5 (4) All of these (3) n = 3, l = 2 (4) n = 4, l = 0
152. The maximum number of sub-shells, orbitals and 160. The magnetic quantum number specifies
electrons in N-shell of an atom are respectively
(1) Size of orbitals
(1) 4, 12, 32 (2) 4, 16, 30
(2) Shape of orbitals
(3) 4, 16, 32 (4) 4, 32, 64
(3) Orientation of orbitals
153. The energy required to dislodge electron from Li2+
(4) Nuclear stability
is sufficient to ionize how many H-atoms?
(1) 3 (2) 6 $
161. When any nucleus has ratio greater than that
(3) 9 (4) 12 4
in stability zone. Which of the following nuclear
154. The energy of an electron in the 3rd orbit of an
atom (H) is –E. The energy of an electron in the change will be expected?
first orbit will be (1) -emission (2) -emission
3 (3) Positron emission (4) K-electron capture
(1) –3E (2)
) 162. The number of waves made by an electron during
3 one complete revolution in fourth orbit is
(3) (4) –9E
2 (1) 3 (2) 4
155. Number of neutron in N3– ion (3) 5 (4) 6
(1) Equals to e– 163. Potential energy of electron of H-atom in an orbit
(2) Three less than e– is –x eV, then kinetic energy of electron in the
same orbit would be
(3) Three more than e–
(1) –x eV (2) +x eV
(4) Three less than protons
156. 420 denotes which of the following orbital? ! !
(3) eV (4) !"#
! $
(1) 4s (2) !!! !
164. The atomic orbital is
(3) !! ! ! (4) (! ! ! " !
(1) The circular path of the electron
157. A metal surface when exposed to solar radiations (2) Elliptical path of the electron
(1) The emitted electrons have energy less than (3) Two dimensional field around the nucleus
a maximum value of energy depending upon
(4) Maximum probability region of an electron
the frequency of the incident radiation
165. Which energy level in Li2+ has same energy as
(2) The emitted electrons have energy less than
the fourth energy level of H-atom?
the maximum value of energy depending upon
the intensity of incident radiation (1) 12 (2) 6
(3) The emitted electrons have zero energy (3) 4 (4) 3
(4) The emitted electrons have energy equal to 166. Photoelectric effect is the phenomena in which
energy of photons of incident light
(1) Photon comes out of the nucleus of an atom
158. The most probable radius for finding electron in under the action of an electric field
He+ is
(2) Photon comes out of a metal when it is hit by
(1) 0.0 (2) 0.529 Å a beam of electrons
(3) 0.265 Å (4) 0.105 Å (3) Electrons are ejected from the metal with a
159. Four quantum numbers of highest energy occupied constant velocity which depends on the
! frequency and intensity of incident radiation
electron is n = 4, l = 1, m = 0, s = . The orbital
" (4) Electrons are ejected from the metal with
occupied by the electron is
different velocities which depends only on the
(1) 4px (2) 4py frequency of the incident radiation, not on its
(3) 4pz (4) Any one of these intensity
167. Among the following have most stable electronic
* *
configuration is 174. The quantum numbers and for the
& &
(1) Fe2+ (2) V2+ electron spin represents
(3) Fe3+ (4) Fe+ (1) Two quantum mechanical states which have no
168. In an atom two electrons move around the classical analogue
nucleus in circular orbits of radii R and 4R. The (2) Magnetic moment of the electron pointing up
ratio of the time taken by them to complete one and down respectively
revolution is
(3) Rotation of the electron in anticlockwise and
(1) 8 : 7 (2) 1 : 8 clockwise direction respectively
(3) 4 : 1 (4) 1 : 4 (4) Rotation of the electron in clockwise and
169. Ionisation potential of hydrogen atom is 13.6 eV. anticlockwise direction respectively
Hydrogen atom in the ground state are excited by 175. Which of the following statement is wrong?
monochromatic light of energy 12.1 eV. The
number of spectral lines emitted by hydrogen (1) If the value of l = 0, the electron distribution
according to Bohr’s theory will be is spherical
(1) 2 (2) 4 (2) Orbital angular momentum of 1s, 2s and

3s electrons are equal
(3) 1 (4) 3
(3) The shape of the orbital is given by Azimuthal
170. Which value is closest to the wavelength in quantum number
nanometer of a quantum of light with frequency of
8 × 1015 s–1? (4) In an atom, all electrons travel with the same
velocity
(1) 2 × 10–25 (2) 5 × 10–18
176. Which of the following statement does not form a
(3) 4 × 101 (4) 3 × 107
part of Bohr’s model of hydrogen atom?
171. The number of electrons with the Azimuthal
(1) Energy of electron in the orbit is quantized
quantum number l = 1 and l = 2 in ground state
of Cu are respectively (2) The electron in the orbit nearest to the nucleus
has the lower energy
(1) 12, 10 (2) 12, 7
(3) Angular momentum of the electron in the orbit
(3) 10, 12 (4) 7, 12
is quantized
172. The number of radial nodes of 4s and 3p orbitals
(4) The position and velocity of the electron in the
are respectively
orbit cannot be determined simultaneously
(1) 1, 3 (2) 3, 1
177. Which of the following is valid representation of
(3) 4, 2 (4) 3, 2 electron?
173. Which of the following sets of quantum numbers (1) 333
represent the highest energy of subshell of an
(2) 323
atom?
(3) 321
"
(1) n = 3, l = 1, m = 1, ! (4)
! 312
178. An ion Mna+ has the magnetic moment equal to

"
(2) n = 4, l = 0, m = 0, ! 4.9 B.M. The value of ‘a’ is
!
(1) 2
"
(3) n = 3, l = 0, m = 0, ! (2) 5
!
" (3) 3
(4) n = 4, l = 2, m = –2, !
! (4) 4
179. Which of the following is the correct representation 184. Select the incorrect statement about the wave
of plot of the radial function against the radial function
distance ‘r’ from the nucleus for an electron of 3s (1) must be continuous
orbital?
(2) has physical significance
!
(3) has no physical significance
(4) 2 gives the probability of finding the electrons
(1) 185. Which of the following statement is not correct?
" (1) Magnetic quantum number may have +ve and
! –ve values including zero
(2) For Ag, Z = 47, spin quantum number for 24
*
(2) electrons is while for other 23 electrons
&
" *
is
! &
(3) For H-atom energy of electron in different
subshell of same shell is in the order of
(3) s<p<d<f
(4) For H-atom and hydrogen like species, the
"
order of energy is
!
1s < 2s = 2p < 3s = 3p = 3d < 4s = 4p = 4d
= 4f.....
(4) 186. The number of spectral lines obtained in visible
region in hydrogen spectrum if electron jumps from
"
sixth excited state to second excited state is
180. If the shortest wavelength of H-atom in Lyman
series is , then longest wavelength in Balmer (1) 4 (2) 10
series of He+ ion is (3) 15 (4) Zero
!" 187. The ratio of kinetic energy to potential energy of
(1) (2) electron of H-atom is
# #
! ! (1) 1 : 2 (2) –1 : 2
(3) (4)
" " (3) 1 : 1 (4) –1 : 1
181. Which of the following d-orbitals has electron 188. Which of the following orbital has no angular node?
density along all the three axes?
(1) !!! ! (2) !!! ! "!
(1) 3dyz (2) 3dzx
(3) 3dxy (4) !! ! ! (3) "! "# (4) All of these
182. The respective value of orbital angular momentum 189. The correct energy order of orbitals for H-atom is
of an electron in 1s, 2s, 3d and 3p orbitals are
(1) 1s < 2s < 2p < 3s < 3p < 3d
! ! ! !
(1) "#$# % # & (2) &'&' (& ' ) (2) 1s = 2s < 2p = 3s < 3p < 3d
' ' ( (
(3) 1s < 2s = 2p < 3s = 3p = 3d
! ! ! !
(3) "#"# $ # % (4) "#"# $ # % (4) 1s = 2s = 2p < 3s < 3p < 3d
% % % %
190. Which of the following statements is incorrect?
183. Which among the following is/are correct about
(1) Kinetic energy of electron is maximum in first
chromium?
orbit
(1) Its electronic configuration is 3d54s1
(2) Velocity of electron is minimum in first orbit
(2) Total spin of chromium = 3
(3) Radius of first orbit of H-atom is minimum
(3) Magnetic moment of chromium = "#
(4) The region of maximum electron density is
(4) All of these
called antinode
191. If the velocity of electron becomes equal to the 199. If IE1 of He atom is 24.5 eV then its IE2 will be
velocity of light then mass of electron will be (1) 24.5 eV (2) 54.4 eV
(1) Zero (3) 108.8 eV (4) 100 eV
(2) Infinity 200. In the conversion of Cu2+ from Cu+ electron is lost
(3) Lower than the rest mass (9.1 × 10–31 kg) of from
electron (1) 4s orbital (2) 4p orbital
(4) Remains same (3) 4f orbital (4) 3d orbital
192. If the magnitude of uncertainties in position ( x) 201. Consider the following statement :
and momentum ( p) are equal then which of the I. p-orbital can accommodate maximum of two
following relation is correct? electrons.
! " ! II. d-subshell has five orbitals.

(1) # (2) " # III. Energy of electron decreases as it goes away
$ % $
from nucleus in an atom
* % * %
(3) 5 (4) 5 Choose the correct statements.
/ & &/ &
(1) I & II (2) II & III
193. The shortest wavelength in hydrogen atom
spectrum of Lyman series is (3) I & III (4) I, II & III
202. Orbital angular momentum of 3d electron is
(1) 1050.75 Å (2) 525.10 Å
(3) 911.7 Å (4) 1510.22 Å (1) "#! (2) ! "!
194. Which transition of electron in H-atom spectrum (3) $ #! (4) # "!

occurs if electron jumps from 5th excited state to
203. Maximum number of electrons which can be
first excited state in He+ ion spectrum having same
accommodated in 4th shell is
wavelength?
(1) 4 (2) 8
(1) n = 4 to n = 2 (2) n = 3 to n = 1
(3) 16 (4) 32
(3) n = 4 to n = 1 (4) n = 3 to n = 2
204. The possible sets of quantum numbers of electron
195. Photoelectric effect can be caused by present in second shell is
(1) Visible light but not by X-rays *
(1) n = 2, l = 0, m = 0, s =
(2) Gamma rays but not X-rays &
(3) Ultraviolet light only *
(2) n = 2, l = 1, m = 1, s =
&
(4) Visible light, ultraviolet rays, X-rays and gamma
rays *
(3) n = 2, l = 1, m = 0, s =
&
196. Which spectral line may appear in both emission
(4) All of these
and absorption spectrum of hydrogen?
205. Which of the following graphs plotted between
(1) Lyman (2) Balmer
frequency of incident radiation and KE of
(3) Paschen (4) Humphery photoelectrons is correct for photoelectric effect?
197. The number of radial nodes of 3s and 2p orbital
is respectively
(1) 2, 0 (2) 0, 2 (1) (2)
(3) 1, 2 (4) 2, 1
!" !"
198. A gas absorb a photon of 355 nm and emit two
wavelengths, if one of the emissions is at 680 nm,
the other is at
(3) (4)
(1) 1035 nm (2) 325 nm
(3) 743 nm (4) 518 nm !" !"
206. Number of waves made by electron in 4th orbit of R : The total number of spectral line obtained is
H atom determined by n.
! 6. A : Kinetic energy of electron decreases with
(1) 2 (2)
# increase in orbit number in H-atom.
! R : Total energy of electron increases with
(3) (4) 4
" increase in orbit number.
207. | |2 at any point in an atom gives the value of 7. A : First line of Lyman series of H-spectrum and
(1) Radius of the orbital second line of Balmer series of He+ spectrum
(2) Probability density of electron at that point have same wavelength.
(3) Total energy of the electron R : First line of Lyman series of H-spectrum and
(4) Shape of the orbital third line of Paschen series of Li +2 ion
SECTION - B spectrum have same wavelength.
8. A : The energy level of atomic orbitals for H-atom
Assertion - Reason Type Questions
is 1s < 2s = 2p < 3s = 3p = 3d.
In the following questions, a statement of assertion
R : The energy of H-atom orbitals depends upon
(A) is followed by a statement of reason (R)
n value only.
(1) If both Assertion & Reason are true and the
reason is the correct explanation of the 9. A : The energy of the electron in the nth shell is
assertion, then mark (1). '!
–13.6 () * %+,( .
(2) If both Assertion & Reason are true but the -!
reason is not the correct explanation of the R : The ionisation energy of the electron in the
assertion, then mark (2). hydrogen atom is equal to +13.6 eV/mole.
(3) If Assertion is true statement but Reason is 10. A : The ground state electronic configuration of
false, then mark (3). nitrogen is 1s2 2s2 2p3.
(4) If both Assertion and Reason are false R : Electrons are filled in orbitals according to
statements, then mark (4). Pauli exclusion principle, Aufbau principle and
1. A : 3dyz has two nodal planes xy and xz. Hund’s rule for maximum multiplicity.
R : d-orbitals have four lobes. 11. A : The radius of 2 nd orbit of He atom
2. A : Electronic configuration of chromium is
!!
[Ar] 3d5 4s1. = "#$!% &#"$' ( .
!
R : Chromium can show +6 oxidation number in
its compound. R : Bohr’s model can be applied to any electron
system.
3. A : We cannot overcome the uncertainty
predicted by Heisenberg’s principle by 12. A : Splitting of spectral line in electric field is
building more precise devices to reduce the called stark effect.
$ R : It is explained by Bohr’s theory.
error in the measurement below the limit.
# 13. A : 4s orbital is more penetrated than 3d orbital.
R : The principle is not due to limitation of the R : Second shell contains 6 orbital.
measuring devices. It is on account of the fact
14. A : A spectral line is not observed for 2px 2py
that subatomic particles cannot be seen even transition for H as both 2p x and 2p y have
under a microscope. same energy.
4. A : All d orbitals are tetralobed structure having
R : A spectral line is observed for 2p x 2p y
two nodal plane. transition for multielectron atoms as both 2px
R : Out of five only four d-orbitals are degenerate and 2py have different energy.
orbitals. 15. A : Isotopes of an element show identical
5. A : The number of spectral line obtained in chemical behaviour.
Lyman Series is zero when electron jumps
from sixth excited state to first excited state in R : Isotopes of an element have same mass
H-atom. numbers.
!" !" !
Chapter 2
Chemical Bonding and
Molecular Structure
7. Select the correct increasing order of dipole
SECTION - A
moment
Objective Type Questions
!" !" !"
1. A chemical bond is possible only if
!#!
(1) The net result is repulsion and the total $ $
(1)
energy of the system increases !#!
(2) The net result is attraction and the total !#!
energy of the system decreases
(3) The net result is attraction and the total !" !" !"
energy of the system increases !#!
(4) All of these (2) $ $
!#!
2. Which of the following compound is most covalent
!#!
in nature?
(1) CaF2 (2) CaCl2
!" !" !"
(3) CaBr2 (4) CaI2 !#!
3. The hybridisation of ‘N’ in N(SiH3)3 is (3) $ $
(1) sp3 (2) sp2
!#!
!#!
(3) sp (4) sp3d
4. NH2–, NH3 and NH4+ do not show similarity in the
!" !" !"
(1) Hybridization state of nitrogen !#!
(2) Atomic number of N (4) $ $
!#!
(3) Number of lone pair of electrons
!#!
(4) Type of orbital overlapping in N – H
8. Which is incorrect regarding dipole moment?
5. Effective overlapping will be shown by
(1) CH2Cl2 > CHCl3
(1) (2) (2) PCl2Br3 = PBr2Cl3
(3) (4) All of these (3) "#! !"#$ $%

6. Which of the following ion shows a bond order of
1.75? !"
(1) !"! (2) !""!

(4) #$%
!
(3) !" "
(4) !"# !
!"
18 Chemical Bonding and Molecular Structure Last Leap for NEET (Part-I)
9. Hypervalent compound is 17. The bond angle in hydrogen bonding of HF is

(1) SO32– (2) NH3 (1) 90° (2) 120°
(3) BeF2 (4) CH4 (3) 109.5° (4) 180°
10. Which of the following shows a change in 18. The hybridisation and shape of ICl 2 – is
hybridisation? respectively
(1) NH3 combines with H+ (1) sp3d linear
(2) AlH3 combines with H– (2) sp3d2 octahedral

(3) sp2 linear
(3) In both (1) & (2)
(4) sp3 linear
(4) H2O combines with H+
19. Which of the following species has highest bond
11. KF combines with HF to form KHF 2 , the
order?
compound contains the species
(1) O2 (2) N2
(1) K+, F– and H+ (2) K+, F– and HF
(3) C2 (4) CO+
(3) K+ and [HF2]– (4) [KHF]+ and F–
20. Which of the following combination of atoms
12. Which are true statements among the following? A and B forms anti-bonding molecular orbital?
(a) PH5 and BiCl5 do not exist
!
(b) p – d bonds are present in SO2 " ! !
(1) ! (2) " #
(c) Electrons travel with speed of light #
(d) SeF4 and CH4 have same shape (3) A + B (4) A – B

(e) I3+ has bent geometry 21. In which of the following molecule lone pair of
(1) a, c (2) a, b, e electrons do not take part in the resonance?
(3) a, c, e (4) a, b, d
13. Select the correct covalent bond character among (1) (2)
the following compounds ! !
(1) LiCl > BeCl2 > BCl3 > CCl4
(2) LiCl < BeCl2 < BCl3 < CCl4 (3) (4) Both (1) & (3)
(3) LiCl > BeCl2 < BCl3 < CCl4 !
(4) LiCl < BeCl2 > BCl3 > CCl4 22. The most stable covalent compound in the
14. Select the compound with highest lattice energy following molecule is
(1) LiCl (2) NaCl (1) BeCl2
(3) KCl (4) RbCl (2) MgCl2
15. Which of the following is correct about bond (3) CaCl2

energy? (4) SrCl2
(1) F2 > Cl2 > I2 > Br2 23. The favourable conditions for the formation of
ionic bond is
(2) Cl2 > F2 > Br2 > I2
(1) Large cation + small anion + low charge on
(3) Cl2 > Br2 > F2 > I2
ions
(4) I2 > Br2 > Cl2 > F2
(2) Large cation + small anion + high charge on
16. The dipole moment of LiH is 5.75 D and its bond ions
length is 1.596 Å. The percentage of ionic (3) Small cation + large anion + low charge on
character in LiH is ions
(1) 90% (2) 20% (4) Small cation + small anion + high charge on
(3) 75% (4) 33.33% ions
Last Leap for NEET (Part-I) Chemical Bonding and Molecular Structure 19
24. Which of the following pair having same bond 30. Maximum bond angle has been found in
order?
(1) NH3 (2) PH3
(1) B2 and C2 (2) C2 and O2
(3) AsH3 (4) SbH3
(3) N2 and O2 (4) !! and O3 31. The hybridisation of the star marked carbon in the
25. The molecule with zero dipole moment is !

compound is
(1) CH2Cl2 (2) PCl3Br2
!"#! (1) sp (2) sp2

(3) sp3 (4) dsp2
(3) PCl2Br3 (4)
32. Which of the following represent positive overlap,
!"#! negative overlap and zero overlap respectively?
26. The correct decreasing order of bond angles of
! ! ! !
!
!" " # !" " and NO2 is (1) !
" "
(1) !" " !" " !" " (2) !" " !" " !" "
(3) !" " (4) !" " !

!" " !" " !" " !" "
(2) " " ! !
27. The expected order of the strength of -bond is
! !
(1) p – p > p – s > s – s
(2) s – s > p – p > p – s
! !
(3) s – s > p – s > p – p
(3) !
(4) p – s > s – s > p – p " "
28. Overlapping of orbital that does not produce bond
is (Assume z is the internuclear axis)
(1) pz – pz (2) s – pz !
(3) s – s (4) px – px (4) ! " ! "
29. Which of the following molecules shows maximum
dipole moment?
33. The correct statement is
!"
(1) Fe3+ ion has greater polarizing power than Fe2+
!"
ion
(1)
(2) The maximum number of covalent bond
formed between two atoms can be greater
!" than three
(3) The acidic nature order of boron halides is in
(2) the order BI3 > BBr3 > BCl3 > BF3
!" (4) All of these
34. Which of the following set have same bond order
!" value?
(1) CO, CN– and NO+
(3)
(2) CN–, CO+ and N2
!" (3) NO–, CO and CN–
!
(4) All have the same values (4) N2, !" " and CN–
35. The ratio of percentage of ‘p’ and ‘d ’ character in 41. In the conversion of N2 into N2+ the electron will be
the hybrid orbital of central atom in a molecule is lost from which of the following molecular orbital?
3 : 1. The hybridisation of central atom may be (1) *2p (2) 2pz
z
(1) sp3d 2 (2) sp3d (3) 2px (4) *2p
x
(3) sp3d 3 (4) sp3 42. Which of the following is correct statement?
36. Hybridisation of nitrogen I and II in the following (1) The bond present in KCl is non-directional
compound is
(2) The bond angle of I3– is more than H2O
(3) NH4Cl contains ionic as well as covalent bonds
! (4) All of these
! " 43. The increasing order of dipole moments for
## #
%" $ # $$"# !" $
(1) sp2, sp3 (2) sp, sp2 #&! #%! #"!
is
(3) sp2, sp2 (4) sp2, sp (1) z < x < y (2) z < y < x
37. The d orbitals involved in the hybridisation of (3) y < z < x (4) z < y x
central atom in XeOF4 molecule is
44. In P 4 molecule phosphorus atoms are
(1) ! # ! ! ! !" (2) ! # ! and ! " ! !!
tetrahedrally arranged. The bond angle in the
molecule is
(3) dxy, dyz (4) ! " ! !!
and dxy (1) 108° (2) 120°
(3) 60° (4) 180°
38. If the dipole moment of C–Cl bond is 1.2 D, then
the resulting value of dipole moment in 45. Which of the following combination of orbitals are
associated with the lowest bond energy?
!" !" (1) sp3-s (2) sp3-sp2
!"
and are (3) sp2-s (4) sp3-sp3
!" 46. The hybridization of P in solid PCl5 is
(1) 1.2 D and 0.6 D respectively (1) sp3d (2) sp3 & sp3d2
(2) 0.6 D and 1.2 D respectively (3) sp3 & sp (4) sp2 & sp3d2
(3) Less than 1.2 D and more than 1.2 D 47. Which of the following combinations gives the
respectively probability of finding of electrons in anti-bonding
(4) 1.2 D and more than 1.2 D respectively molecular orbitals?
(1) 2 + 2
39. A molecule which contains same number of sigma A B
(2) 2 – 2
and bonds is A B
(3) 2 + 2 + 2
(1) HNO2 (2) HCN A B A B
(4) 2 + 2 – 2
(3) (CN)2 (4) C2 A B A B
40. When two isomeric aromatic liquid compounds A 48. Which of the following molecular orbitals contains
and B having hydrogen bond, are heated. maximum number of nodal planes?
Compound A boils at lower temperature than B. (1) (2)
!
2s "!
Which statement is correct?
!
(1) Intermolecular H bonding present in A (3) ! !! (4) " !!
(2) Intramolecular H bonding present in A and B 49. In CO+ the highest occupied molecular orbital is
both !
(1) ! !" (2) "!
(3) Intramolecular H bonding present in B
!
(4) Intramolecular H bonding present in A (3) " !! (4) ! !!
50. In which of the following exp > theoretical? 57. The correct order of bond length of N–H in NH3
and bond length of N–F in NF3 is
"# !"!
(1) N–H = N–F (2) N–F < N–H
! !"!
(1) (2) (3) N–F > N–H (4) N–H <<< N–F
58. Cu2Cl2 is more covalent than CuCl2. This can be
justified on the basis of
!" !"!
!" (1) VSEPR theory (2) Hybridization
(3) (4)
(3) Fajan’s rule (4) Hydration energy
!"! 59. The geometry of the molecule having 20%
s-character in hybrid orbitals of central atom will
" ! be
51. In !"!!##" both the carbon atoms are present
(1) Trigonal planar (2) Square planar
in _______ and _______ hybrid state respectively
(3) Trigonal bipyramidal (4) Square bipyramidal
(1) sp, sp2 (2) sp2, sp3
60. The pair of molecules having same structure is
(3) sp2, sp2 (4) sp3, sp3
(1) ICl2+, I3– (2) ICl4+, SF4
52. C2 exist in vapour phase. Which type of bonds are
(3) CO2, SO2 (4) BCl3, PCl3
present in C2 molecule?
! !
61. The total number of nodes in " !" and " !!
(1) One and one bond
orbitals will be respectively
(2) One and three bond
(1) 0 and 1 (2) 1 and 1
(3) Two bonds
(3) 1 and 2 (4) 2 and 1
(4) Two bonds
62. Which of the following has zero dipole moment?
53. The minimum angle around the central atom is
present in (1) PCl2Br3 (2) PBr2Cl3
(3) CHCl3 (4) CH3Cl
(1) O 3 (2) I3 –
63. The geometry of XeO 2 F 2 and XeF 4 are
(3) NO2– (4) H2S
respectively
54. A diatomic molecule has a dipole moment of
(1) See-saw and square planar
1.2 D. If its bond length is 1.0 Å, what fraction of
an electronic charge, exist on each atom? (2) Square pyramidal and see-saw
(1) 12% of e (2) 18% of e (3) See-saw and see-saw
(3) 25% of e (4) 29% of e (4) Tetrahedral and tetrahedral
55. Which of the following sequence represents the 64. Which among the following is diamagnetic?
increasing order of polarising power of the (1) NO (2) NO2
cations?
(3) ClO2 (4) ClO2–
( # &' # # $%# # !" # 65. Of the following molecules SF4, XeF4, CF4 which
! !! !!! !"
has square planer geometry?
(1) IV < I < II < III (2) I < IV < II < III (1) SF4 (2) XeF4
(3) I < II < III < IV (4) III < I < II < IV (3) CF4 (4) All of these
56. In which of the following reaction hybrid state of 66. The correct order of increasing dipole moment is
central atom changes? (1) CF4 < NH3 < NF3 < H2O
!""# !! " (2) CF4 < NH3 < H2O < NF3
(1) !$ "#$% (2) !"# #$%
(3) CF4 < NF3 < H2O < NH3
!! " !! "
(3) !"## $#% (4) !"## $#%
(4) CF4 < NF3 < NH3 < H2O
67. XeO 2 F 2 molecule has sp 3 d hybridisation 75. Which of the following contains maximum number
containing one lone pair. For most stable structure of covalent bonds?
the two fluorine atoms should be present at (1) 2.8 g C2H4
(1) Equatorial position only (2) 3 g C2H6
(2) Axial position only (3) 2.6 g C2H2
(3) One fluorine at axial and other fluorine atom at (4) Same in all of these
equatorial position
76. The number of bond angles equal to 90º in IF7
(4) Unpredictable molecule are
68. The number of 90º and 180º angles found in sp3d2 (1) 5 (2) 2
hybridisation respectively are (3) 10 (4) 14
(1) 6, 3 (2) 8, 4 77. Pair of iso-structural molecules among following is
(3) 8, 3 (4) 12, 3 (1) CO2 and SO2
69. Which of the following pair have different bond (2) BF3 and NF3
order?
(3) ClO3– and NH3
(1) N2, CO (2) & ! , N2 (4) XeF4 and SF4
78. In the formation of CO+ from CO, one electron is
(3) C2, O2 (4) #" " ! "! ! removed from
70. The shape of XeO2F2 molecule is (1) ! $! (2) !! !
!
(1) Square pyramidal
(2) Trigonal bipyramidal (3) ! !! (4) !
!!
(3) See-Saw 79. Which type of bond is not present in HNO 3

(4) Octahedral molecule?
71. Which of the following molecule is having a net (1) Covalent (2) Ionic
dipole moment? (3) Dative (4) p — p
(1) XeF4 (2) IF 7 80. The species for which dipole moment is not equal
(3) XeO2F2 (4) XeO4 to zero is
(1) SiF4 (2) XeF4
72. The hybridisation of N in trisilyl amine and Si in SiO2
are (3) !"#! (4) TeCl6
2
(1) sp , sp 2 2
(2) sp , sp d 3 81. In XeF2, XeF4 and XeF6, the number of lone pairs
2 3 3 2
on Xe is respectively
(3) sp , sp (4) sp , sp
(1) 2, 3, 1 (2) 1, 2, 3
73. What is the hybridization of P in solid PBr5 ?
(3) 4, 1, 2 (4) 3, 2, 1
(1) sp3d (2) sp3
82. The number and type of bonds between two
(3) sp3d2 (4) Both (2) & (3) carbon atoms in calcium carbide are
74. The correct sequence of increasing bond angles (1) Two sigma, two pi
among the following molecules is
(2) Two sigma, one pi
I. C2H4 II. NH3
(3) One sigma, two pi
III. SF6 IV. C2H2
(4) One sigma, one pi
(1) III < IV < II < I
83. In which of the following molecules/ions all the
(2) III < II < I < IV bonds around the central atoms are not equal?
(3) IV < I < III < II (1) SF4 (2) SiF4
–
(4) II < I < IV < III (3) XeF4 (4) BF4
84. The type of bonds present in CuSO4 5H2O is/are 91. Which of the following does not apply to
(1) Only co-ordinate resonating structures?
(2) Only covalent and co-ordinate (1) The contributing structures should have much
difference in energies
(3) Covalent, co-ordinate, ionic and H-bonds
(2) The structure having negative charge residing
(4) Only ionic and co-ordinate on less electronegative element is less
85. Carbon dioxide molecule is isostructural with significant.
which of the following? (3) The number of unpaired electrons in different
(1) HgCl2 (2) H2O resonating structures should be equal
(4) Similar charges should not reside on adjacent
(3) SnCl2 (4) !"!
atoms
86. Consider the species !"" , !"! and !"! . Pick 92. Which of the following process involves cleavage
of hydrogen bonds?
up the correct statement
(1) Sublimation of dry ice
(1) The hybrid state of N in all the species is
same (2) Melting of ice
(3) Dissociation of H2 molecules
(2) The shapes of both !"! and !"! is bent
(4) Condensation of ammonia
while !"" is planar
93. Among the species given below, the largest angle
(3) The hybrid state of N in !"" and !"! is around the central atom is in
same (1) I 3– (2) I3+
(4) The hybrid state of N in !"! is sp2 (3) NO2– (4) H2O
87. Of the following sets which one does not contain 94. The bond order of NO molecule is
isoelectronic species? (1) 1.5 (2) 2
(1) BO3 3–, CO32–, NO3 –
(3) 2.5 (4) 3.0
(2) SO32–, CO32–, NO3– 95. In which of the following molecule the dipole
(3) CN–, N2, C22– moment is largest?
(4) PO43–, SO42–, ClO4– (1) CH2Cl2 (2) CHCl3
88. The species amongst the following, having one (3) CCl4 (4) CO2
unpaired electron, is
(1) NO 96. In piperidine, !", the hybrid state of N is
(2) C3O2
(1) sp (2) sp2
(3) CN–
(3) sp3 (4) dsp2
(4) N2
97. Which of the following option is correct?
89. A certain diatomic molecule AB has dipole
moment 1.6 D and the internuclear distance is (1) Bond dissociation energy bond order
100 pm. The fraction of electronic charge existing !
on each atom is "#$% &'$()*
(1) 33% (2) 25%
!
(3) 50% (4) 10% (2) Bond length bond energy "#$% #+%'+
90. The mole of electrons present in 2.6 g of ethyne
(3) Bond length bond energy bond order
is
(1) 0.1 mol (2) 0.2 mol ! !
(4) "#$% &$&'() "#$% &'$()* bond order
(3) 0.3 mol (4) 0.4 mol
98. A diatomic molecule AB has a dipole moment of 104. Which of the following option is true regarding
0.816 debye. If its bond length is 100 pm. then H-bonding?
what percentage of an electronic charge will exist (1) Orthonitrophenol is steam volatile due to
on each atom? intermolecular H-bonding
(1) 83% (2) 37% (2) Alcohols are soluble in water due to
(3) 10% (4) 17% intramolecular hydrogen bonding
99. In order to convert N2 into N2+ the electron will be (3) Ice is lighter than liquid water due to
removed from intermolecular H-bonding
(1) *–orbital (2) –orbital (4) Ether in general form effective H-bonding
(3) –orbital (4) *–orbital 105. Mixing of two or more than two orbital of same
100. Deduce the bond order of NO and CN – , energy level or approximately same and forming a
respectively new orbital is called hybridization and new orbital
is called hybridized orbital. What will be the
(1) 2.5, 3 decreasing order of bond length?
(2) 3, 2.5 (1) sp3 – sp3 > sp2 – sp2 > sp – sp
(3) 2.5, 2.5 (2) sp – sp > sp2 – sp2 > sp3 – sp3
(4) 3, 3 (3) sp3 – sp3 > sp – sp > sp2 – sp2
101. Which of the following sketch for orbital (4) sp – sp > sp3 – sp3 > sp2 – sp2
configuration (considering boundry surface only) is
correct for orbital type * 2px ? 106. Lattice Enthalpy can be easily calculated by
(1) Born-Haber cycle (2) Kirchoff’s law
!
(3) Hess’s law (4) Laplace law
(1)
" 107. The dipole moment of LiH is 1.96 × 10–29 C m and
the inter atomic distance between Li and H in the
molecule is 1.59 Å. The percentage ionic character
! ! in the molecule is
(2) (1) 77% (2) 27%
" "
(3) 50% (4) 19%
! 108. Find the incorrect match

(3) " !
(1) S8 molecule – 16 lone pair
(2) PCl5 molecule – Different bond length
(4) ! "
(3) NO – Odd electron molecule
102. The shape of IO2F2– is (4) ClF3 – Tetrahedral molecule
(1) Linear 109. In which of the following pair hybridisation of
(2) Trigonal bipyramidal central atom are different?
(3) T-shaped (1) NH3, NH4+ (2) BF3, BF4–
(4) Seesaw (3) H2O, H3O+ (4) SO2, SO3
103. Which of the following molecule contains only 110. Which is paramagnetic in nature?
20% d character? (1) B2 (2) C2
(1) CH4 (3) O2 (4) Both (1) & (3)
(2) SO2 111. The molecule which is not of pyramidal shape is
(3) ClF3 (1) NF3 (2) H3O+
(4) CO2 (3) BF3 (4) NH3
112. Which of the following is incorrect match? 120. The hybrid state of C in CO2 is same as in
(1) HCHO
(1) !""! #$%&%'
(2) !""!
(2) !"" !
!" #$%&'()(*+,(-.
(3) Second carbon of propadiene
(3) !" (4) Carbon 3 of propadiene
#$%&'#%(')(#*#+
121. The linear structure is not possessed by
(4) !"#$! %&'()*" (1) SnCl2 (2) C2H2
113. When the species, H 2 O, Cl 2 O and F 2 O are (3) !"! (4) CS2
arranged in order of increasing X–O–X bond
angles, then the correct order is 122. Which of the following is not isostructural with
SiCl4?
(1) F2O < Cl2O < H2O
(1) #"" ! (2) !"" !
(2) F2O < H2O < Cl2O
(3) H2O < F2O < Cl2O (3) !"! (4) ,-&!
(4) H2O < Cl2O < F2O 123. The shape of XeOF 2 , XeO 3 and XeOF 4 is
114. The ratio of bonds in benzene to naphthalene respectively
is (1) Square planar, trigonal pyramidal, square
pyramidal
(1) 1 : 1 (2) 3 : 5
(2) Square pyramidal, trigonal pyramidal, square
(3) 5 : 3 (4) 3 : 2 planar
115. Among the following, the compound having (3) T-shaped, pyramidal, square pyramidal
highest lattice energy is (4) Square planar, T-shaped, pentagonal
(1) CaF2 (2) BeF2 pyramidal
124. In blue vitriol, the number of H2O molecule forming
(3) MgF2 (4) SrF2
H-bond is
116. Which of the following species is diamagnetic (1) 5 (2) 4
in nature?
(3) 2 (4) 1
(1) H2+ (2) O2 125. Which of the following is the correct order of dipole
(3) N2 + (4) CO moment?
!" !" !"
117. Which is not the correct order of dipole moment ?
#!!
(1) HF > HCl > HBr > HI (1) > >
(2) PCl3F2 < PF3Cl2 #!!
(3) CHCl3 < CH2Cl2 < CH3Cl #!!
!" !" !"
(4) CH3F > CH3Cl
#!!
118. Name the different bonds present in calcium (2) > >
carbide #!!
(1) Ionic bond only #!!
!" !" !"
(2) Covalent bond only
#!!
(3) Both ionic and covalent bond (3) > >
(4) Neither ionic nor covalent #!!
119. The correct order of hybridization of central atom #!!
in the following species NH3, [PtCl4]2–, PCl5, BCl3 !" !" !"
is respectively #!!
(4) > >
(1) sp3, dsp3, sp2, dsp2 (2) sp3, dsp2, sp3d, sp2
#!!
(3) dsp2, sp2, sp3, dsp3 (4) dsp2, sp3, sp2, dsp3 #!!
126. Identify the false statement

(1) Bond length in H2+ is longer than that in H2 133. The hybridisation of N-atom in is
(2) A -molecular orbital forms weaker bond than a !
-molecular orbital
(1) sp3d (2) sp3d2
(3) H2+ and H2– are diamagnetic
(3) sp3 (4) sp2
(4) The number of electrons in antibonding
molecular orbitals of N22– is six 134. Which of the following pair is having same bond
order?
127. Polarizing power is given by expression
(1) NO+ & CO+ (2) CN– & NO+
!
!"#$%& ! !"#$%& " (3) N2 & CO+ (4) NO+ & O2
(1) ! (2) # $
$ % $ & 135. The relative strength of bonds follows the order
(1) 2p – 2p > 2p – 3d > 2p – 3p
.*/+(' !"#$%&'( !
(3) (4) (2) 2p – 2p > 2p – 3p > 2p – 3d
+ %
(3) 2p – 3d > 2p – 2p > 2p – 3p
128. Which of the following is a set of isoelectronic
(4) 2p – 3d > 2p – 3p > 2p – 2p
species?
136. The formal charge on C-atom in !""!
(1) CO, N2, CN– (2) N2, "# , NO
molecule is
!
(3) CO, CN–, !! (4) !"! , N2O, O3 (1) +4 (2) –2
(3) +5 (4) Zero
129. In the formation of !! molecule, the extra electron
enters into 137. Which of the following has maximum number of
lone pairs on central atom?
! !
(1) "#! (2) "# !
(1) XeO3 (2) XeO4
(3) (4) ! (3) XeO2F2 (4) XeF2

!" ! "# !
138. Which of the following is a true statement?
130. In which of the following pair trans isomer has
(1) Bond order of N2 and CO are same
higher dipole moment than cis isomer?
(1) Trans-1-chloropropene and cis-1- (2) With increase in bond order bond length also
chloropropene increase
(2) Trans-1,2-dichloroethene and cis-1,2- (3) In !"! covalency of N = 3

dichloroethene
(4) All of these
(3) Trans-but-2-ene and cis-but-2-ene
139. Which of the following is paramagnetic according
(4) All of these to molecular orbital theory?
(1) O2 (2) KO2
131. The hybridisation of carbon atom in CF4 and #$!
respectively is (3) NO (4) All of these
(1) sp2, sp2 140. Correct sequence of indicated property is
(2) sp3, sp3 (1) O2 > O2– > O22– (Bond order )
(3) sp2, sp3 (2) O22+ > O2+ > O2 (Bond energy)
(4) sp3, sp2 (3) C – C > C = C > C C (Bond length)
132. Which of the following molecules contain only (4) All of these
bond? 141. Incorrect matching of hybridisation is
(1) N2 (2) O2 (1) Diamond (sp3) (2) XeO3 (sp3)
(3) C2 (4) CO (3) XeO4 (sp3) (4) XeF2 (sp)
142. Which of the following has maximum dipole 148. Correct match in the following is
moment? (1) CO2 – Zero dipole moment
!"! (2) XeF2 – 3 lone pair
(1) PCl3F2 (2)
(3) 1!! – Bond order 3
!"!
(4) All of these
(3) NH3 (4) NF3
149. Correct match in the following is
143. Find out the correct statement
(1) PCl5 – Trigonal planar geometry
(1) Boiling point of HF is greater than H2O, as F
(2) SF4 – CH4 like geometry
is more electronegative than oxygen
(2) Bond angle of PH3 is greater than NH3, as (3) !"! – Tetrahedral geometry
lone pair-bond pair repulsion is less than
lone pair-lone pair repulsion (4) ClF3 – sp2 hybridisation of Cl
(3) o-nitrophenol has lower boiling point than 150. The hybridisation of HgCl 2 and H 3 O + is
p-nitrophenol respectively
(1) sp3, sp3 (2) sp, sp2
! " ! "
(4) Strength of ! " ### ! bond is less than (3) sp, sp3 (4) sp2, sp2
! " ! "
! " ### ! bond 151. The total number of 90º bond angle in PCl5 and
SF6 is respectively
144. Which of the following is mismatch regarding
shape? (1) 2, 4 (2) 2, 6
(1) XeF4 – Octahedral (3) 6, 6 (4) 6, 12
(2) PCl3 – Trigonal planar 152. The d-orbital involved in the structure of ClF3 is
(3) SO2 – Linear (1) dxy (2) !

!! " !
(4) All of these (3) ! (4) dyz

!!
145. For CO+, which is incorrect? 153. When there is subtractive overlapping between
2pz atomic orbitals, the total number of nodes
(1) It is isoelectronic with 0!
present in the molecular orbital formed is
(consider z is the internuclear axis)
(2) It is paramagnetic in nature like 0!
(1) 0 (2) 1
(3) Its bond order is same as that of 0!
(3) 2 (4) Can’t be predicted
(4) Both (2) & (3)
154. During overlapping of atomic orbitals, which of the
146. Which is correct for carbonate ion? following will result in zero overlap? (consider z as
(1) Formal charge on carbon is –1 the internuclear axis)
! (1) s – px (2) px – py
(2) Its bond order is
" (3) py – s (4) All of these
(3) Its shape is pyramidal 155. According to valence bond theory, total number of
(4) Covalency of carbon is 2 attractive and repulsive forces resulted in the
formation of H2 from hydrogen atom is respectively
147. Which one of the following does not have H-
bonding? (1) 2, 1 (2) 2, 2
(1) Phenol (3) 4, 2 (4) 5, 4
(2) Liquid NH3 156. The incorrect order of polarity is shown by
(3) Water (1) H2O > H2S (2) NH3 > H2O
(4) HCl (3) NH3 > NF3 (4) PF3Cl2 > PCl3F2
157. The intermolecular forces that is present when 165. The different types of bonds present in
sodium chloride dissolves in water and when ammonium chloride is
oxygen gas present in water is respectively (1) Ionic bond (2) Covalent bond
(1) Dipole - dipole interaction, hydrogen - bonding
(3) Coordinate bond (4) All of these
(2) Ion - dipole interaction, hydrogen - bonding
166. Carbon atoms in C2(CN)4 are
(3) Dipole - dipole interaction, dipole-induced
dipole interaction (1) sp-hybridized
(4) Ion - dipole interaction, dipole-induced dipole (2) sp2-hybridised
interaction (3) sp and sp2 hybridised
158. Total number of sigma, pi bonds, lone pair of
(4) sp, sp2 and sp 3 hybridised
electron present in urea is
167. According to M.O.T. for O2+
(1) 6 ,1 , 3lp (2) 8 , 0 , 3lp
(3) 7 , 1 , 5lp (4) 7 , 1 , 4lp (1) B.O. is less than that of O 2 and O 2+ is
paramagnetic
159. To explain the carbon - oxygen bond length in
case of carbon dioxide, out of the following (2) B.O. is more than that of O 2 and O 2+ is
structures, which structure is used as contributing paramagnetic
structure? (3) B.O. is less than that of O 2 and O 2+ is
diamagnetic
A. ! " ! B. ! " !
(4) B.O. is more than that of O 2 and O 2+ is
C. diamagnetic
" ! "
168. The cyanide ion, CN– and N2 are isoelectronic but
(1) A only (2) B & C only
in contrast to CN–, N2 is almost inert, because of
(3) A & B only (4) A, B & C
(1) Low bond energy
160. S.I. unit of dipole moment is
(2) Absence of bond polarity
(1) debye (2) Cm
(3) esu-cm (4) All of these (3) Unsymmetrical electron distribution
(4) Presence of more number of electron in
!
bonding orbitals
161. Formal charge on nitrogen in !"#"$ is
! 169. The hydration of ionic compound involves
(1) 0 (2) +1 (1) Evolution of heat
(3) –1 (4) +2 (2) Weakening of attractive forces in ionic
162. Total number of shared electron around central compound
atom in sulphuric acid in Lewis structure is (3) Association into ions with water
(1) 2 (2) 4 (4) All of these
(3) 6 (4) 12
170. Which of the following does not have pyramidal
163. Correct order of bond length is shown shape?
(1) !! !! !! !!! (2) !!! !! !! !! (1) !""! (2) !"!
(3) !!! !! !! !! (4) !! !! !! !!! (3) NH3 (4) !"!
164. The enthalpies of hydrogen bond in most !

171. Number of nodes present in ! !! antibonding
instances is given by
(1) 500 – 1000 kJ/mol molecular orbital is (consider z as the internuclear
axis)
(2) 100 – 500 kJ/mol
(3) 20 – 30 kJ/mol (1) 0 (2) 1
(4) 5 – 10 J/mol (3) 2 (4) 3
172. Identify the correct order of solubility of NiS, CuS
!"
and ZnS in aqueous medium
(1) CuS > ZnS > NiS (2) ZnS > NiS > CuS 179. The dipole moment of is 0. The dipole
(3) NiS > CuS > ZnS (4) NiS > ZnS > CuS
moment of
173. Among KO 2 , !"#! , BaO 2 and !"! , unpaired
electron is present in
!"
(1) !"! and BaO2 (2) KO2 and !"#! !" !"
(1) is 6 0
(3) KO2 only (4) BaO2 only
!" !"
174. Which of the following hydrogen bond (shown by !"
dotted line) has highest average bond energy?
(1) F – H - - - - - F (2) F – H - - - - - O
!"
(3) O – H - - - - - O (4) O – H - - - - - S !"
! !
175. The molecular shapes of SF4, CF4 and XeF4 are (2) is
"
(1) The same with 2, 0 and 1 lone pair of !"
electrons on the central atom respectively !"
(2) The same with 1, 1 and 1 lone pair of
electrons on the central atoms respectively !"
(3) Different with 0, 1 and 2 lone pairs of !"
electrons on the central atom respectively (3) is 0
(4) Different with 1, 0 and 2 lone pairs of !" !"

electrons on the central atom respectively
176. The states of hybridisation of boron and oxygen !"
atoms in H3BO3 are respectively
!
(4) is
(1) sp2 and sp2 !
!" !"
(2) sp2 and sp3
(3) sp3 and sp2 180. In which one of the following triplets, all the
members are diamagnetic?
(4) sp3 and sp3
(1) B2, CO, NO+
177. The arrangement of electron pairs around central
atom in !"#! ion is (2) Cu+, !!! , O2
(1) Trigonal
(2) Tetrahedral (3) !!! " #!! , NO–
(3) Square planar

(4) O3, !!! , N2O
(4) Trigonal bipyramidal
181. The Xenon compound(s) that are isostructural
178. The percentage ionic character of a bond having
1.275 Å bond length and 1.03 D dipole moment with !"#! and !"#! respectively are
is
(1) Linear XeF2 and pyramidal XeO3
(1) 10%
(2) Bent XeF2 and pyramidal XeO3
(2) 15%
(3) 16.83% (3) Bent XeF2 and planar XeO3
(4) 18.8% (4) Linear XeF2 and square planar XeO3
182. Consider the Born-Haber cycle for the formation 188. Which of the following is correct about XeOF4?
of an ionic compound given below and identify the (1) sp3d2 hybridisation
compound (Z) formed.
(2) Zero polarity
(3) Square planar shape
!! !"
!!"# !!$# !%!$# (4) Contain only bond
!%
%
# " !# !$ 189. Which gets stabilization by removal of electron?
"!$# "'!$#
$ &!$# (1) O2 (2) N2
(3) H2 (4) H2+
(1) MX (s) (2) M+X– (g) 190. The correct order of strength of H-bond in the
following compound is
(3) M+ X – (l) (4) M – X – (g)
(1) HF > H2O > H2O2 > H2S
183. The lattice enthalpy and hydration enthalpy of four
(2) HF > H2O2 > H2O > H2S
compounds are given below
(3) H2O > H2O2 > HF > H2S
Compound Hydration Lattice
enthalpy enthalpy (4) HF > H2O > H2S > H2O2
P +780 –920 191. The maximum number of hydrogen bonds that

can be formed by one molecule of H2O
Q +1012 –812
(1) 1 (2) 2
R +828 –878
(3) 3 (4) 4
S +632 –600
192. Intramolecular hydrogen bonding is formed in
The pair of compound which is soluble in water is
(1) Salicylaldehyde (2) Water
(1) P and R (2) P and Q
(3) Acetaldehyde (4) Phenol
(3) R and S (4) Q and S
193. Which of the following have both polar and non-
184. In which of the halides, there is maximum polar bonds?
polarisation?
(1) C2H6 (2) NH4Cl
(1) AlF3 (2) AlCl3 (3) HCl (4) AlCl3
(3) AlBr3 (4) AlI3 194. XeF2 involves hybridisation
185. The correct order of decreasing polarity is (1) sp3 (2) sp3d
(1) NH3 > H2O > HF (2) HF > H2O > NH3 (3) sp3d2 (4) sp2
(3) HF > NH3 > H2O (4) H2O > NH3 > HF 195. Which of the following is in the increasing order
of the ionic character?
186. Anhydrous AlCl3 is covalent but AlCl3. 6H2O is
ionic because (1) PbCl4 < PbCl2 < CaCl2 < NaCl
(1) AlCl3 has a planar triangular structure (2) PbCl2 < PbCl4 < CaCl2 < NaCl
(2) The ionisation energy of Al is very low (3) PbCl2 < PbCl4 < NaCl < CaCl2
(3) The hydration energy of AlCl3 is very low (4) PbCl4 < PbCl2 < NaCl < CaCl2
(4) The hydration energy of AlCl3 compensates 196. Which has the least bond angle?
for the high ionisation energy of Aluminium (1) NH3 (2) H2O
187. Among LiCl, BeCl 2 , MgCl 2 and RbCl the (3) BeF2 (4) CH4
compounds with greatest and least ionic character 197. Number of 90º and 180º angles in SF 6
respectively are respectively are
(1) LiCl and RbCl (2) RbCl and BeCl2 (1) 12 and 3 (2) 6 and 3
(3) RbCl and MgCl2 (4) MgCl2 and BeCl2 (3) 12 and 2 (4) 6 and 2
207. Intramolecular H-bonding is absent in
198. Bond order of !! and CO+ are respectively
(1) o-methylbenzaldehyde
(1) 2.5 and 2.5 (2) 3 and 2.5
(2) p-methoxybenzaldehyde
(3) 3.5 and 2.5 (4) 2.5 and 3.5
(3) Water
199. Which of the following pair contains isoelectronic
(4) All of these
and isostructural ions?
208. Which of the following compound has lowest
(1) NO3–, CO32– (2) ClO4–, NO3– melting point?
(3) ClO3–, CO32– (4) CO32–, ClO4– (1) RbCl (2) RbF
200. d orbital involved in hybridisation of SF4 is (3) RbI (4) RbBr
(1) dxy (2) dyz 209. Identify the incorrect statement
(1) In ClF 3 molecule, lone pairs occupy axial
(3) ! ! ! "! (4) ! ! !
positions
201. In BrF3 molecule, the lone pair occupy equatorial (2) In I3–, bond pairs occupy equatorial positions
position to minimize
(3) In IF7, only one type of bond angle is present
(1) Lone pair - bond pair repulsion only (4) All are incorrect
(2) Bond pair - bond pair repulsion only 210. The species not having all the bonds identical is
(3) Lone pair - lone pair repulsion and (1) SiF4 (2) CO2
lone pair - bond pair repulsion
(3) BF3 (4) PCl5
(4) Lone pair - lone pair repulsion
211. Highest lattice energy is shown by
202. The hybridisation of carbon in diamond, graphite (1) BeCl2 (2) BaCl2
and fullerene is respectively
(3) MgCl2 (4) CaCl2
(1) sp3, sp3 and sp3 (2) sp2, sp3 and sp3
212. The maximum bond angle is present in
(3) sp3, sp2 and sp2 (4) sp2, sp2 and sp2
(1) NH3 (2) PCl3
203. Among the following groups, which represents the
(3) CH4 (4) CO2
collection of isoelectronic species?
213. The correct order of increasing polarising power
(1) NO+, C22–, O2–, CO (2) N2, C22–, CO, NO is
(3) CO, NO+, CN–, C22– (4) NO, CN–, N2, O2– (1) Cs+, Rb+, Na+, K+
204. The pair of species having identical shape is (2) Be2+, Mg2+, Ca2+, Sr2+
(1) NH3, BF3 (2) CO2, SO2 (3) Ba2+, Sr2+, Ca2+, Mg2+
(3) SO3, BrF3 (4) H2O, H2S (4) Li+, Na+, K+, Rb+
205. The hybridization of phosphorus in H 3PO4 and 214. The fraction of s-character in the orbitals forming
H3PO3 respectively is S-S bond in S8 is
(1) sp3, sp3 ! #
(1) (2)
(2) sp3, sp2 " !
(3) sp2, sp ! #
(3) (4)
(4) sp2, sp3d " $
215. Which of the following pair has same bond order?
206. Hybridization of nitrogen in pyrrole is (1) O22– and F2 (2) F2 and B2

$$
! (3) B2 and O22– (4) All of these
"
# 216. In which of the following species the hybridization
of central atom is not same like other species?
(1) sp3 (2) sp
(1) H3O+ (2) NH4+
(3) sp2 (4) sp3d (3) PCl3 (4) C2H4
217. Which of the following is correct statement 223. In the Lewis structure of acetic acid, CH3COOH,
regarding PCl5? the bonding pairs and lone pairs of electrons
(1) Hybridisation of P-atom is sp3d in gaseous present are respectively.
state (1) 7, 2 (2) 6, 4
(2) All P-Cl bonds are having same bond length (3) 8, 4 (4) 5, 3
in gaseous state of PCl5
(3) Coordination number of P-atom is 5 in solid
PCl5 (1) Ionic compounds are good conductor in
molten state
(4) All of these
(2) Rate of ionic reactions are very slow
218. The correct order of stability is
(3) Covalent bond is rigid and directional
(1) !! !! !! !! !!
(4) Ionic compounds have high m.p. and b.p.
(2) !! !! !! !! !! 225. Which of the following pair is having same

hybridisation?
(3) !! !! !! !! !! (1) SF4 and SnCl4 (2) CO2 and SO2
(4) !! !! !! !! !! (3) !! and !! (4) !! and PCl5
219. (i) AlF3 226. The bonding present between CH3OH molecules
(ii) Al2O3 are
(iii) AlN (1) Dipole-dipole

The correct increasing order of lattice energy of (2) H-bonding
the above compounds is (3) London forces
(1) (i) < (ii) < (iii) (2) (iii) < (ii) < (i)
(4) Ion-dipole
(3) (ii) < (i) < (iii) (4) (iii) < (i) < (ii)
227. Which combination is best explained by the
220. Higher covalent character in ionic bond is coordinate covalent bond?
favoured by
(1) H2 + I2
(1) Large cation + small anion + low charge on ions
!
(2) Small cation + small anion + high charge on (2) "# $!
%
ions
(3) Large cation + large anion + low charge on (3) -& -&
ions
(4) ! !!"
(4) Small cation + large anion + high charge on
ions 228. Which of the following has fractional bond order?
221. Which of the following are having same shape?
(1) "!! (2) "!!
(1) CO2 and SO2 (2) SO2 and !"!
(3) !! ! (4) $!
(3) CO2 and !"! (4) All of these
229. Which are isostructural species?
222. In which molecule does the chlorine have the
most positive partial charge? (1) !"! #$%&#!"!
(1) SCl2 (2) CO2 and NH3

(2) OCl2
(3) !"#$ ! %&"'%#$(!
(3) HCl
(4) BrCl (4) 2&-&! 3/$%3,1"
230. In which of the following, weakest hydrogen (iii) Resonance hybrid of a compound cannot be
bonding is present ? depicted by a single Lewis structure.
(1) H2O (2) HF Choose the correct statement(s)
(3) CH3OH (4) NH3 (1) Only (i) (2) (i) & (ii)
231. Which of the following is the correct order of (3) (ii) & (iii) (4) (i) & (iii)
dipole moments? 239. Choose the incorrect statement
(1) BF3 > NH3 > NF3 (2) NH3 > NF3 > BF3 (1) The bond order of C2 is 2
(3) NH3 > BF3 > NF3 (4) NF3 > NH3 > BF3 (2) C2 is diamagnetic molecule
232. In which of the following reaction hybrid state of (3) Double bond of C2 consists of one and one
underlined atom is changed in the product? -bonds
(1) ,1" 4"1 (2) 04! 4"1 (4) 4 electrons are present in two -MO in C2
240. Which of the following has maximum triple bond
(3) ! "#! $%"& (4) Both (1) & (3) energy?
233. The shape of CH3NCS is (1) N N (2) C O
(1) Trigonal pyramidal (2) Trigonal Planar (3) C C (4) C N
(3) Linear (4) Bent

SECTION - B
234. Which of the molecule is non-polar?
(1) PCl3Br2 (2) PCl3F2
(3) XeO2F2 (4) All of these (A) is followed by a statement of reason (R)
235. The given orbital is (consider z as the internuclear (1) If both Assertion & Reason are true and the
axis) reason is the correct explanation of the
assertion, then mark (1).
! " (2) If both Assertion & Reason are true but the
reason is not the correct explanation of the
" ! assertion, then mark (2).
(3) If Assertion is true statement but Reason is
(1) (2) ! false, then mark (3).
! !! " !!
(4) If both Assertion and Reason are false
! statements, then mark (4).
(3) ! !! (4) " !!
1. A : The melting point of NaCl is more than LiCl.
! R : LiCl is more covalent than NaCl.
""
236. The formal charge over ‘Cl’ atom in # is 2. A : PCl2Br3 has zero dipole moment.
$% $% R : PBr2Cl3 has non zero dipole moment.
3. A : BF3 is non-polar molecule.
(1) +1 (2) +3
R : BF3 behave as a Lewis base.
(3) 0 (4) –1
4. A : Bond order of CO+ is more than CO.
237. Which of the following is having highest dipole-
R : Bond order of !! is also 3.5 because CO+
moment ( )?
(1) CH3Cl (2) CH2Cl2 and !! are isoelectronic.
(3) CHCl3 (4) CCl4 5. A : NaNO3 is an ionic compound.

R : There is no covalent bond in NaNO3.
238. Consider the following statements about
resonance: 6. A : The order of lattice energy of lithium halide is
LiF > LiCl > LiBr > LiI
(i) The canonical forms have no real existence.
R : Smaller the size of cation more will be
(ii) There is equilibrium between the canonical polarising power and more ionic nature of
forms. bond formed by cation.
7. A : The hybridisation of PCl5 is sp3d. 15. A : Bond angle in PF3 is less than that of PCl3.
R : PCl5 consists of three equatorial bonds and R : Lone pair - bond pair repulsion is greater than
two axial bonds. bond pair-bond pair repulsion.
8. A : N(CH3)3 is pyramidal but N(SiH3)3 is planar.
16. A : Ionic compounds are generally soluble in
R : Hybrid state of nitrogen in both the polar solvents.
compounds is sp3.
R : Ionic compounds are directional in nature.
9. A : The melting point of CaO is higher than NaCl.
17. A : Order of ionic character of chlorides is
R : NaCl is 100% pure ionic compound while
NaCl > MgCl2 > AlCl3.
CaO is 20% covalent.
10. A : Both H2O and SO2 having same shape. R : Higher is the charge on the cation, lesser will
be the ionic character.
R : Central atom in H 2 O and SO 2 are sp 3
hybridised. 18. A : In solid PCl5 hybridisation of P is sp3 and
11. A : N(SiH3)3 is weaker base than N(CH3)3. sp3d2 both.
R : N(SiH3)3 and N(CH3)3 do not have any p – R : In solid state PCl 5 exist in ionic form as
d bond. [PCl4]+[PCl6]–.
12. A : Lattice energy is the energy required to 19. A : KHF2 exists but KHCl2 does not exist.
separate 1 mole of solid ionic substance
R : F is smaller in size than Cl.
completely into gaseous ions.
20. A : Hybridisation of central atoms in both NH3 and
R : Higher the lattice energy more is the stability
of ionic compound. H2O is sp3.
13. A : 3d and 4d can easily undergo hybridisation R : N has 1 lone pair electron and O has 2 lone
among themselves. pair electron in NH3 and H2O respectively.
R : Hybridisation is mixing of atomic orbitals having
21. A : !" and !! have same bond-order.
large difference in energies.
14. A : PCl3F2 has zero dipole moment. R : CO+ has 15 electrons whereas !! has 13
R : F-atom is present at axial position. electrons.
!"!"!
Chapter 3
Equilibrium
(1) Favour backward reaction
SECTION - A
(2) Favour forward reaction
(3) Increases the reaction rate
1. !!!
"
For the equilibrium, !" #!!
! ! " at 300 K. The (4) Has no effect
!"# !"# !"#
pressure at which 50% of PQ is dissociated is 6. The pure water has [H3O+] = 10–6 M at 90°C. The
numerically equal to value of pKw at the same temperature is
(1) 3 Kp (2) 4 Kp (1) 6 (2) 14
(3) Kp (4) Can’t be predicted (3) 10–14 (4) 12
2. Kc for PCl5(g) #!!!!!" 7. 0.40 g of NaOH was added to one litre of a buffer
! PCl3(g) + Cl2(g) is 0.04 at
solution. Its buffer capacity is found to be 0.06, its
25°C. The number of moles of PCl5 required to a
pH change will be
3.0 litre flask to obtain Cl2 of concentration 0.15 M
is (1) 0.33 (2) 0.17
(1) 1.5 mole (2) 2.1 mole (3) 1.0 (4) 0.01
(3) 6.0 mole (4) 0.45 mole 8. Calculate the degree of hydrolysis of salt which is
!
3. Which of the following is correct for the reaction? prepared by the mixing of 10 ml, acetic acid
"#
!!!
"
N2(g) + 3H2(g) #!!
! 2NH3(g) !
and 10 ml of NaOH solution. [Ka of CH3COOH
"#
(1) Kp = Kc = 10–5]
(2) Kp < Kc (1) 4.4 × 10–9 (2) 10–7
(3) Kp > Kc (3) 1.4 × 10–4 (4) 1.69 × 103
(4) Pressure is required to predict the correlation
9. The solubility product of chalk is 9.3 × 10 –8 .
4. What will be effect on the state of equilibrium for Solubility of chalk in g/L is
!!!
"
the following reaction H2(g) + I2(g) #!!
! 2HI(g) at (1) 3.5 × 103 (2) 1.6 × 10–5
250°C, on doubling the volume of the system?
(3) 9.1 × 102 (4) 3.05 × 10–2
(1) Shift to reactant side
10. Which of the following is correct about buffer
(2) Shift to product side solution?
(3) No effect on state of equilibrium (1) Its pH does not change on standing for long
(4) Liquefication of HI time
5. Density of diamond and graphite are 2.5 and (2) Its pH does not change on dilution
1.3 g/ml respectively. With decrease in pressure
(3) pH is slightly changed by the addition of small
equilibrium will
quantity of an acid or a base
!!!
"
Cdiamond #!!
! Cgraphite (4) All of these
36 Equilibrium Last Leap for NEET (Part-I)
11. If AgCl, PbCl2 and Ca3(PO4)2 have same value of 17. 40% N2O4 molecules are dissociated in a sample
solubility product, which of the following has of gas at 27°C and 760 mm Hg. Calculate the
minimum solubility in mol/litre? density of the equilibrium mixture
(1) AgCl (1) 13.11 g/L (2) 2.66 g/L
(2) PbCl2 (3) 6.2 g/L (4) 20.02 g/L
(3) Ca3(PO4)2 18. pK h for a salt of weak acid and weak base is
(4) All have same solubility given by the formula
12. When 0.4 mole of HCl is added to one litre of (1) pKh = pKw – pKa
solution containing 0.2 M each of HCN and CN– (2) pKh = pKw – pKa + pKb
ion. pH of solution become (Ka = 1.8 × 10–5)
(3) pKh = 14 + logKa – pKb
(1) 3.5 (2) 1
(4) pKh = 14 – logKa + logKb
(3) 0.7 (4) 4
19. On reducing the concentration of base to one half,
13. A certain weak acid has a dissociation constant in the buffer solution of NH4OH and NH4Cl, the
1.0 × 10–5. The equilibrium constant for its reaction pH observed was 7.82. What was the pH of the
with a strong base is original solution?
(1) 1.0 × 10–5 (2) 1.0 × 10–9
(1) 4.6 (2) 10.34
(3) 1.0 × 109 (4) 1.0 × 10–14
(3) 8.12 (4) 7.52
14. For the reaction,
20. In a reaction,
!!!
"
CaCO 3(s) #!!
! CaO(s) + CO2(g), K p = 1.16
!!!
"
A2(g) + 4B2(g) #!!
! 2AB4(g), H > 0
atm
at 800°C. If 40 g of CaCO3 were kept in a 5 L the formation of AB4(g) will be favoured by
vessel at 800°C, the moles of CaCO3 remained at (1) Low temperature and low pressure
equilibrium is
(2) Low temperature and high pressure
(1) 0.33 (2) 0.45
(3) High temperature and low pressure
(3) 0.63 (4) 0.21
(4) High temperature and high pressure
15. Review the pKa data of the following equilibria and
point out which buffer is to be used to study the 21. Which of the following cannot act as buffer?
hydrolysis of methyl acetate at pH 9.25 (1) NaH2PO4 + H3PO4
!!!
"
(1) HSO4– #!!
! SO42– + H+ (pKa = 1.92) (2) NH4OH + NH4Cl
!!!
" (3) NaOH + CH3COONa
(2) H2PO4– #!!
! HPO42– + H+ (pKa = 7.21)
(4) Both (1) & (3)
!!!
"
! HCO3– + H+ (pKa = 6.37)
(3) CO2(aq)+H2O #!!
22. If solubility product of Ca(OH)2 is 10–11, the pH at
!!!
"
(4) HCO3– #!! which Ca(OH) 2 precipitate from a solution
! CO32– + H+ (pKa = 10.25)
containing decimolar concentration of Ca2+ is
16. For the reaction (i) and (ii)
(1) < 5 (2) 9 < pH > 5
!!!
"
A #!!
! B+C ... (i) (3) > 9 (4) 9 < pH > 7
!!!
"
D #!!
! 2E .... (ii) 23. What will be the pOH when 20 ml of 0.2 M HCN
Given Kp1 : Kp2 :: 16 : 1 (pK a = 5.0) is titrated with 20 ml of 0.2 M
ammonia solution (pKb = 5.0)?
If the degree of dissociation of A and D be same
then the total pressure at equilibria (i) and (ii) (1) 7
would be in the ratio (2) 5
(1) 32 : 1 (2) 1 : 64 (3) 9
(3) 64 : 1 (4) 1 : 4 (4) 12
Last Leap for NEET (Part-I) Equilibrium 37
24. For the reaction, 31. What is the pOH of a buffer solution containing
0.04 moles of acetic acid and 0.4 moles of
!!!
"
CuSO 4 5H 2 O(s) #!!
! CuSO 4 3H 2 O(s) + potassium acetate? (Ka = 10–5)
2H2O(g) (1) 6 (2) 8
Which one is correct representation? (3) 11 (4) 9
(1) Kp = !"! !# (2) Kc = [H2O]2 32. pH of 0.1 M NaCN solution is 11, then the
percentage hydrolysis is
(3) Kp = Kc (RT)2 (4) All of these (1) 0.1% (2) 1%
25. pH of water is 7.0 at 25°C. If water is heated to (3) 0.01% (4) 10%
70°C, the
33. Equilibrium constant (Kc) for the following reaction
(1) pH will decrease and solution becomes acidic
!
(2) pH will increase !!!
"
! H2 + I2 is
2HI #!! . Then, percentage of HI
"#
(3) pH will remain constant as 7 left at equilibrium will be
(4) pH will decrease but solution will be neutral (1) 25% (2) 50%
26. The conjugate base of [Al(H2O)3(OH)3] is (3) 75% (4) 12.5%
(1) [Al(H2O)3(OH)2]+ (2) [Al(H2O)3(OH)2O]– 34. Which of the following can act as Buffer solution?
(3) [Al(H2O)3(OH)3]– (4) [Al(H2O)2(OH)4]– (1) NH4OH + NH4Cl (2) Boric acid + Borax
27. The solubility of PbCl2 in water is 0.01 M at 25°C. (3) Na2HPO4 + Na3PO4 (4) All of these
Maximum concentration of [Pb2+] in 0.1 M NaCl will
35. What will be the resulting pH, when equal volume
be
each of monobasic acid solution with pH 2, 3, 4
(1) 2 × 10–3 M (2) 1 × 10–4 M are mixed in a vessel ? (log 3.7 = 0.56)
(3) 1.6 × 10–2 M (4) 4 × 10–4 M (1) 3 (2) 2.44
28. pH of a solution of salt undergoing anionic (3) 1.9 (4) 3.40
hydrolysis (say CH3COONa) is given by
" ! # ! ! !
!!!
36. !""# # #!!!" $ #!!!
!!!" !!!"
% #!!! & , what can be
!
(1) pH = [pKw + pKa + log C] predicted about K1, K2, K3 ?
"
(1) K1 > K2 > K3 (2) K3 > K2 > K1
!
(2) pH = [pKw + pKa – log C] (3) K1 = K2 = K3 (4) K1 = K2 < K3
"
37. Increasing pressure will move the reaction in
! forward direction for
(3) pH = [pKw + pKb – log C]
"
(1) !! " !!!
"
# ! " #!!
! $!# "
!
(4) pH = [– pKw – pKb – log C]
"
!!!
"
(2) !"#! $ #!!
! !"#" $ "## $
!!!
29. For the reaction : N2O3 #!! "
! NO + NO2, total
pressure is P and degree of dissociation is 50%. !!!
"
(3) !"#$% #!!
! &'$
Then, KP would be
(4) !! " !!!
"
#$! " #!!
! %!$" "
(1) 3P (2) 2P
! !
(3) (4) !!!
"
38. !! "#$ %! "#$ #!!
! &!%"#$' If 2g H2, 63.5 g I2, 25.6
" "
30. Which of the following aqueous solution of sodium g HI are present at equilibrium for the reaction in
acetate will show minimum pH? 2 litre flask, value of Kp =
(1) 0.01 M (2) 0.001 M (1) 0.16 (2) 0.0256
(3) 0.0001 M (4) 0.1 M (3) 1.65 (4) 0.08
39. Ksp for zinc phosphate is correctly represented as 46. In the system,
(1) s2 (2) 8 s3 !"#$! % &!' " !!!
"
&()* #!!
! !"'+%, -&#$ "
(3) 27 s4 (4) 108 s5 equilibrium is established. More water vapour is
40. If Ka for HCN is 10–5
and concentration of CN– is added to re-establish the equilibrium. The pressure
thrice than that of HCN. The pH of buffer is of water vapour is tripled. The factor by which
pressure of HCl is changed
(1) 5 (2) 5.477
(1) 3 (2) !
(3) 4.523 (4) 6.2
41. For NH 4 Cl, correct expression for degree of (3) 6 (4) "
hydrolysis (h), (h < < 1) is
47. The equilibrium constant K p for the reaction
!! !! !!!
"
! !"#! at a particular temperature is
!"# #! #!!
(1) " ! " #$ (2) " ! " #$
5. The partial pressure of oxygen gas if equal
moles of AO and AO2 is present at equilibrium
#! !! (1) 0.49 atm (2) 5 atm
(3) $ # " %# # (4) "
# (3) 0.2 atm (4) 1.87 atm
42. If pH of 0.1 M (NH4)2CO3 solution is x then pH of 48. The expression pK h – pK w + pK b = 0 is not

0.01 M solution of (NH4)2CO3 is suitable for the salt
(1) FeCl3 (2) NaCN
!
(1) 2x (2)
! (3) Ag2SO4 (4) All of these
(3) 10x (4) x 49. ! "!# ! "! #" represents the hydrolysis
43. Which of the following mixture act as buffer reaction. This indicates that the salt is made up of
solution?
(1) Weak acid and weak base
(1) 100 ml of 1 M CH3COOH + 25 ml 5 M NaOH
(2) Strong acid and weak base
(2) 150 ml 0.1 M HCOOH + 20 ml 1 M KOH
(3) Strong base and weak acid
(3) 200 ml 0.5 M NH4OH + 50 ml 2 M H2SO4
(4) Strong acid and strong base
(4) 100 ml 1 M NH4OH + 40 ml 1 M HCl
50. A solution contains Pb +2 ions. In order to
# #
44. !!"!"" !$ precipitate Pb+2 ions, potassium sulphate is added.
What is the concentration of sulphate ions required
This reaction is set up in aqueous medium. We
to reduce the concentration of Pb +2 to
start with 1 mol of I2 and 0.5 mol of I– in 1L flask.
4 × 10–5 moles per litre? [KspPbSO4 = 1.8 × 10–8]
After equilibrium is reached, excess of AgNO 3
gave 0.25 mol of yellow precipitate, equilibrium (1) 4.5 × 10–4
constant is
(2) 9 × 10–4
(1) 1.33 (2) 2.66
(3) 6 × 10–3
(3) 2.00 (4) 3.00
(4) 5 × 10–3
45. For the reaction
!
51. PCl5 dissociates at 250°C as
! " #$ " ! %& " ' ( " )* . If at PCl5(g) ! PCl3(g) + Cl2(g).
equilibrium one mole of A is added and 1 mole of
The pressure required for the 50% dissociation is
C is removed then the value of KC will be
(1) 102 (2) 103 (1) 3 Kp (2) 4 Kp
(3) 104 (4) 10 (3) 2 Kp (4) Kp
52. Which of the following mixture of solution act as 58. The pressure necessary to obtained 50%
buffer? dissociation of AX2 (g) as AX 2(g) AX(g) +
(1) 150 ml of 0.1 M HCl and 5 ml of 3 M NH4OH X(g) at 250ºC is numerically equal to
(2) 200 ml of 1 M CH3COOH and 40 ml of 5 M (1) Three times of Kp (2) Four times of Kp
NaOH (3) Eight times of Kp (4) Six times of Kp
(3) 100 ml of 1.5 M HCOOH and 20 ml 4 M KOH 59. For the equilibrium reaction
(4) All of these "
2NOBr(g) 2NO(g) + Br 2 (g) if "!" ,
!
53. pH of which of the following salt solution does not !
depend on concentration? where P is total pressure then !!"#$ will be
(1) CH3COONa (2) NH4Cl "% $!

(1) (2)
$ #
(3) NH4NO3 (4) NH4CN
! &%
54. What volume of water is added to 400 ml of HCl (3) (4)
# $
solution so the pH of the solution increases by one
60. At temperature T K, PCl5 is 50% dissociated at an
unit?
equilibrium pressure of 4 atm. At what pressure it
(1) 360 ml (2) 1000 ml would dissociates to 80% at the same
(3) 600 ml (4) 3600 ml temperature?
55. The equilibrium constant k p for the reaction (1) 0.75 atm (2) 0.50 atm
! ! "# is related to degree of dissociation of (3) 0.60 atm (4) 2 atm

A is and total pressure P is 61. Vapour density of N2O4 when heated to 100ºC
!
becomes 24.5. Its degree of dissociation at this
! "# temperature is
(1) $ " !
% kP is independent of pressure
&
(1) 80% (2) 87.75%
' ! "#
(2) $ " !
% k P is directly proportional to (3) 40.34% (4) 60%
&
pressure 62. If K1 and K2 are respective equilibrium constant
for the two reaction
! ! "#
(3) $ " % k P is directly proportional to XeF6(g) + H2O(g) XeOF4(g)+2HF(g); K1
&
pressure
XeO4(g) + XeF6(g) XeOF4(g)+XeO3F2(g); K2
! !
(4) " " #$% k P is directly proportional to The equilibrium constant for the reaction
&
pressure XeO4(g) + 2HF(g) XeO3F2(g) + H2O(g) will
56. pH of 0.1 M CH3COONa solution is 12. Then the be
percentage hydrolysis will be !"
(1) (2) K1.K2
(1) 1% (2) 0.1% ! !!
(3) 10% (4) 0.01% #& #%
(3) # (4) #
57. An element ‘X’(s) melts at 271ºC and has density % &
of 9.73 g/ml as solid and 10.05 g/ml as a liquid at 63. For the equilibrium SO 2 Cl 2 (g) SO 2 (g) +
this temperature for the equilibrium X(s) X(l) Cl2(g) volume is increased. When the equilibrium is
the melting point is favoured either by reestablished
(1) Increasing temperature, decreasing pressure (1) Amount of SO2(g) will decrease
(2) Decreasing temperature, decreasing pressure (2) Amount of SO2Cl2(g) will increase
(3) Increasing temperature, increasing pressure (3) Amount of Cl2(g) will increase
(4) There is no effect of pressure on melting point (4) Amount of Cl2(g) will remain unchanged
64. Gº for the reaction X + Y Z is –4.606 kcal. 72. A white salt is readily soluble in water and gives
The equilibrium constant for the reaction at 227ºC a colourless solution with a pH of about 9. The salt
is nearly would be
(1) 100 (2) 10 (1) NH4NO3 (2) CH3COONa

(3) CH3COONH4 (4) CaCO3
(3) 2 (4) 0.01
73. When CO 2 is dissolved in water following
65. Which of the following is true at chemical
equilibrium? equilibrium is established CO2+2H2O H3O+ +
HCO3– for which equilibrium constant is 3.8×10–7
(1) ( G)T, P is minimum and ( S)u,v is minimum
and pH = 6.0. The ratio [HCO3–]/[CO2] would be
(2) ( G)T, V is minimum and ( S)u,v is maximum
(1) 3.8 × 10–13 (2) 3.8 × 10–1
(3) ( G)T, V is maximum and ( S)u,v is zero
(3) 6.0 (4) 13.4
(4) ( G)T, P is zero and ( S)u,v is zero
74. The pH of a buffer solution containing equal molar
66. When the reactants A and B are mixed to give concentration of a weak base and its chloride will
products C and D, the reaction quotient Q at the be (Kb for weak base = 2 × 10–5)
initial stage of reaction is
(1) 5 (2) 9
(1) Zero
(3) 4.7 (4) 9.3
(2) Independent of time
75. When rain is accompanied by a thunderstorm the
(3) Increase with time collected rain water will have a pH value
(4) Decrease with time (1) Slightly lower than that of rain water without
67. At infinite dilution, the percentage ionisation for thunder storm
both strong and weak electrolytes is (2) Slightly higher than that when the thunder
(1) 1% (2) 20% storm is not there
(3) 50% (4) 100% (3) Uninfluenced by occurrence of thunder storm
68. Which of the following can act both as Bronsted (4) Depend on the amount of dust in air
acid and Bronsted base in aqueous solution? 76. Mass loss of 1.0 g of the AgCl on repeated
(1) Na2CO3 (2) OH– washing with 10L of water is (Ksp of AgCl = 1.0
× 10–10 and Ag = 108, Cl = 35.5)
(3) HCO3– (4) NH3
(1) 1.43 × 10–2 g (2) 1.23 × 10–3 g
69. A compound NH2CH2COOH may behave
(3) 1 × 10–4 g (4) 1.34 × 10–3 g
(1) Only as an acid
77. pH of a solution obtained on mixing 50 ml of
(2) Only as a base 0.1 M NaCN and 50 ml of 0.2 M HCl will be (pKa
(3) Both as an acid and base for HCN = 9.40)
(4) Neither acid nor base (1) 1.00 (2) 9.40
70. To Ag 2 CrO 4 solution over its own precipitate (3) 9.10 (4) 1.30
!"#!"
# ion are added. This results in 78. Equal volume of two solution having pH = 2 and
(1) Increase in Ag+ concentration pH = 10 are mixed together at 90ºC then pH of
resulting solution [Kw at 90º = 10–12]
(2) Decrease in Ag+ concentration
(1) 2 + log 2 (2) 10 – log 2
(3) Increase in solubility
(3) 7 (4) 6
(4) Increase in solubility product
79. The correct order of increasing solubility of AgCl
71. The K sp of AgCl is 4.0 × 10 –10 at 298 K. Its in A = water, B = 0.1 M NaCl, C = 0.1 M BaCl2
solubility in 0.04 M CaCl2 will be and D = 0.1 M NH3 is
(1) 2.0 × 10–5 M (2) 1.0 × 10–4 M (1) D > A > B > C (2) D > C > B > A
(3) 5 × 10–9 M (4) 2.2 × 10–4 M (3) B > A > D > C (4) A > D > B > C
80. A monoprotic acid undergo 40% dissociation in its 86. Which of the following reaction has minimum
0.2 M aqueous solution. The approx. pH of solution value of KP/KC?
will be (1) N2(g) + 3H2(g) 2NH3(g)
(1) 2 (2) 1.7
(2) PCl5(g) PCl3 + Cl2(g)
(3) 1.53 (4) 1.1
(3) 2HI(g) H2(g) + I2(g)
81. In the reaction
(4) N2O4 (g) 2NO2(g)
N2O4 2NO2
87. In the reaction A(g) + 2B(g) 2C(g) + D(g). The
On reducing the pressure the reaction shifts in initial concentration of B is twice of A and at
forward direction. This is because on reducing equilibrium the concentration of A and D are equal
pressure then the value of equilibrium constant is
(1) QC increases while KC remains constant (1) 4 (2) 16
(2) QC decreases while KC remains constant (3) 2 (4) 1
(3) QC remains constant while KC decreases 88. When 100 ml 1 M H2SO4 is mixed with 50 ml of
(4) QC remains constant while KC increases 4 M NaOH solution. pH of resulting solution would
be
82. Which of the following aqueous solution will have
maximum value of Kb? (1) 6.05 (2) 8.10
(1) 1 N NaCl (3) 7 (4) 6.20
(2) 1 M MgCl2 89. The degree of hydrolysis of 0.2 M NH4Cl solution

will be (Kb for NH4OH is 1.8 × 10–5)
(3) 1.5 N AlCl3
(1) 5.27 × 10–5 (2) 3.10 × 10–4
(4) All will have same value
(3) 3.65 × 10–6 (4) 5.15 × 10–4
83. In an aqueous solution of 1 L, when the reaction
90. The value of equilibrium constant depends on
2Ag+(aq) + Cu(s) Cu2+(aq) + 2Ag(s) reaches
(1) Pressure (2) Concentration
equilibrium [Cu2+] = xM and [Ag+] = yM. If volume
of solution is doubled by adding water then at (3) Temperature (4) All of these
equilibrium 91. When the volume of container is doubled then
! ) # which of the following equilibrium shifts in the right
(1) '*+ $ !( ' %& $ ! direction?
" "
! ) # (1) 2SO2(g) + O2(g) 2SO3(g)
(2) '*+ $ !( ' %& $ !
" "
(2) N2(g) + 3H2(g) 2NH3(g)
! ) "
(3) &*+ # (' & $% #
! ! (3) N2O4(g) 2NO2(g)
!) #
(4) '*+ $ !( ' %& $ ! (4) 2HI(g) H2(g) + I2(g)
" "
84. The molecular mass of PCl5 is 208.32 when it is 92. In the following equilibrium
heated to 230ºC it dissociates to extent of 68%.
NH4HS (s) NH3 (g) + H2S (g)
The molecular mass of PCl5 at this temperature
will be some more NH3 is added at constant temperature
(1) 100 (2) 124 so that partial pressure of NH3 at new equilibrium
becomes equal to the initial total pressure. Ratio
(3) 60 (4) 62
of KP at new equilibrium and initial equilibrium is
85. Two solutions of equal volume of pH = 3 and
(1) 2 : 1
pH = 5 are mixed together. The pH of resultant
solution will be nearly [log 3 = 0.48, log 5 = 0.7] (2) 4 : 1
(1) 4 (2) 2.7 (3) 1 : 1
(3) 3 (4) 3.3 (4) 3 : 1
# 99. The relation between KP and KC at equilibrium

93. The pH at the equivalence point, when 50 ml
!" (1) KP = KC (RT)– n (2) KC = KP (RT) n
#
HCOOH is neutralised by 50 ml NaOH is (pKa #! #"
!" (3) = (RT) n (4) = (RT)– n
#" #!
of HCOOH = 3.70)
100. The nature of 10–7 M HCl solution is
(1) 7.5 (2) 8.19
(1) Acidic (2) Basic
(3) 8.60 (4) 9.26
(3) Neutral (4) Cannot define
94. Find the change in pH value of buffer solution when
101. 25 ml of H2 and 20 ml of I2 was heated in a one
#
50 ml HCl is added to a buffer containing litre vessel and at equilibrium 30 ml of HI was
!" found. KC is
# #
100 ml CH 3 COOH and 100 ml (1) 1.8 (2) 0.18
!" !"
CH3COONa (pKa = 4.74, log 3 = 0.4771) (3) 18 (4) 0.018
(1) pH increases by 0.47 102. Which pair will show common ion effect?
(2) pH decreases by 0.47 (1) BaCl2 + Ba(NO3)2 (2) NaCl + HCl

(3) NH4OH + NH4Cl (4) NaCN + KCN
(3) pH remain constant
103. A 1 M monoprotic acid is 0.001% ionised. The
(4) pH increases by 1
dissociation constant of acid is
95. In Ca(OH) 2 solution (aqueous), the molar
! !
concentration of [OH – ] is found to be x, the (1) !"# !# (2) !"# !#
solubility of Ca(OH)2 in moles/litre is " !"
(3) !"# !# (4) !"# !#
(1) 2x (2) x
104. Conjugate acid of &' base is
" (1) H2 (2) H2O
(3) (4) 4x
!
(3) H+ (4) H3O+
96. Hydrolysis constant (Kh) of salt of weak acid and
105. The dissociation constant of acids HA, HB, HC and
weak base is given by
HD are !"# !$ !" , !"$ !# " , !"#$ %& ! and
!" !" $"% !# " respectively. The weakest acid among
(1) ! # (2) ! # these
!! !!
(1) HA (2) HB
"# "#
(3) " $ (4) " $ (3) HC (4) HD
" " !" ! " " !" !
106. On increasing temperature the value of KW
97. In the given equilibrium
(1) Increases (2) Decreases
H2O(l) H2O (V)
(3) Not affected (4) Both (1) & (2)
At 100ºC the vapour pressure is 1 atm. If the
volume of container is halved, after sometime the
vapour pressure becomes (assuming constant (1) pH of pure water at 50°C is non-zero
temperature) (2) pH of 10–8 M HCl is less than 7 at 25°C
(1) 1.5 atm (2) 2.5 atm (3) Addition of one drop of conc. HCl in NH4OH
(3) 2 atm (4) 1 atm solution decreases pH of the solution
(4) Equimolar mixture of HCN and NaOH solution
98. 0.01 M NH4OH is 50% neutralised by using HCl
has pH of 7
solution. The pOH value of final solution will be
108. The nature of solution for salt of weak acid and
(&' !" %$"# !
! strong base is
(1) 7.26 (2) 6.74 (1) Acidic (2) Basic
(3) 4.74 (4) 8.74 (3) Neutral (4) Both (1) & (2)
109. Correct representation for the solubility product of 117. At 300 K, the degree of dissociation of 0.066 M
Hg2Cl2? solution of an acid HA is 0.0145. What would be
(1) [Hg2+][Cl–]2 (2) [Hg22+][Cl–]2 the degree of dissociation of 0.02 M solution of the
acid at the same temperature? (Assuming
(3) [Hg+][Cl–]2 (4) [Hg+][Cl–] dissociation constant in both cases are same)
110. Which of the following is not a buffer? (1) 0.026 (2) 0.42
(1) NaCN / HCN
(3) 0.01 (4) 0.85
(2) (#'$)'% * (#'$ )'& (+ 118. Which solution acts as buffer solution?
(3) Na3PO4 / Na2HPO4 (1) 50 ml 0.1 M CH3COOH + 20 ml 0.1 M NaOH
(4) NH4OH / NaOH (2) 20 ml 0.1 M CH3COOH + 50 ml 0.1 M NaOH
111. The solubility of A2B3 is x mol dm–3. Its solubility
(3) NH4Cl + HCl
product is
(4) 20 ml 0.1 M NH4OH + 50 ml 0.1 M HCl
(1) 6x4 (2) 64x4
(3) 36x4 (4) 108x5 119. AB2(g) AB(g) + B(g). If the initial pressure
112. NaOH (aq), HCl (aq) and NaCl (aq) have is 500 mm Hg and total pressure at equilibrium is
concentration of 10–3 M each. Their pH will be 700 mm Hg. Kp for the reaction is
respectively (1) 500.25 (2) 200.65
(1) 10, 6, 2 (2) 11, 3, 7 (3) 133.3 (4) 100.50
(3) 10, 3, 7 (4) 10, 4, 7
120. If pH of 0.1 M (NH4)2CO3 solution is x then pH of
113. In the reaction 0.01 M solution would be
I2 + I– I3– the Lewis base is (1) More than x (2) Less than x
(1) I2 (2) I–
(3) Equal to x (4) Data is not sufficient
(3) !! (4) Mixture of I2 + I– 121. The solubility product constants of both salt
Ag 2CrO 4 and AgBr is 4 × 10 –12. The ratio of
114. The V.D. of PCl5 is 104.25 but when heated to
solubility of their saturated solutions is
230°C, its V.D. is reduced to 62. The degree of
dissociation of PCl5 at this temperature will be (1) 90 (2) 50
(1) 6.8% (2) 68% (3) 60 (4) 70
(3) 46% (4) 64% 122. A mixture containing 100 ml of each 0.2 M
115. C2H4 + H2 ! C2H6, H = –56 kcal mol–1 H2SO4, 0.2 M HCl and 0.6 M NaOH, then pH of
resulting solution would be
The equilibrium concentration of C 2H6 can be
increased by (1) 6.5 (2) 7.5
(1) Increasing the temperature (3) 7 (4) 5.60

(2) Decreasing the pressure 123. For three hypothetical reactions, equilibrium
(3) Addition of catalyst constants (K)
(4) Addition of C2H4 A ! B ; K1 = 2
116. A + B ! C B ! C ; K2 = 3
If concentration of A increases 10 fold, then and D ! C ; K3 = 2

equilibrium constant K becomes
Then the equilibrium constant for D ! A is
!
(1) 10 K (2) " (1) 3 (2) 12
!#
(3) 100 K (4) K (3) 0.083 (4) 0.33
124. Which of the following is correct? 131. KC for the reaction A(g) + B(g) ! C(g) is 3 at 400
(1) pKw increases with increase in temperature K. In an experiment x mol of A is mixed with
(2) pKw does not depend on temperature same number of mole of B in a 1 L vessel. At
equilibrium 3 mol of C is formed. The value of x
(3) On adding an acid, pKw decreases will be
(4) On increasing temperature, pH of neutral (1) 2.5 (2) 3.5
water decreases
(3) 4.0 (4) 4.5
125. For KAl(SO4)2, the solubility is x, then Ksp is given
132. 3 ml of a strong acid solution of pH = 3 is mixed
by
with 2 ml of a strong base of pH = 11. What is
(1) 4x4 (2) 2x2 the pH of new solution? (log2 = 0.3010, log5 =
(3) x2 (4) 4x3 0.6990)
126. Following reaction mixtures are given (1) 7.0 (2) 2.0
a. 100 ml of 0.1 M CH 3 COOH + 100 ml of (3) 3.7 (4) 4.5
0.1 M NaOH 133. In the decomposition reaction of ammonia
b. 100 ml of 0.1 M CH 3 COOH + 50 ml of
!"#! ! "" $%& '#" $%&
0.1 M NaOH
c. 100 ml of 0.1 M HCl + 100 ml of 0.1 M NaOH 2 moles of NH3 are introduced in the vessel of
1 litre. At equilibrium, 1 mole NH3 was left. The
Select the mixtures which are the cases of
value of Kc will be
hydrolysis of salt and buffer solution respectively
(1) 0.75 (2) 0.70
(1) a, b (2) b, a
(3) 2.69 (4) 1.70
(3) a, c (4) c, a
134. The solubility of CaF 2 (K sp = 3.4 × 10 –11) in
127. A weak acid HOX (Ka = 10–5) forms a salt NaOX
0.1 M solution of NaF would be
(0.1 M) on reacting with caustic soda. The
degree of hydrolysis of NaOX is (1) 3.4 × 10 –11 (2) 3.4 × 10 –14
(1) 0.01% (2) 0.0001% (3) 3.4 × 10 –15 (4) 3.4 × 10 –9
(3) 0.1% (4) 0.5% 135. When 0.1 M, 100 ml of acetic acid is titrated
against 0.1 M, 50 ml of NaOH. The correct
128. If Ag+ + 2NH3 [Ag(NH3)2]+, K = 6.06 × 10–6
statement about the titration is
[Ag(NH 3 )] + + NH 3 [Ag(NH 3 ) 2 ] + ,
the equilibrium constant = 1.7 × 10–3 then what [Given that $% ! &'""'##"( )*+) ]
would be equilibrium constant of following? (1) At the mid point of titration the pH of the
Ag+ + NH3 [Ag(NH3)]+ solution is 4.74
(1) 3.56 × 10–3 (2) 5.3 × 10–3 (2) At the end of titration pH of the solution is
less than 7
(3) 3.5 × 103 (4) 6.08 × 10–3
(3) If 100 ml of NaOH is taken then solution will
129. The solubility of a salt A2B 3 is 1×10 –3 M. Its be basic
solubility product is
(4) All of these
(1) 1.08 × 10–13 (2) 1.08 × 10–15
136. When 0.2 M, 100 ml of NH4OH and 0.2 M, 100
(3) 1.08 × 10–10 (4) 1.08 × 10–17 ml of HCl is titrated. The pH of the solution at
130. One litre of water contains 10–7 mole of H+ ions. 90°C is [Assuming that pK w at 90°C is 12 and
Degree of ionization of water is given that pKb (NH3) = 3.74]?
(1) 1.8 × 10–7% (1) 4.63
(2) 0.8 × 10–9 % (2) 5.63
(3) 3.6 × 10–9% (3) 5.13
(4) 3.6 × 10–7% (4) 7
137. N2(g) + O2(g) 2NO(g) 145. Which of the following mixture will act as buffer
solution?
One mole of N 2 (g) and 1 mole of O 2 (g) is
allowed to react in a closed container. If the (1) 100 ml of 1 M CH3COOH + 200 ml of 1 M NaOH
value of Kc is 5 × 10–31 at 25°C then the value (2) 100 ml of 1 M HCOOH + 100 ml of 1 M KOH
of Kp at 25°C will be
(3) 100 ml of 1 M HCN + 50 ml of 1 M NaOH
(1) 2 × 1030 (2) 5 × 1031
(4) 100 ml of 1 M CH3COOH + 150 ml of 1 M
(3) 2 × 10–30 (4) 5 × 10–31 KOH
138. Equal volume of an acid (pH = 2) is mixed with 146. The solubility of Pb(OH)2 in water is 4 × 10–6 M,
a base (pH = 9). The pH of the resulting solution then solubility of Pb(OH)2 in the buffer solution of
will be pH = 9
(1) 5.5 (2) 11.7 (1) 2.56 × 10–6 M (2) 1.25 × 10–4 M
(3) 2.3 (4) 8.5 (3) 2.45 × 10–3 M (4) 5.6 × 10–8 M
139. Number of [OH–] in 1 ml of solution having pH = 147. The vapour density of PCl5 at 200°C is found to
4 are be 60. The approx. percentage dissociation of
PCl5 at this temperature would be (approx)
(1) 10–4 (2) 10–10
(1) 25% (2) 45%
(3) 6.02 × 1023 (4) 6.02 × 1010
(3) 65% (4) 74%
140. The solubility of AgCl in 0.1 M NaCl solution is
(Ksp of AgCl = 1.8 × 10–10) !!!
"
148. !!"#$% #!!
! !!"#&%
(1) 2.5 × 10 –5 (2) 1.34 × 10 –5 The above system is in equilibrium at certain
(3) 1.34 × 10 –6 (4) 1.8 × 10 –9 temperature and pressure. If the pressure is
increased at the same temperature then which of
141. The numerical value of equilibrium constant the following statement is correct?
changes with change in
(1) Melting of ice decreases
(1) Concentration of reactants
(2) Equilibrium will shift towards left
(2) Pressure
(3) Formation of H2O(l) decreases
(3) Temperature
(4) Melting of ice increases
(4) All of these 149. Which of the following reaction has KP > KC and
142. Solubility of AgCl is maximum in the value of equilibrium constant increases with
increase in temperature?
(1) Water (2) Ammonia
(3) HCl (4) AgNO3 !!!
"
(1) !! "#$ %! "#$ #!!
! &!%"#$
143. In the hydrolysis of CH3COONH4, which of the !!!
"
(2) !"#! $%& #!!
! !"#" $%& "## $%&
following statement is correct?
!!!
"
(3) !"#! $%& #!!
! "!#" $%&
(1) Only anion undergoes hydrolysis
(2) Only cation undergoes hydrolysis !!!
"
(4) '# $%& ()# $%& #!!
! *')" $%&
(3) Both cation and anion undergoes hydrolysis 150. The correct statement among the following is
(4) pH of solution increases with increase in (1) Buffer capacity of acidic buffer is minimum
dilution when [Acid] = [Salt]
144. 4 g NaOH is dissolved in 100 ml water and (2) The degree of hydrolysis of salt of weak acid
treated with 20 ml of 1 M HCl then pH of and weak base depends on concentration
resulting solution is (log 2 = 0.301, log 3 = 0.477) (3) At certain temperature pH of water is 6 and
(1) 9.56 (2) 11.25 at this temperature water is acidic in nature
(3) 6.50 (4) 13.824 (4) pH of water is temperature dependent
156. For which of the following solution pH will be less

!!!
"
151. !"!!#!"!" #$ #!!
! !"!!"!" #$ !#" #$ than 7?
Initial pressure of CH3COCH3 is 100 mm. When (1) 0.5 M ,)'! -" .&!
! (2) 0.1 M HCl

equilibrium is set up mole fraction of CO(g) is ,
" (3) 100 ml 0.1 M CH3COOH and 50 ml of 0.1 M
hence Kp is NaOH
(1) 100 mm (2) 50 mm (4) All of these
(3) 25 mm (4) 150 mm 157. Which of the following anion is the weakest base?
152. Hg2Cl2 (s) forms a saturated aq. solution hence (1) ("'#& (2) !"!
solubility product expression for solution is
(3) !"" (4) !"!!##
(1) + $% ,)% -# ,"# -# (2) ! "# "# $ !! %"&' %!
158. PbCl2 would be least soluble in
(1) Distilled water (2) 0.1 M HCl
(3) ! "# "#$ %! "&'! % (4) ! "# "#$!! %"&'! %!
(3) 0.1 M CaCl2 (4) 0.1 M NaCl
153. Some solid NH4HS is placed in a flask containing
159. The solubility of A(OH)3 is x mol L –1. Its KSP
0.5 atm of NH3. Upon heating following equilibrium value is
is attained and the pressure of H2S found to be
(1) 9x3 (2) 3x4
0.2 atm
(3) 27x4 (4) 9x4
!!!
"
!"!"#"#$ #!!
! !"%" &$ "'#" &$ 160. At 25°C, the dissociation constant of base BOH
is 1.0 × 10 –10 . The concentration of OH – in
then total pressure developed at equilibrium is 0.01 M aqueous solution of the base would be
(1) 0.9 atm (2) 0.67 atm (1) 1 × 10–5 mol L–1 (2) 1.0 × 10–6 mol L–1
(3) 0.17 atm (4) 0.50 atm (3) 2.0 × 10–6 mol L–1 (4) 1.0 × 10–7 mol L–1
154. 6 moles of A were mixed with 4 moles of B in a 161. pH of which of the following salt solution does not
5 litre container. At equilibrium, the reaction depend on concentration?
mixture was found to contain 4 moles of C
(1) NH4Cl
according to the reaction
(2) (NH4)2CO3
!" !"# #!"# !$!"# %!"# (3) (NH4)2SO4
The equilibrium constant Kc for the reaction is (4) All of these
(1) 0.2 162. A buffer solution of pH 9 can be prepared by
(2) 4.0 mixing
(3) 0.5 (1) CH3COONa & CH3COOH
(4) 5.0 (2) NaCl & NaOH
155. The oxidation of SO2 to SO3 is an exothermic (3) NH4Cl & NH4OH
reaction. The yield to SO3 will be maximum if (4) KH2PO4 & K2HPO4
(1) Temperature is increased and pressure is kept 163. At 90°C, pure water has
constant !"
(1) ! # "#
(2) Temperature is reduced and pressure is
increased (2) !"# # $ %& ! '() * "
(3) Both temperature and pressure are increased

(3) !"!#$ !#" $
(4) Both temperature and pressure are
decreased (4) All of these
164. To make a solution of pH = 12, the amount of 173. CO2 forms carbonic acid with water, which is a
NaOH dissolved in one litre of the solution should weak dibasic acid and dissociates in two steps :
be
!!"#" $%&' !!#$('
(1) 0.1 g (2) 0.2 g
!"#"! $%&' !"# $%&'(((((() #!
(3) 0.4 g (4) 1.2 g
165. The equilibrium constant of reaction is affected by '(&%$ ,23- '"&,+-
(1) Temperature (2) Catalyst !"#!" #$%& '#" #$%& (((()$!
(3) Pressure (4) Both (1) & (2)
The correct relationship between ! !! and ! !!
166. N2 + 3H2 ! 2NH3 K1 = x
(1) ! !! > ! !! (2) ! !! < ! !!
/ 0
NH3 ! )% '% K2 = ?
" "
(3) ! !! = ! !! (4) ! !! < < < ! !!
/ !
(1) # % (2) " !
1 #! 174. The numerical value of equilibrium constant
! depends on
(3) K2 = x2 (4) " !
# (1) Temperature
167. For whose ionisation, equilibrium constant is (2) Pressure
highest?
(3) Concentration of reactant
(1) HI (2) HBr
(4) All of these
(3) HCl (4) HF
!!!
"
168. !"# #!!
! "! #! for 22% dissociation what !" ! !!!
"
#$% &'() #!! "
! *!"&#$%)+ &'()
#$%%&' (&%&)*%$++ ,$$-.*$,
would be value of equilibrium constant?
(1) 0.04 (2) 0.0198 If oxalic acid is added to above equilibrium
reaction then
(3) 0.5 (4) 1.2527
(1) Equilibrium remains undisturbed, no change in
169. Which does not form conjugate base?
the intensity of colour
(1) HS– (2) HPO32–
(2) Intensity of red colour increases
(3) H3PO2 (4) H3O+
(3) Intensity of red colour decreases
170. )# !!!
"
! ")+$ the production of NH3 can
*+# #!! (4) It becomes colourless
be lowered by 176. Solubility (S) of the PbCl 2 is given by if the
(1) High temperature and low pressure solubility product is Ksp
(2) Low temperature and high pressure !"#

! ! $% "
(3) Low temperature and low pressure (1) . + $% (2) " ## $$
% # &
(4) High temperature and high pressure
171. 0.01 M (HA) is 2% ionised the OH – ion !"& !"#
concentration ! ! $% " ! ! $% "
(3) " ## $$ (4) " ## $$
(1) 2 × 10–4 (2) 5 × 10–11 % $%& & % #$%& &
(3) 5 × 10–12 (4) 10–8 177. Degree of hydrolysis of which of the following
172. Which of the following is buffer? salt is independent of concentration of solution?
(1) NH4OH + NH4Cl (1) NH4Cl
(2) HCN + NaCN (2) NH4CN
(3) CH3COOH (aq) + CH3COO– (aq) (3) (NH4)2SO4
(4) All of these (4) All of these
178. Which of the following is basic buffer? 185. The value of the reaction quotient before any
reaction occurs is
(1) ('%(&& ('%(&&'
(1) (2) 0
(2) %"" %"! &'() (3) –1 (4) 1

186. Calculate the number of H present in 1 ml of
(3) !" #$#%!" a solution whose pH is 4 (N A = Avogadro’s
number)
(4) All of these
179. Which of the following is not a Lewis acid? (1) 10–7 NA (2) 10–8 NA
(1) BF3 (2) AlCl3 (3) 10–16 NA (4) 10–14 NA
(3) CCl4 (4) BeCl2 187. A certain buffer solution contains equal
concentrations of X– and HX; the Kb for X– is 10–8.
180. The value of Kp varies with The pOH of the buffer is
(1) P (2) T (1) 8 (2) 6
(3) C (4) Both (1) & (2) (3) 14 (4) 9
! ! 188. pH of 10 M HCl (aq) is
181. , 200 cc CH 3 COOH was mixed with ,
"# "# (1) –1 (2) 10
100 cc NaOH. What would be pH of the solution? (3) 0 (4) 6
(1) pKa of CH3COOH 189. What is the pH of 0.2 M H2S if the Ka values of
(2) pKb of CH3COONa H2S to HS–1 and HS–1 to S–2 are 10–5 and 10–12
respectively? (log 2 = 0.301)
!
(3) pKa of CH3COOH (1) 1.85 (2) 2.85
#
! (3) 4 (4) 2
(4) pKb of CH3COONa
# 190. At equilibrium, Kp = 1 then the value of G° will
182. 40% N2O4 molecules are dissociated in a sample be equal to
of gas at 27°C and 1 atm pressure, the density (1) 10 (2) 100
of the equilibrium mixture is
(3) 0 (4) 1
(1) 3.1 g/L (2) 6.2 g/L
191. The following equilibrium constant are given
(3) 2.67 g/L (4) 18.6 g/L
!! !!!
"
"#! #!!
! $!#" % &#
183. The dissociation of solid NH 4HS in a closed
container produces a pressure of 4 atm at 95°C, !! !!!
"
"! #!!
! #!"$ % !
then Kp for the reaction is !
"! !!!
#! #!!"
! "! #$ % "
!!!
"
)+%+,(-! #!! &
! )+$ (.!/0/+# ,(.!
The equilibrium constant for the oxidation of
(1) 4 (2) 8 2 mole NH3 by oxygen to NO is
(3) 16 (4) 5
#!# " ! "! !!
184. The rate of the elementary reaction at 25°C (1) ## (2)
!#
!! "#"$%! &!%" is given by ! "! !" ! ""! !
(3) (4)
!# !#
rate = 4 × 10 –15 [N 2 ][H 2 ] 3 , the rate of
decomposition of gaseous NH3 to N2 and H2 at 192. Which of the following is Lewis acid?
25°C is given by rate = 8 × 10–20 [NH3]2. Then (1) CO2
equilibrium constant for the formation of NH3 at
(2) SiCl4
25°C is
(3) Zn2+
(1) 5 × 104 (2) 105
(4) All of these
(3) 7 × 104 (4) 106
193. For the reaction in equilibrium, !!!
"
200. !"#$% #!!
! ! #&'% " #&'% ; G° = 57 kJ
!!!
"
!"#$%&'( #!!
! !"#&'()$%! &'( Ksp for the reaction is
(1) 10–5 (2) 10–6
If !!"! "#$%&'( when initial pressure of NOCl is
(3) 10–10 (4) 10–16
80 atm, then total pressure at equilibrium is 201. How many mol of HCl in 10 L water would
(1) 70 atm (2) 90 atm produce solution having pH = 1?
(3) 100 atm (4) 85 atm (1) 1 (2) 10
194. CuSO4 solution is acidic due to (3) 0.1 (4) 0.01
(1) Anionic hydrolysis 202. What is pOH of a buffer solution containing
0.04 moles of acetic acid and 0.4 moles of
(2) Cationic hydrolysis
potassium acetate? Ka for acetic acid is 10–5
(3) Both cationic and anionic hydrolysis (1) 6 (2) 8
(4) No hydrolysis (3) 11 (4) 3
195. Aqueous solution contains SCN–, Br–, I– and Cl– 203. A is an aqueous weak acid, B is an aqueous
ions of equimolar concentration. On adding weak base. They are diluted separately, then
AgNO3 we should first expect precipitation of
(1) pH of A and B decreases
Given: Ksp of AgCl = 1.2 × 10–10
(2) pH of A and B increases
Ksp of AgBr = 3.5 × 10–13
(3) pH of A increases and B decreases
Ksp of AgI = 1.7 × 10–16 (4) pH of A decreases and B increases
Ksp of AgSCN = 7.1 × 10–13 204. NaHCO3 decomposes as :
(1) AgCl (2) AgBr 2NaHCO3 (s) Na2CO3 (s) + CO2 (g) + H2O (g)
(3) AgI (4) AgSCN The total pressure is 2.04 atm. The KP for the
196. M(OH)x has Ksp = 2.56 × 10–13 and solubility in reaction is
water is 10–3 mol/L. Calculate the value of x. (1) 1.04 atm (2) 4.08 atm
(1) 3 (2) 4 (3) 0.52 atm (4) 6.86 atm
(3) 2 (4) 1 205. At some elevated temperature value of Kw is
197. pH of 0.005 M HCOOH (Ka = 2 × 10–4) is equal 10 –10 if any solution has [H +] = 10 –7 at this
to temperature, solution is
(1) 3 (2) 4 (1) Acidic (2) Basic
(3) 2 (4) 5 (3) Neutral (4) Can’t be predicted

206. If )% 0'% ! ")'& , K c = K, then value of
!! equilibrium constant for the reaction
!!!
"
198. For !"! #$% !#&% #!!
! '!"#$% the ratio of !
" !"#! ! $"" %#"
= (1) K3 (2) 1/K2
(1) RT (2) (RT) –1 (3) 1/K3 (4) 1/K
(3) RT –1 (4) RT 2 207. The solubility products of Al(OH)3 and Zn(OH)2
are 8.5 × 10–23 and 1.8 ×10–14 respectively. If
199. !! !!!
"
"! #!!
! #!" ; K c = 4. If 2 mol of each NH4OH is added to a solution containing Al3+ and
reactant are arrested in a vessel of one dm3 then Zn2+ ions, the substance precipitated first is
how many mol of HI are expected at equilibrium? (1) Al(OH)3
(1) 2 mol (2) 1 mol (2) Zn(OH)2
! ! (3) Both together

(3) "#$% (4) "#$%
& & (4) No one can precipitate
208. A 0.1 N solution of an acid at room temperature 215. When S8 is heated to 950 K, at equilibrium the
has a degree of ionisation 0.1. The concentration pressure of S8 falls by 30% form 1 atm because
of OH– would be some of the S8 is converted to S2. The value of
equilibrium constant kp for this reaction is
(1) 10–12 M (2) 10–11 M
(3) 10–9 M (4) 10–2 M (1) 2.6 (2) 3.45
209. The pH of 10–8 M aqueous solution of HCl is (3) 2.96 (4) 1.57
(1) 9 (2) 8 216. What concentration of HCOO– is present in a

solution of 0.02 M HCOOH and 0.04 M HCl?
(3) Between 6 & 7 (4) Between 7 & 8
[Ka for HCOOH is 2.4×10–4]
210. How much sodium acetate should be added to a
0.1 M solution of CH3COOH to give a solution of (1) 2.4 × 10–5 (2) 1.2 × 10–4
pH = 5.5?(pKa of CH3COOH = 4.5) (3) 2.8 × 10–4 (4) 1.2 × 10–5
(1) 0.1 M (2) 0.2 M
217. !"#$%&#'#(!"#$%& !"!#$%&#'#(!#$%& at
(3) 1.0 M (4) 10.0 M 800 K.
211. The principal buffer present in human blood
The value of K C is 4.41. The equilibrium
(1) NaH2PO4 + Na2HPO4 concentrations of CO2 and CO will be (if reaction
(2) H3PO4 + NaH2PO4 is started with 0.1 M of each reactant)
(3) Na2HPO4 + Na3PO4 (1) [CO2] = 0.067 M, [CO] = 0.033 M
(4) H2CO3 + HCO3– (2) [CO2] = 0.033 M, [CO] = 0.033 M

(3) [CO2] = 0.067 M, [CO] = 0.067 M
!
212. How much volume of !"#$ are required to (4) [CO2] = 0.05 M, [CO] = 0.05 M
%
neutralise CH3COOH which is obtained from the 218. The species H2O, HCO3–, HSO4– and NH3 can
hydrolysis of 4.4 g CH3COOC2H5? (Degree of act both as Bronsted acids and bases. Find the
hydrolysis of salt is 1) incorrect match of conjugate acid and conjugate
base
(1) 1000 ml (2) 750 ml
Species Conjugate acid Conjugate
(3) 500 ml (4) 250 ml
base
(1) H2O H3O + OH–
! !
213. 200 ml "#$ is mixed with "#$%&'% !()*
%& # (2) HCO3– H2CO3CO32–
and the resulting solution is made upto 1 litre. The
(3) HSO4– SO42– H2SO4
pH of the solution will be
(4) NH3 NH4 + NH2–
(1) 12 (2) 10
219. The ionisation constant of nitrous acid is
(3) 6 (4) 2
4.0 10 –4 . The pH of 0.04 M sodium nitrite
214. 7 moles H2, 3 moles I2 and 1 mole of HI are solution is
taken in 1 litre container. At equilibrium, 3 moles
(1) 7 (2) 9.5
of HI are present. The value of K c for the
reaction, (3) 4.5 (4) 8.0
220. Which of the following salt solution will have
!!!
"
!! "#$ %! "#$ #!!
! &!%"#$ is lowest pH?
(1) CH3COONa
!
(1) (2) 0.5 (2) NaCl
$
(3) Na2CO3
"
(3) (4) 1 (4) NH4NO3
$
221. If CO2(g) is added to the following reaction at 227. Ksp of AgCl = 1.8 × 10–10. It will be most soluble
equilibrium in aqueous solution of
!!!
"
!"!#! $%&' #!!
! '!"#$%&' '!#" $(& then (1) AgNO3 (2) NaCl
(3) H2O (4) CaCl2
(1) Pressure of CO2 will increase
228. In which of the salt, cation and anion both will
(2) Kp increases
undergo hydrolysis?
(3) Partial pressure of CO2 remains same
(1) CH3COONa (2) NaCl
(4) Both (1) & (2)
(3) NH4Cl (4) CH3COONH4
!!!
222. For a reaction in equilibrium !"#$% #!! "
! %&'"#$ , 229. Equilibrium constants of following reactions are
initial pressure of A(g) = 1 atm, and the pressure given below
of A(g) is equal to that of B(g) at equilibrium. The
!!!
"
! '* ;
& '(')' #!! K1
value of Kp will be
! # !!!
"
(1) (2) ! "# ;
!" #!! K2
" "
$ The equilibrium constant of following reaction
(3) 1 (4)
"
! ! !
223. If pH of pure water is 6, then it may be "# !!!
"
# $# #!!
! # % is K3 and it is equal to
& & &
(1) Acidic
(2) Neutral at 25ºC !
(1) K1 × K2 (2) " "
(3) Neutral at higher temperature ! "
(4) Basic
!!
224. Which of the following can act as Bronsted acid (3) !! ! " (4) !"
and base both?
230. Bromine monochloride, BrCl decomposes into
(1) H2SO4
bromine and chlorine and reaches the equilibrium
(2) "#"# !!!
"
! "#! &'( $%! &'( ; Kc = 32
!"#$%&'( #!!
If initially pure BrCl is present at a concentration
(3) "#$#"
of 3.3 × 10–3 mol L–1, its molar concentration in
the mixture at equilibrium
(4) $"%##
(1) 1.1 × 10–3 mol L–1 (2) 3 × 10–4 mol L–1
225. Which of the following mixture will have pH =
(3) 2.2 × 10–4 mol L–1 (4) 2 × 10–5 mol L–1
pK a ? (Consider the volume is same for all
solutions given below) 231. For the following three reactions 1, 2 and 3
equilibrium constants are given
(1) 3 M HCl + 3 M CH3COOH
(2) 2 M CH3COOH + 2 M CH3COONa !!!
"
(a) !"#$% &! "#$% #!!
! !"! #$% &! #$% ; K1
(3) 4 M CH3COOH + 2 M CH3COONa !!!
"
(b) !"! #$% "" &#$% #!!
! !&#$% '"" #$% ; K2
(4) 1 M CH3COOH + 2 M CH3COONa """
#
(c) ('$ ,4- "'" &,4- $""
" (&" ,4- 5'" ,4- ; K3
226. pH of an acidic buffer is 5.7 and pKa is 5 then the
Which of the following relations is correct?
!"#$%&
ratio of is (1) K1K3K2 = 1
!'()*&
(1) 3 (2) !!!!" " !#
(2) 4
(3) K3 = K1 × K2
(3) 5
(4) 6
(4) ! # ! "" "!!! "
232. Le Chatelier’s principle is not applicable to 239. Which of the following is considered as Bronsted
acid but not as Lewis acid ?
!!!
"
(1) !"#$% &#$% #!!
! !"&#$%
(1) Al3 (2) BF3
!!!
"
(2) !! "#$ %! "#$ #!!
! &!%"#$
(3) NH4 (4) Zn2
!!!
"
(3) !! "#$ %&! "#$ #!!
! '!&" "#$
240. The dipole moment of HBr is 1.6 × 10–30 Cm and
!!!
"
(4) !! "#$ %! "#$ #!!
! &!%"#$ bond-length is 1Å. The percentage ionic
character of HBr is
233. A solution with pH-2.0 is more acidic than the
one with pH-6.0 by a factor of (1) 5% (2) 10%
(1) 3 (2) 4 (3) 1% (4) 20%
(3) 10,00 (4) 10,000 241. On adding NH4Cl to NH4OH solution the pH of
234. The aqueous solution of FeCl3 is acidic due to the solution will
(1) Acidic impurities (2) Ionisation (1) Increase
(3) Hydrolysis (4) Dissociation (2) Decrease
235. For the reaction, (3) Remains same

!!!
"
!"#$% !&! #$% #!!
! !"!&! #$% (4) Either increase or decrease
242. What will be the pH of 10–2 M CH 3COONH 4
Kp/ Kc is equal to
solution, if Ka(CH3COOH) = Kb(NH4OH) ?
(1) 1 (2) RT
(1) 2 (2) 12
!
(3) 67 (4) (3) 7 (4) 4
"#
243. Consider the following two reactions :
236. If 1 M CH3COONa is added to 1 M CH3COOH
(1) pH of the solution increases !
NO(g) + !!!
"
! NO2(g); K1 = 4 × 10–3
O (g) #!!
(2) pH decreases # 2
(3) pH does not change !!!
"
2NO2(g) #!!
! 2NO(g) + O2(g); K2 = ?
(4) Cannot be predicted If K1 and K2 are equilibrium constants, what will
237. If kc for the reactions are given as be the value of K2 ?
!!!
" (1) 6.25 × 104 (2) 2.5 × 102
! "# #!!
! #$#%#&!
(3) 4 × 10–3 (4) 1.6 × 102
!!!
"
! "# #!!
! #$%#& #' ! 244. 2 mol CO2 is passed over red hot charcoal. Find
the number of moles of gaseous product and
then kc of the reaction reactant at equilibrium if 25%, CO2 is reduced in
the reaction
/ / /
"""
#
89 $""
"9 : ; <
" " " (1) 1.5 mole CO2 and 1 mole CO
will be (2) 1 mole CO2 and 1 mole CO

(3) 1 mole CO2 and 1.5 mole CO
(1) !! ! " (2) !"" " ! #!
(4) 1.5 mole CO2 and 1.5 mole CO
! !! 245. Lewis acid among the following is
(3) "! " " (4) !"
!"!
238. For a weak acid degree of dissociation is 0.5,
(1) Cl– (2)
then find its ‘Ka’ if concentration is 0.1 M
(1) 2.5 × 10–2 (2) 1
(3) SiCl4 (4) CH3COOH
(3) 1.25 × 10–2 (4) 5 × 10–2
246. PbI2 has maximum solubility in 253. Which of the following cannot form its conjugate
(1) 0.1 M PbCl2 (2) 0.1 M KI base in aqueous medium?
(3) 0.01 M Cal2 (4) 0.01 M NaI (1) H2 !" !" (2) H2 !" #!
247. If Kc of the reaction, !"#$ %"#$ #!!!!!"
! &"#$ is ‘3’.
If ‘a’ mole of X and Y each are taken in a 1 L (3) H2 !" "! (4) All of these
vessel initially and at equilibrium number of moles 254. 50 mL of 0.2 N HCl solution is added to 50 mL of
of Z are ‘3’. The value of ‘a’ should be 0.1 N NaOH solution, pH of mixture will be
(1) 4.0 (2) 4.5 (1) 1.3
(3) 2.5 (4) 3.5
(2) 2.7
!!"
!
248. For the equilibrium, !(+$'() #!!
! !(+&'() (+%'() (3) 11.7
If D is the molar vapour density before (4) 11.2
dissociation and d is the observed vapour density
255. Which of the following will favour the formation of
at equilibrium, and the plot of degree of
ammonia in Haber’s process?
dissociation and the ratio D/d is given below.
The value of D/d at A is ( = degree of I. Increase in temperature
dissociation) II. Increase in pressure
III. Addition of catalyst
IV. Increase in concentration of N2 gas
(1) I & II (2) II & III
$
(3) I, II & III (4) II, III & IV
!"#
! SECTION - B
(1) 0 (2)
#
"
(3) (4) 1 In the following questions, a statement of assertion
#
249. The solubility of calcium fluoride in saturated
solution, if its solubility product is 3.2 × 10–11, is (1) If both Assertion & Reason are true and the
reason is the correct explanation of the
(1) 2.0 × 10–4 M (2) 12.0 × 10–3 M assertion, then mark (1).
(3) 0.2 × 10–4 M (4) 2.0 × 10–3 M
(2) If both Assertion & Reason are true but the
250. If the solubility of Zr3(PO4)4 (s) is S, then the reason is not the correct explanation of the
expression for solubility product will be assertion, then mark (2).
(1) 12 S7 (2) 108 S5 (3) If Assertion is true statement but Reason is
(3) 576 S7 (4) 6912 S7 false, then mark (3).
251. Which of the following is mismatched? (4) If both Assertion and Reason are false
statements, then mark (4).
(1) Milk : pH = 6.8
(2) Gastric juice : pH = 11.2 1. A : Aqueous solution of CH 3 COOH and
CH3COONa shows pH > 7.
(3) Human blood : pH = 7.4
(4) Human saliva : pH = 6.4 R : The phenomenon is attributed to cationic
hydrolysis.
252. 100 ml of 0.2 N HCl is added to 100 ml of
0.18 N NaOH and the whole volume is made one 2. A : pKa value of acetic acid is lower than that of
litre. The pH of resulting solution is phenol.
(1) 2.2 (2) 1.3 R : Resonance stabilization of phenoxide is more
(3) 2.7 (4) 4.50 than acetate ion.
3. A : If an inert gas is added to a dissociation 12. A : For a reaction, concentration quotient (Q) is
equilibrium keeping pressure constant the equal to K when the reaction is in equilibrium.
dissociation increases. R : If a catalyst is added to the reaction at
R : Inert gas exerts its own pressure in the equilibrium, the value of Q remains no longer
vessel. equal to K.
4. A : pH of boiling water is 6.6. This means that 13. A : Equilibrium constant of a reaction changes on
boiling water is not neutral. changing the stoichiometric coefficients of the
R : H + ion conc in boiling water decreases reaction.
because some water boils off.
!!!
"
R : The reaction, !"#! $%& #!!
! "! # " $%&
5. A : pH of a buffer solution changes with change
in temperature.
"""
# /
R : K w of water and dissociation constant and )&" ,4- $""
" )"&$ ,4- have same
"
(Ka & Kb) change with change in temperature.
equilibrium constant.
6. A : H2O(s) ! H 2O(l) ; the increase in pressure
decreases the melting point of ice. 14. A : The aqueous solution of CH3COONa is alkaline
in nature.
R : The above equilibrium exist only at melting
point of ice. R : Sodium acetate undergoes cationic hydrolysis.
7. A : A catalyst does not influence the values of
15. A : H2SO4 mainly dissociates into ! and !"#!# "
equilibrium constant.
in aqueous solution.
R : Catalyst influence the rate of both forward and
backward reaction equally. R : Ka of H2SO4 is very large than Ka of H2SO4.
1 2
8. A : pH value of 1L, 1M H2SO4 + 1L, 1M NaOH 16. A : At equilibrium KC = QC.

would be equal to 7.
R : When KC > QC, the reaction mainly goes in
R : N of H2SO4 would be lesser than NaOH. forward direction.
9. A : pH of salt solution of weak acid and weak 17. A : pH of NH 4 CN solution is independent of
base is independent of concentration of concentration.
solution. R : It is anionic hydrolysis.
R : Degree of hydrolysis of such salt solution is 18. A : A buffer solution has a capacity to resist the
independent of concentration. change in pH value on addition of small amount
10. A : The reaction for which n = 0 no effect of of acid or base to it.
pressure on equilibrium.
R : pH value of buffer solution does not change on
R : Change of pressure results in no change in dilution or on keeping for long.
the value of equilibrium constant.
19. A : H– acts as both Bronsted Lowry base as well
11. A : pH of solution of CH3COOH increases upon
addition of CH3COONa. as Lewis base.
R : On dilution, degree of ionisation of CH3COOH R : It acts as both H acceptor and lone pair
increases. donor.
!" !" !
Chapter 4
Electrochemistry
6. If for cell, H of reaction is – 285.8 kJ/mol,

SECTION - A
!!"#$$ = 1.23 V. Thermodynamic efficiency of fuel
cell is (n = 2)
1. 10 g of a fairly conc. solution of CuSO 4 is
(1) 50% (2) 83%
electrolysed using 0.01 faraday of electricity. The
weight of solution after electrolysis (3) 41% (4) 75%
(1) 9.6 g (2) 10 g 7. Product of electrolysis of aqueous CuCl2 using

platinum electrode at anode and cathode
(3) 9.75 g (4) 0.39 g respectively is
2. A half cell consist of a strip of cobalt dipped into (1) Cl2 and Cu
a 1 M solution of Co2+. If ammonium hydroxide is (2) O2 and Cu
added to the half cell, then what will be effect on
(3) O2 and H2
the emf of the cell? !"!"!! #"! #$%&& '(
(4) Cu2+ comes into solution and Cu at cathode
(1) Increases
8. Which of the following solution can be safely
(2) Decreases stored in copper vessel?
(3) Remains unchanged (1) ZnSO4 (2) AgNO3
(4) Cannot be predicted (3) FeSO4 (4) Both (1) & (3)
3. The reduction potential of hydrogen half cell will be 9. A galvanic cell is constructed by chromium
negative if electrode dipped in 0.1 M Cr2(SO4)3 and silver
electrode dipped in 0.1 M AgNO3. If resulting cell
(1) !!! = 1 atm and [H+] = 1 M is feasible, then its emf would be approximately
(2) !!! = 2 atm and [H+] = 2 M
!"!"# ! $"#
#$%& '( "!%& $ %&
#$) '*
(3) !!! = 6 atm and [H+] =3M
(1) 1.50 V (2) 3.09 V
(4) !!! = 1 atm and [H+] = 2 M
(3) 0.25 V (4) 4.70 V
4. The value of equilibrium constant for a feasible
10. In the electrolysis of H2O, 11.2 litre of H2 was
reaction is
liberated at cathode at NTP. How much O2 will be
(1) < 1 (2) Zero liberated at anode under the same condition?
(3) = 1 (4) > 1 (1) 11.2 L (2) 5.6 L
5. The ionisation constant of a weak electrolyte (HA) (3) 22.4 L (4) 16.8 L
is 36 × 10–4 while the equivalent conductance of 11. If the pressure of hydrogen gas is increased
its 100 M solution is 20.4 –1 cm 2 eq –1 . The from 1 atm to 100 atm, keeping the hydrogen ion
equivalent conductance of the electrolyte at infinite concentration constant at 1 M, the voltage of the
dilution will be hydrogen half cell at 25°C will be
(1) 3.4 × 103 (2) 3.4 × 102 (1) 0.0295 V (2) –0.0295 V
(3) 1000 (4) 5 × 10–2 (3) –0.059 V (4) 0.059 V
56 Electrochemistry Last Leap for NEET (Part-I)
12. The correct order of equivalent conductance at 20. 4 moles of electrons were transferred from anode
infinite dilution of NaCl, KCl, RbCl is to cathode in an experiment on electrolysis of
(1) NaCl > KCl > RbCl (2) RbCl > KCl > NaCl water. The total volume of the pure gases (at
STP) produced will be approximately
(3) NaCl > RbCl > KCl (4) KCl > NaCl > RbCl
(1) 22.4 L (2) 94.8 L
13. 9 g aluminium (Atomic weight 27) is deposited
(3) 56.2 L (4) 67.2 L
from aq. solution of its salt at cathode by passing
certain quantity of electric charge. The volume of 21. The volume of H2 gas at NTP obtained by passing
chlorine produced at S.T.P. by the same quantity 4 A through acidified H2O for 1930 second is
of charge will be (1) 0.896 L (2) 89.6 L
(1) 22.4 L (2) 11.2 L (3) 44.8 L (4) 0.0448 L
(3) 5.6 L (4) 44.8 L 22. Chemically, rust of iron is
14. If standard reduction potential of Cu2+/Cu
and (1) Hydrated ferrous oxide
Cu2+/Cu+1 is x and y respectively, then standard
(2) Hydrated ferric oxide
electrode potential of Cu+/Cu becomes
(3) Only ferric oxide
(1) x – y (2) 2(x – y)
(4) A mixture of ferric oxide with a little of Fe(OH)3
(3) 2x – y (4) 2x + y
23. If Eo, A+2/A = 0.34 ...(i)
!
15. If for BaCl2, NaOH and NaCl are p, q and
"
–1
B+3/B = –1.66 ...(ii)
r cm 2 mol –1 respectively, the equivalent
conductivity of Ba(OH)2 at infinite dilution is C/C– = 2.87 ...(iii)
D+2/D = –0.44 ...(iv)
! " #
(1) p + q – r (2) Correct order of reactivity is
$
! "# "$ (1) (ii) < (iv) < (iii) < (i) (2) (iii) < (i) < (iv) < (ii)
(3) (4) p + 2q – 2r
" (3) (ii) < (iv) < (i) < (iii) (4) (iii) < (i) < (ii) < (iv)
16. Number of Faraday’s required for conversion of 24. 1 mole of following solutions are electrolysed
one mole of KMnO4 according to the following completely
reaction
Al2(SO4)3 (molten), Bi2(SO4)3 (molten), CuSO4 (aq),
!"#$! ! ""#$! "#$" $" Ag2SO4 (aq)
(1) 8 F (2) 6 F Ratio of charge required is
(3) 4 F (4) 2 F (1) 3F : 3F : 2F : 2F (2) 6F : 6F : 2F : 2F
17. Passage of 3F of charge through aqueous solution (3) 3F : 3F : 4F : 4F (4) 6F : 6F : 1F : 1F

of AgNO3, CuSO4, Al(NO3)3 and NaCl respectively 25. The oxidation potential of a hydrogen electrode at
will deposite the metals in the ratio (molar) pH = 10 and PH2 = 1 atm is
(1) 1 : 2 : 3 : 1 (2) 6 : 3 : 2 : 6 (1) 0.50 V (2) 0.00 V
(3) 6 : 3 : 0 : 0 (4) 3 : 2 : 1 : 0 (3) + 0.59 V (4) 0.059 V
18. For which of the following electrolyte the value of 26. When 96500 coulomb of electricity is passed
m and eq are same?
through acidified water during electrolysis then
which of the following is correct?
(1) KNO3 (2) Ba(OH)2
(3) FeCl3 (4) Al2(SO4)3 "
(1) mole of H2 at cathode
!
19. A solution of Na 2SO 4 is electrolysed using Pt
electrodes. The products at the cathode and (2) 5.6 litre O2 at anode at STP
anode are respectively "
(3) mole of O2
(1) O2, H2 (2) H2, O2 !
(3) Na, SO2 (4) H2, SO2 (4) All of these
Last Leap for NEET (Part-I) Electrochemistry 57
27. 1 mole of Ag 2SO 4 solution is electrolysed by 34. In the electrolysis of copper chloride solution
passing a current of 1 amp for 965 s Moles of Ag+ using copper electrodes, the mass of cathode
left after electrolysis is increases by 3.175 g. At the anode,
(1) 0.99 (2) 1.98 (1) 560 ml of O2 at STP will be liberated
(3) 1.99 (4) 1.50 (2) 112 ml of Cl2 will liberate
28. The resistance of solution A is 100 and (3) 3.2 mol of copper metal will dissolve
resistance of solution B is 200 in same
(4) 0.05 mole of Cu will dissolve
conductivity cell. Equal volume of solution A and
B are mixed and taken in same cell. The 35. A cell contains two hydrogen electrodes. Anode is
resistance of mixture is in contact with a solution of 10–4 M H+ ions. E.M.F.
of cell is 0.118 V at 25°C. pH of solution at
(1) 133.33 (2) 166.66
cathode is
(3) 150 (4) 175
(1) 1 (2) 2
29. The specific conductance of saturated solution of
(3) 0 (4) –1
AgCl is 1.24 × 10–6 –1 cm–1. Molar conductance
at infinite dilution of AgCl is 119 –1 cm2 mol–1. 36. When electric current is passed through a cell
The solubility of AgCl in mole/L is having an electrolyte, the positive ions move
(1) 0.5 × 10–5 M (2) 1.04 × 10–5 M towards the cathode and negative ions towards
the anode. If the cathode is pulled out of this
(3) 1.5 × 10–5 M (4) 2 × 10–5 M solution
30. Emf of a cell Ni | Ni2+ (1M) || Au3+ (1M) | Au is .... (1) The positive ion and negative ions both will
if E° for Ni2+/Ni is –0.25 V, E° for Au3+/Au is 1.50 V move towards the anode
(1) + 1.25 V
(2) The positive ions will start moving towards the
(2) – 1.75 V anode, the negative ions will stop moving
(3) + 1.75 V (3) The negative ions will continue to move
(4) – 1.25 V towards the anode; the positive ion will stop
moving
31. In order to get greater value of emf of a cell
(4) The positive ions and negative ions will start
(1) Concentration of anode solution should be
moving randomly
lower than cathode solution
37. Four colourless salt solutions are placed in
(2) Concentration of anode solution should be
separate test tubes and a strip of copper is placed
higher than cathode solution
in each, which solution finally turns blue?
(3) Concentration of anode and cathode solution
(1) Pb(NO3)2
should be 2 M and 1 M respectively
(2) Zn(NO3)2
(4) None of these
(3) AgNO3
32. If E1° is standard electrode potential for Fe/Fe+2
and E2° is for Fe+2/Fe+3 and E3° for Fe/Fe+3 then (4) Cd(NO3)2
which of the following relation is correct? 38. What will be Equinohydrone at pH = 2 if
! #"#! "!" Eºquinohydrone = 1.30 V?
(1) " $ (2) !!$ "!#! !!"
!
!" !
(3) !!$ !#! !!" (4) !!$ #!!# "!"!
33. A cell is constructed as follows
#$$$%"!""$#$$$%&#
Pt : H2 (1 atm) | HA1 || HA2 | H2 (1 atm), if the pH
of two acid solution HA1 and HA2 are 5 and 3 !" !
respectively. The e.m.f. of the cell is
(1) 0.059 V (2) 0.0295 V (1) 1.36 V (2) 1.30 V
(3) 0.118 V (4) –0.118 V (3) 1.42 V (4) 1.20 V
39. Blocks of magnesium metal are often strapped to 44. The e.m.f of the cell
the steel walls of ocean going ships in order to Pt, H2(1atm) | HA(0.01M) || HCl(1.0M) | H2(1atm),
(1) Provide cathodic protection Pt is 0.295 V. The dissociation constant of the acid
HA is
(2) Provide sacrificial protection
(1) 1.0 × 10–4 (2) 1.0 × 10–6
(3) Provide barrier protection
(3) 1.0 × 10–8 (4) 1.0 × 10–5
(4) All of these
45. Which of the following is zero for concentration
40. When an aqueous solution of lithium chloride is
cell?
electrolysed using graphite electrodes
(1) pH of the resulting solution increases (1) ECell (2) ! !"##
(2) pH of the resulting solution decreases
(3) As the current flows, pH of the solution (3) Both ECell and ! !"## (4) Go
around the cathode increases
46. The maximum work that can be obtained from a
(4) pH of solution increases till it becomes neutral
cell having ! !"##
+ 1.10 volt and two electrons
41. Certain quantity of electricity is passed through two
voltameters connected in series and containing are involved in the cell reaction would be
XSO4 (aq) and Y 2SO4 (aq) respectively. If the (1) 45.75 kJ (2) 190 kJ
atomic masses of X and Y are in the ratio of 2 : 1,
the ratio of the masses of Y liberated to that of (3) 212.3 kJ (4) 119.50 kJ
X is 47. When 5F of charge is passed through CaSO4 (aq),
(1) 1 : 1 (2) 1 : 2 CuSO4 (aq), Al2(SO4)3 (molten) and Na2SO4 (molten)
then ratio of moles of substances obtained at
(3) 2 : 1 (4) 3 : 2 cathode are
42. The standard EMF of the cell reaction: (1) 1 : 1 : 2 : 3 (2) 1 : 2 : 3 : 4
% !#()& % !" ('& % !#! !"
(3) 3 : 3 : 2 : 6 (4) 2 : 3 : 4 : 5
$ $ ! $
is 1.02 V. The maximum work which can be 48. Electrolysis of water is done by passing 4F of
obtained by this cell charge. Total volume of gases obtained are
(1) 22.4 litre (2) 44.8 litre
(1) –98.43 kJ
(3) 67.2 litre (4) 50 litre
(2) –196.86 kJ
49. The reduction potential of hydrogen electrode in
(3) –198.43 kJ
0.01 M H2SO4 solution at 1 atm and 25ºC will be
(4) –205.0 kJ equal to
43. Given (1) 0 V (2) 0.1 V
A2+ + 2e– A(s); Eº = 0.10 V (3) – 0.591 V (4) – 0.0791 V
B+ + e– B(s); Eº = –2.71 V 50. The ratio of volumes at NTP of 1 equivalent of
X2(g) + 2e– 2X– ; Eº = 1.08 V each H2 and O2 gases formed by electrolysis of
H2O is
The incorrect statement among the following is
(1) 1 : 2 (2) 2 : 1
(1) X2(g) will oxidize both A & B
(3) 1 : 16 (4) 8 : 1
(2) A2+ will oxidize B
51. Which of the following expressions is correct?
(3) The reaction
(1) G° = –2.303 RT n FE°
2X– (1.0 M) + A2+ (1.0 M) X2 (1 atm) + A(s)
(2) G° = +n FE°
will be spontaneous
(3) G° = –n FE°
(4) The oxidising power of A2+, B+ and X2(g) is in
order B+ < A2+ < X2 (4) G° = –n F log KC
52. Out of Cu, Ag, Fe and Zn the metal which can 58. For the cell of type
displace all other atoms from their salt solutions is
H2 | H+ | | H+ | H2
(1) Ag (2) Cu
P1 C1 C2 P2
(3) Zn (4) Fe
Which of the following is not true?
53. The electronic conductance depends upon
(1) Standard electrode potential is always zero
(1) Temperature
(2) If the [H+] becomes same and partial pressure
(2) Nature of the metal becomes equal in two half cells, then cell
(3) Number of valence electron per atom stops working
(4) All of these (3) To have maximum cell potential C2 < C1 and
P1 > P2
54. When a graph is plotted between molar
conductivity and (conc)1/2 for a strong electrolyte, (4) To have feasible cell reaction, oxidation takes
then which of the following is observed correctly? place on electrode with lower concentration if
! partial pressure is same
(1) Intercept equal to "
59. During electrolysis of H 2 SO 4 at higher
(2) Slope equal to A
concentration the reaction which is preferred at
(3) The value of A (constant) depend upon type anode is
of electrolyte, i.e. CaCl2, CaSO4 are 1–2 and
1–1 electrolyte (1) !"#!"
# "!#$!" !$ "
%&'( %&'(
(4) All of these
(2) 2H2O(l) O2 + 4H+ + 4e–
55. Which of the following is mismatched?
(3) 2H+ H2
(1) Charge on 1 mole – 96487 C mol–1
(4) All of these
electron
60. Which of the following is mismatched regarding
(2) Reduction of 1 mole – 1 mole of e–
number of faradays of electricity required for
required
deposition of 1 mole of respective substance?
of Ag+ ion
(1) Nitrobenzene Aniline 6F
!"# $%# &' ()*(%+,-!
(3) Electrochemical –
./011 (2) Al2O3 Al 3F
equivalent
(3) FeO Fe2O3 1F
(4) 1 F of electricity liberate– 1 g equivalent of
any substance (4) MnO4– Mn+2 5F
always 61. Correct statement/s with respect to the mercury
56. If Eext is greater than the Ecell then cell is/are
(1) Electron flow from zinc to copper (1) Zinc-mercury amalgam is used as anode
(2) Electron flow from copper to zinc (2) Its cell potential remains constant as reaction
does not involved any ion in solution
(3) The reaction stops
(3) During oxidation at anode ZnO is produced
(4) All of the above can occur
(4) All of these
57. If the potential of hydrogen electrode in contact
with a solution is nearly –0.6 V, then the hydroxide 62. What will happen if no salt bridge is used in
ion concentration of the solution is electrochemical cell?
(1) 104 M (1) Inner circuit is not completed
(2) 1010 M (2) Current stops flowing
(3) 10–4 M (3) Outer circuit is not completed
(4) 10–10 M (4) Both (1) & (2)
63. Which statement is correct for equivalent 70. In the electrolytic cell, the flow of electron is from
conductance?
(1) Cathode to anode in solution
(1) It decreases for both strong and weak
(2) Cathode to anode through external supply
electrolytes on dilution
(2) It increases for strong electrolyte on dilution (3) Cathode to anode through internal supply
but decreases for weak electrolyte on dilution (4) Anode to cathode through external supply
(3) Remains unaffected on dilution 71. Ag(s) | AgNO3(0.001 M) | | AgNO3(0.01 M) | Ag(s). The
(4) It increases with dilution for strong and weak EMF of the cell will be
electrolyte
(1) 59.00 V (2) 5.90 V
64. What amount of current should be passed in the
(3) 0.059 V (4) 0.59 V
electrolysis of acidulated water, if hydrogen gas
is required at the rate of 1cc per second at NTP 72. 1.08 g of an element was displaced when a
condition? current of one ampere was passed through the
(1) 8.6 A (2) 10 A salt solution of the element for 16 minutes and
five seconds. The equivalent weight of the
(3) 24 A (4) 12 A element is
65. In which electrolysis pH of solution increases
(1) 108 (2) 5.4
using inert electrodes?
(1) AgNO3 solution (2) CuSO4 solution (3) 1.08 (4) 10.8
(3) NaCl solution (4) Na2SO4 solution 73. Which is mismatched?
66. If 6 faraday of electricity is passed through !"#

Al 2 O 3 (molten), CuSO 4 (aq), NaCl (molten), (1) Efficiency of fuel cell = $
%
separately. Amount of Al, Cu, Na deposited at
cathodes will be in molar ratio of (2) At equilibrium Ecell = 0
(1) 1 : 2 : 3 (2) 3 : 2 : 1
!"#$#%&
(3) 2 : 3 : 6 (4) 6 : 3 : 2 (3) At equilibrium '!"#$$ ()*+
,-
67. If pressure of hydrogen gas is increased from
10 atm to 1000 atm keeping hydrogen ion (4) Galvanic cell If Eext < Ecell, current
concentration constant at 1 M, the voltage of flow from anode to cathode
hydrogen half cell at 25°C will be 74. During the electrolysis of highly concentrated
(1) 0.118 V (2) 0.059 V H2SO4 solution, which is released at anode?
(3) 0.59 V (4) 0.0295 V (1) H2
68. On passing a current through AgNO3 solution, (2) O 2
5.4 g Ag is deposited at cathode (assume 100%
(3) S2O82–
current efficiency). If same current is passed
through CuSO4 for same time, only 0.8 g Cu is (4) Both (1) & (3)
deposited, then current efficiency in second
experiment is
(1) 25% (2) 50% !"# $! % $ %% $ % $! # !"
"&! % "#$! % "#$" % "&" %
(3) 75% (4) 100%
69. The standard reduction potential at 25°C of the Standard cell potential will be maximum when
reaction, 2H 2 O + 2e – H 2 + 2OH – is
(1) pH1 > pH2, P1 > P2
–0.8277, the equilibrium constant for the above
reaction is approximately? (2) pH2 > pH1, P2 > P1
(1) 10–20 (2) 10–14 (3) pH1 > pH2, P2 > P1

(3) 10–12 (4) 10–28 (4) It is always zero
76. From the following facts 82. During the process of electrolysis of brine
(i) 2X– + Y2 2Y– + X2 solution using inert electrode, which of the half
cell reaction will take place at anode?
(ii) 2W– + Y2 No reaction
(1) !" #"$% &! "
!"#'%
(iii) 2Z– + X2 2X– + Z2
! " %
Which of the following is true? (2) & '(") * &# '+)
$
(1) ! ! ! ! ! " !
!! "! #! "# $! "$ %! "% (3) "# $%&' "## $(' )! "
*
(2) ! ! ! !
!! "! #! "# $! "$ %! "% !
(4) "##$%& ## $'& (" $)*& (+! "
(3) ! ! ! ! (
!! "! $! "$ #! "# %! "%
83. The charge present on tin (Sn) if 7.42 g of
(4) ! ! ! ! metallic tin is deposited by passage of 24125 C,
!! "! %! "% #! "# $! "$
through a salt of tin in molten state [At wt of Sn
77. Which of the following is correct statement about
= 118]
concentration cell?
(1) +1 (2) +2
(1) !!"#$$ "
(3) +3 (4) +4
(2) Ecell 0
84. Which of the following option is true for galvanic
! cell?
(3) Ecell = 0.059 "#$ ! if C2 > C1
!" (1) Anode is positive electrode
(4) All of these (2) Salt bridge completes the electrical circuit
78. The equivalent conductance of 0.05 N monoprotic through metallic conductance
acid is 7.40 –1 cm 2 eq –1 at a given
(3) There is flow of current from anode to
temperature. If the equivalent conductance at cathode through outer circuit
infinite dilution is 390.0 –1 cm2 eq –1 then, the
(4) The electrolyte present in the salt bridge
dissociation constant of the acid will be
should have same ionic-mobility
(1) 1.8 × 10–5 (2) 1.8 × 10–7
85. Which of the following statement regarding redox
(3) 1.8 × 10–3 (4) 1.8 × 10–6 reaction is correct?
79. Thermodynamic efficiency of a cell is given by (1) Oxidant is a substance undergoing increase in
oxidation number by loss of electrons
! !"#
(1) " (2) $ (2) EMF of cell is the difference in the electrode
# %
potentials of two electrodes in a cell when
%&'
(3) ( (4) –nFE0 current flows through the cell
)
(3) Reduction involves loss of electrons
80. For completely reducing 20 ml of 0.5 M MnO4–
to Mn2+(aq). The charge required is (4) Galvanic cell is a device in which redox
change occurs decreases the free energy that
(1) 4825 C
appears as electrical energy
(2) 48250 C
86. !! ! "#$%%& and !! ! "#$%&
(3) 48.25 C "# $"# "# $"#
(4) 5 F On the basis of above data which statement is

incorrect?
81. Electrolysis product of aqueous NaF using
(1) Tl3+ is unstable in solution while Al3+ ion is
graphite electrodes
stable
(1) Anode : H2 ; Cathode : O2
(2) Aluminium has high tendency to make Al3+
(2) Anode : F2 ; Cathode : H2 ions
(3) Anode : O2 ; Cathode : H2 (3) Aluminium is less electropositive than thallium
(4) Anode : F2 ; Cathode : Na (4) Tl3+ is powerful oxidising agent
87. The standard emf of the cell 93. For the galvanic cell
Zn|Zn2+ (1M) || Cu2+(1M)|Cu Ag | AgCl(s), KCl(0.2 M) || KBr(0.001 M);
E° for Zn2+/Zn = –0.76 V, E° for Cu2+/Cu = + 0.34 V AgBr(s) | Ag.
(1) +1.10 V (2) –1.10 V Calculate the emf generated and assign correct
polarity to each electrode for the spontaneous
(3) –0.76 V (4) –0.42 V
process after taking into account the cell reaction
88. The feasible cell reaction, if E0 of Ni/Ni+2 = 0.25 at 25°C.
V and Mg/Mg+2 = 2.37 V is
Given ksp(AgCl) = 2.8 × 10–10
(1) !" #$ !" ! #$ ! ksp(AgBr) = 3.3 × 10–13
(1) 0.0371 volt (2) – 0.0371 volt
! !
(2) !" #$ !" #$
(3) 0.371 volt (4) – 0.371 volt
! ! 94. Given the following information, rank the ‘activity’
(3) !" #$ #$ !"
of the metals as reducing agents. Cr reacts with
(4) !" !
#$ ! !" #$ NiBr2 and CdBr2, but not with ZnBr2. Cd reacts
with NiBr2 but not with ZnBr2 or CrBr3.
89. Standard electrode potential can be calculated
(1) Zn > Cr > Cd > Ni (2) Ni > Cr > Cd > Zn
from
(3) Zn > Cr > Ni > Cd (4) Zn > Cd > Cr > Ni
(1) !!"#$$ !
!"%&'!(# ! !%)!(#
*+#(),-.!&,/ *+#(),-.!&,/
95. Which of the following statements is correct?
(1) Both conductance and molar conductance
(2) !!"#$$ !
!"%&'!(# !
!%)!(# increase on increasing concentration
*+#(),-.!&,/ *!01(),-.!&,/
(2) Both conductance and molar conductance
(3) $!"#$$ !
$"%&'!(# $!%)!(# decrease on increasing concentration
*+#(),-.!&,/ *!01(),-.!&,/
(3) Conductance increases but molar conductance
(4) Both (1) & (3) decreases on increasing concentration
90. Reducing power for alkali metals decided by (4) Conductance decreases but molar
Eo value. Eo value does not depend upon conductance increases on increasing
(1) Ionization energy (2) Internal energy concentration
(3) Hydration energy (4) Heat of sublimation 96. The equation for one of the half reactions in a
lead storage battery is
91. Given that
!
I2 + 2e– 2I– ; E° = 0.54 V ,-.! /& 0." $* ,-0." $&!.
Br2 + 2e– 2Br– ; E° = 1.09 V What happens to the properties of the electrolyte
Predict which of the following statement is true? as this cell discharge?
(1) I– ions will be able to reduce bromine Density pH

(2) Br– ions will be able to reduce iodine (1) Increase Increase
(3) Iodine will be able to reduce bromine (2) Increase Decrease
(4) Bromine will be able to reduce iodide ions (3) Decrease Decrease
92. The reaction occurring at the cathode during (4) Decrease Increase
charging of lead storage battery is
97. Ionic conductance of and SO4–2 at infinite
H+
(1) Pb2+ + 2e– Pb dilution are x and y s cm 2 eq –1 . Hence the
(2) Pb2+ + SO42– PbSO4 equivalent conductance of H2SO4 at dilution is
(3) Pb Pb2+ + 2e– (1) x + y (2) 2x + y
(4) PbSO4 + 2H2O 2PbO2 + 4H+ + SO42– + 2e– (3) x + 2y (4) x + 0.5y
98. Which of the following statement is incorrect? !
104. The !" !values for A, B, C and D are
#""
(1) Increase in temperature increases electrolyte –0.41 V, +1.57 V, + 0.77 V and +1.97 V
conductivity but decreases metallic respectively. For which one of these metals the
conductivity change in oxidation state from +2 to +3 is easiest?
(2) Increases in temperature increases reduction (1) A (2) B
electrode polential (3) C (4) D
(3) Increasing temperature increases rate of 105. If the reduction potential of x, y and z are in the
exothermic reactions order z > y > x, then
(4) Increasing temperature increases defects in (1) y can oxidise x– and not z–
NaCl
(2) y can oxidise z– and not x–
99. Which of the following are correct?
(3) y can oxidise both x– and z–
(1) Electrolysis of dil. NaOH solution gives H2 at (4) y– can reduce both x and z
cathode and O2 at anode
106. In a galvanic cell, flow of electrons is from
(2) Electrolysis of molten CaH2 produces H2 at
anode and calcium at cathode (1) Cathode to anode in solution
(2) Cathode to anode through external wire
(3) Electrolysis of CuSO4 solution using copper
electrode do not show any change in molarity (3) Cathode to anode through internal supply
of solution (4) Anode to cathode through external wire
(4) All of these 107. The standard oxidation potential E° for the half
100. A gas X at 1 atm is bubbled through a solution reactions are as
containing a mixture of 1 M Y– and 1 M Z– at Zn Zn2+ + 2e– E° = + 0.76 V
25°C. If the reduction potential of Z > Y > X; then
Fe Fe2+ + 2e– E° = + 0.41 V
(1) Y will oxidize X but not Z
The standard EMF for cell reaction
(2) Y will oxidize Z but not X Fe2+ + Zn Zn2+ + Fe is
(3) Y will oxidize both X and Z (1) – 0.35 V (2) + 0.35 V
(4) Y will reduce both X and Z (3) + 1.17 V (4) – 1.17 V
101. Which process occurs in the electrolysis of an 108. What current is to be passed for 0.25 second, for
aqueous solution of nickel chloride at nickel deposition of certain weight of metal which is
anode? equal to its electrochemical equivalent?
(1) Ni Ni+2 + 2e– (2) Ni+2 + 2e– Ni (1) 4 A (2) 5 A
(3) 2Cl– Cl2 + 2e– (4) 2H+ + 2e– H2 (3) 6 A (4) 2 A
102. A 4.0 molar aqueous solution of NaCl is prepared 109. Which ion has highest conductivity in aqueous
and 500 mL of this solution is electrolyzed. Find solution?
out number of moles of Cl2 gas evolved is (1) Li+ (2) Na+
(1) 1.0 mole (2) 2.0 mole (3) Mg2+ (4) Be2+
(3) 0.5 mole (4) 3.0 mole !!" #$%&'*+$)
!" !"# #$%&'(&$)
110. !" !"" !"
103. x, y, z are the equivalent conductance at infinite !$"
dilution for BaCl2, H2SO4 and HCl respectively.
The equivalent conductance of BaSO4 would be !! will be
(1) x + y – z (1) 0.45 V
(2) x – 2y + z (2) 0.225 V
(3) x + y – 2z (3) 0.15 V
(4) x – y – z (4) –0.225 V
111. The molar conductivity of 0.1 M NH4Cl is 20 s 117. The value of !!" #"!
cm2 mol–1. The molar conductivity of !"! and
(1) Is zero
Cl– at infinite dilution are 74 and 26 s cm2 mol–1
respectively. The dissociation constant of NH4Cl (2) Depends on concentration
will be (3) Is +ve always
(1) 10–2 (2) 2 × 10–3 (4) Is –ve always
(3) 4 × 10–3 (4) 5 × 10–3 118. For the cell, Zn|Zn2+(C1)||Zn2+ (C2)|Zn to show
112. Find the correct statement positive e.m.f., the relationship between C1 and
C2 should be
(1) KCl is used as salt bridge in Ag|Ag+||Au3+|Au
(2) 1 g equivalent of copper deposited by 2 (1) C1 – C2 < 0
Faraday (2) C2 – C1 < 0
(3) Molar conductivity of 0.1 M HCN increases if (3) C1C2 = 1
one litre water is added to it
(4) Fuel cells are galvanic cells in which heat &!
(4) & '
energy is directly converted into electrical "
energy
119. An electrochemical cell can behave like an
113. Standard electrode potentials of some metals are
electrolytic cell when
given below
(1) Eext > Ecell (2) Eext < Ecell
K+/K = – 2.93 V
(3) Ecell = 0 (4) Eext = Ecell
Ag+/Ag = 0.80 V
120. On electrolysis of aqueous solution of NaCl using
Hg2+/Hg = 0.79 V
Pt electrode
Mg2+/Mg = – 2.37 V
(1) pH of the solution will decrease
Cr3+/Cr = – 0.74 V
(2) pH of the solution will increase
Correct order of reducing power of these
(3) pH of the solution will remain constant
metals is
(4) pH of solution may increase or decrease
(1) Mg > K > Cr > Hg > Ag
121. Given :
(2) K > Mg > Cr > Hg > Ag
○
(3) Ag > Hg > Mg > Cr > K Mn2 + 2 ! Mn; E° = –1.18
○
(4) K > Mg > Cr > Ag > Hg Mn3 + ! Mn2 ; E° = 1.51
114. How much Faraday is required to produce 40 g ○
What is the E° value for Mn3 + 3 ! Mn?
Al from molten Al2O3?
(1) +2.8 V (2) –2.8 V
(1) 4.4 F (2) 3 F
(3) –0.28 V (4) +0.28 V
(3) 2.9 F (4) 1.5 F
122. Consider the following statements regarding
electrochemical cell
115. Which have highest !!!"# in the following?
Zn(s)|Zn2(+)(aq) || Cu2(+)(aq)|Cu(s)
(1) Na (2) F–
I. Electrons move from Zn to Cu
(3) Li (4) !" II. Concentration of Zn2(+) will increase and that
116. If Cu strip is put in the solution of AgNO3(aq) then of Cu2(+) will decrease when cell operates
(1) Nothing will happen III. When cell becomes dead, E°cell = 0
(2) Ag+ will be reduced Choose the correct statement(s)
(3) Cu will become Cu2+ (1) I, II & III (2) I & III
(4) Both (2) & (3) (3) I & II (4) II & III
123. Choose the correct statement(s) 129. The products of electrolysis of AgNO3(aq) using
Ag electrodes are
(1) E°cell is zero for concentration cell
(2) E cell = 0, when cell reaction approaches Cathode Anode
equilibrium
(1) Ag+ Ag+
(3) Specific conductance of all electrolytes
decreases on dilution (2) Ag O2
(4) All are correct (3) Ag Ag+

124. Consider the following EMF diagram for Fe, (4) Ag+ Ag
!"!# $ #"%% $
!"#!&
)
'
!"(& '
!"!& '
130. Four faraday of electricity were passed through
aqueous solutions of AgNO3, CuSO4 and PbCl4
the value for ! will be connected in series, using inert electrode. The
!"#!"
$
#
!"!" #
ratio of number of moles of Ag, Cu and Pb
(1) 7.37 V (2) 3.685 V deposited will be
(3) 2.456 V (4) 1.843 V (1) 1 : 2 : 4
125. The amount of electricity required to obtain 10
(2) 4 : 3 : 1
mole of Al from molten AlCl3 is
(1) 10 F (2) 60 F (3) 4 : 2 : 1
(3) 20 F (4) 30 F (4) 1 : 2 : 3

126. During rusting following redox reaction takes 131. Cathodic and anodic product when dilute
place: aqueous solution of Na2SO4 is electrolysed using
inert electrode are respectively
!
"#! "
$# %& ##$ %&#! " ' ( !)*+ ,
" (1) H2, O2
What is G° of the reaction? (2) Na, O2
(1) –322.31 kJ (2) –161.155 kJ
(3) O2, H2O
(3) 322.31 kJ (4) +161.155 kJ
(4) Na, SO2
127. Oxide that can be reduce by hydrogen
132. The reduction potential of hydrogen electrode at
(1) Na2O
5 atm and pH = 2 is
(2) MgO
(1) – 0.14 volt
(3) Al2O3
(4) CuO (2) –0.047 volt
128. The rusting of iron takes place by these two half (3) + 0.39 volt
reactions
(4) + 0.08 volt
!
"# "$ %! #! %&'( ; E° = 1.23 V 133. If !!"#$%&'() of I2 < Br2 < Cl2, then Br2(l) can
"
!" !
#" !"$%& ; E° = – 0.44 V (1) Oxidise I– to I2 and Cl– to Cl2
(2) Oxidise only CI– to CI2

The G° for the net process is
(1) – 322 kJ/mol (2) – 161 kJ/mol (3) Oxidise only I– to I2
(3) – 152 kJ/mol (4) – 76 kJ/mol (4) Cannot oxidise (I–) and (CI–)
4. A : In electrolysis, the amount of charge required

SECTION - B
to deposit 1 mole of Ag and Zn are different.
R : Atomic weights of Ag and Zn are different.
(A) is followed by a statement of reason (R) 5. A : A correct electrochemical cell can be set up
only if redox reaction is spontaneous in
(1) If both Assertion & Reason are true and the forward direction.
assertion, then mark (1). R : A reaction is spontaneous in forward direction
if Ecell is positive.
reason is not the correct explanation of the 6. A : The half cell potential of hydrogen electrode at
assertion, then mark (2). pH = 10 is 0.59 V.
(3) If Assertion is true statement but Reason is R : Half cell potential do not depend upon
false, then mark (3). temperature.
(4) If both Assertion and Reason are false 7. A : For the reaction, 1 1# 1! is not always
statements, then mark (4). valid.
1. A : Corrosion of metals is essentially an R : For the reaction ! !! !" is always
electrochemical phenomenon. valid.
R : Corrosion of iron metal can be prevented by
8. A : Electrolysis of aqueous FeSO4 gives Fe at
galvanization.
cathode in preference to H2.
2. A : !!"#$$ is zero for concentration cell. R : %"! #" !
%$%!
! #$%
R: G is zero for working concentration cell. 9. A : Specific conductivity decreases on dilution.

3. A : In galvanic cell anode is negative electrode. R : Number of ions per unit volume decreases on
R : Anode is the source of electron. dilution.
!" !" !
Chapter 5
p-Block Elements (Group 15-18)

7. Oxidation of I– with MnO4– in acidic medium gives
SECTION - A
product
Objective Type Questions (1) IO3– (2) I2
1. Which of the following compound is a tribasic (3) IO4– (4) IO–
acid?
8. Select the correct statement
(1) H3PO2 (2) H3PO4 (1) H3PO4 is tribasic and reducing
(3) H3PO3 (4) H4P2O7 (2) H3PO3 is dibasic and reducing
2. The correct increasing order of enthalpy of (3) H3PO3 is dibasic and non-reducing
vaporisation is
(4) H3PO4 is dibasic and non-reducing
(1) NH3, PH3, AsH3 (2) AsH3, PH3, NH3
9. Thermal stability of hydrides of 15th group follows
(3) NH3, AsH3, PH3 (4) PH3, AsH3, NH3 the order
3. Which of the following is the strongest acid? (1) NH3 > PH3 > AsH3 > SbH3
(1) HClO (2) HClO2 (2) PH3 < AsH3 < SbH3 < NH3
(3) HClO3 (4) HClO4 (3) NH3 < AsH3 < PH3 < SbH3
4. Which of the following cannot be hydrolysed? (4) NH3 < PH3 < AsH3 < SbH3
10. Which of the following cannot be hydrolysed?
(1) NF3 (2) PCl3
(1) PCl3 (2) SiCl4
(3) SbCl3 (4) NCl3
(3) NF3 (4) All of these
5. Find the correct statement
11. Sulphuric acid is used
(1) ICl is more reactive than I2
(1) In lead storage batteries
(2) All hydrolysis of XeF6 are redox reactions (2) In making fertilizers
(3) HCl reacts with finely powdered iron and ferric (3) As a dehydrating agent
chloride is formed
(4) All of these
(4) ! !! !!" for H2SO4 12. Which of the following is responsible for turning
6. Which is incorrect? moist starch iodide paper blue when it is brought in
contact with O3?
(1) HClO > HBrO > HIO – Acidic
strength (1) Liberation of iodine (2) Liberation of O2
(2) HClO > HClO2 > HClO3 > HClO4 – Oxidising (3) Formation of alkali (4) All of these
power 13. The correct acidic nature order is
(3) Cl2 > F2 > Br2 > I2 – Enthalpy of (1) HClO2 < HClO3 < HClO4
dissociation (2) H3PO4 < H3PO3 < H3PO2
(4) H2O > H2Te > H2Se > H2S – Boiling (3) CH4 < NH3 < H2O < HF
point (4) All of these
68 p-Block Elements (Group 15-18) Last Leap for NEET (Part-I)
14. SO2 acts as an oxidant when reacts with 23. The oxide of nitrogen formed when Zn reacts with
hot and conc. HNO3 is
(1) Acidic K2Cr2O7 (2) Acidic KMnO4
(1) N2O
(3) H2S (4) All of these
(2) NO2
15. Colour of iodine solution is discharged by shaking
(3) NO
it with an aqueous solution of
(4) N2O5
(1) H2SO4 (2) K2S
(3) Na2S2O3 (4) Na2SO4
(1) N2 diffuses faster than O2
16. The halogen which gives O2 with hot conc. NaOH
(2) Solid PCl 5 exist as tetrahedral cation and
is octahedral anion
(1) F2 (2) Cl2 (3) NO2 has the tendency to dimerise
(3) Br2 (4) I2 (4) HNO 3 exists as non-planar molecule in
gaseous state
17. Which is incorrect?
25. The incorrect statement is
(1) SbH3 > AsH3 > PH3 (Boiling point)
(1) (CH3)3N is pyramidal but (SiH3)3N is planar
(2) BiH3 > SbH3 > AsH3 > PH3
(2) Both N2O and N2O5 are neutral oxides
(Reducing) character
(3) White phosphorus consists of discrete
(3) PH3 > AsH3 > SbH3 > NH3 > BiH3 (Volatility) tetrahedral molecule, P4
(4) NH3 > PH3 > AsH3 > SbH3 (HEH angle (°)) (4) Fluorine does not show disproportionation
18. XeF4 + H2O A [Complete hydrolysis] reaction
26. Which of the following is mixed anhydride?
Hybridisation and shape of xenon product A is
(1) NO2 (2) N2O5
(1) sp3d, T-shaped
(3) SO2 (4) SO3
(2) sp3d, see-saw
27. Which of the following has maximum
(3) sp3d2, square pyramidal electronegative nature?
(4) sp3, pyramidal (1) F– (2) Cl
19. Total number of P – O – P bonds and bonds in (3) Br+ (4) I+
P4O10 is 28. BF3 is Lewis acid while NH3 is Lewis base. If they
combine, the hybrid state of B and N atom in
(1) 6, 14 (2) 8, 14
adduct is
(3) 6, 16 (4) 4, 16 (1) N is sp3, tetrahedral, B is sp3 tetrahedral
20. Select the correct statement (2) N is sp2, planar, B is sp3 tetrahedral
(1) H3PO2 is tribasic and non-reducing (3) N is sp3, tetrahedral, B is sp2 planar
(2) H3PO3 can form two type of salts (4) N is sp2, pyramidal, B is sp3 tetrahedral
(3) In solid state, PCl5 exists as an ionic solid 29. The correct order of boiling points of noble gases is
(4) Both (2) & (3) (1) He < Ne < Ar < Kr < Xe
(2) He > Ne > Ar > Kr > Xe
21. Which of the following oxide of nitrogen is
coloured? (3) He < Ne < Kr < Ar < Xe
(1) NO2 (2) N2O5 (4) He < Ne < Ar < Xe < Kr
(3) N2O4 (4) All of these &' % "#$ !

30. #$ "0 !
/ .) '- )*+),, (
22. Which of the following compound does not have Number of lone pairs on the central element of ‘Z’
d -p bonding? is
(1) H3PO4 (2) HClO4 (1) One (2) Two
(3) H2SO4 (4) H2CO3 (3) Three (4) Zero
Last Leap for NEET (Part-I) p-Block Elements (Group 15-18) 69
31. During etching of glass by hydrofluoric acid, which 40. Which of the following is correct structure of S2Cl2?
chemical compound is formed?
$% #$
(1) H2SiF6 (2) H2SiO6 !"!
(1) !"#"! (2)
(3) H2F2 (4) F2O $% #$
%&'(
32. NO2 is released on heating
(3) !"#$#$#!" (4) Cl = S = S = Cl
(1) Pb(NO3)2 (2) KNO3 %&'(
(3) NaNO2 (4) NaNO3 41. The number of P–O–H links in orthophosphoric acid
33. The correct statement about the oxoacids of is
halogens is (1) 2 (2) 4
(1) All of them are good reducing agents (3) 3 (4) 1
(2) All of them are monobasic 42. Which of the following hydride is best reducing
(3) They may be monobasic and polybasic hydride?
(4) They have general formula HXO (1) NH3 (2) PH3
34. In which of the following properties, white (3) SbH3 (4) BiH3
phosphorus resembles red phosphorus? 43. A white precipitate is obtained on hydrolysis of
(1) Reaction with caustic alkali (1) PCl5 (2) NCl3
(2) Burning in air (3) BiCl3 (4) AsCl3
(3) Dissolution in CS2 44. In the solid state, SO3 exist as
(4) Chemiluminescence (1) Cyclic tetramer (2) Cyclic trimer
35. Which of the following is formed when phosphoric (3) Discrete molecule (4) Dimer
acid is heated to 600°C? 45. XeF6 on partial hydrolysis gives
(1) HPO3 (2) H4P2O7 (1) XeOF2 (2) XeOF4
(3) PH3 and P2O5 (4) P2O5 and H2O (3) XeO3 (4) XeF2
36. Among chalcogen, the highest tendency to form 46. Cyclo S6 exist in the
X–(g) ion is exhibited by
(1) Boat form
(1) Oxygen (2) Sulphur
(2) Chair form
(3) Tellurium (4) Selenium
(3) Puckered ring structure
37. When droplets of concentrated H2SO4 fall on cotton
fabric, the spots blacken with the appearance of (4) Octahedral arrangement
hole. This is because 47. The starting material for the preparation of
(1) H2SO4 burns the cotton cross-linked silicones is
(2) Causes cotton to form respective sulphates (1) R2SiCl2 (2) R3SiCl
(3) Removes water from the fabric (3) RSiCl3 (4) SiR4
(4) Heats up the cotton 48. Which among the following oxides is basic in
nature?
38. The halogen having five vacant orbitals in the
outermost shell belongs to (1) P4O6 (2) As4O6
(1) 3rd period (2) 4th period (3) Sb4O6 (4) Bi2O3
(3) 2nd period (4) 5th period 49. Which of the following halogen does not
disproportionate with hot and concentrated NaOH
39. Which halogen acid has highest percentage ionic solution?
character?
(1) Cl2 (2) Br2
(1) HI (2) HF
(3) I2 (4) F2
(3) HCl (4) HBr
50. Which of the following is the correct sequence of 59. Which of the following compound of Xe is
increasing electron affinity among oxygen family isostructural with ICl4– and BrO3– respectively?
elements?
(1) XeF4, XeO3 (2) XeO3, XeF4
(1) Te < Se < O < S (2) O < Te < Se < S (3) XeO3, XeF2 (4) XeF4, XeF2
(3) Se < Te < O < S (4) O < Se < Te < S 60. Which of the following are not correctly arranged
51. Correct statement about NCl3 is that as per the property given in front of it?
(1) Its hydrolysis produces HNO3 and HCl (1) H2Te > H2Se ....... acidic character
(2) Its hydrolysis produces NH3 and HCl (2) Br2 > F2 ...... enthalpy of dissociation
(3) NH3 >PH3 ......... basic nature
(3) Its hydrolysis produces NH3 and HOCl
(4) TlCl3 > InCl3 ..... stability
(4) It can’t be hydrolysed
61. Most acidic oxide among the following is
52. The basicity of hypophosphorus acid and
hybridisation of ‘P’-atom in it, is (1) N2O5 (2) P2O5
(3) N2O4 (4) As2O3
(1) 3, sp3 (2) 3, sp2
62. What is the crystalline form of PBr5?
(3) 2, sp2 (4) 1, sp3
(1) [PBr4]+[PBr6]– (2) [PBr3]+[Br2]–
53. Correct order of acidity of some hydrides is
(3) [PBr4]+[Br]– (4) [PBr3]+[PBr7]–
(1) NH3 < PH3 < H2O < H2S
63. The number of d -p bonds in SO3 is
(2) PH3 < NH3 < H2S < H2O
(1) 2 (2) 3
(3) PH3 < NH3 < H2O < H2 S (3) 4 (4) 5
(4) NH3 < PH3 < H2S < H2O 64. Very pure nitrogen gas is prepared by heating
%'! %& (1) NH4NO2 (2) (NH4)2Cr2O7
54. &'(( #$% ! "! + SF4 + NaCl
"#$!
(3) Ba(N3)2 (4) N2H4
The product ‘X’ will be
65. Which of the following is a mixed anhydride?
(1) S (2) SCl4
(1) Cl2O5 (2) N2O5
(3) S2Cl2 (4) S2Cl4
(3) Cl2O7 (4) NO2
55. The reaction which produces a green coloured 66. Incorrect statement about P4O10 molecule is
product is
(1) It has six P – O – P bonds
(1) !"#! $" %&"'# (2) !"!!#" (2) It is hydrolysed to H3PO4 and H4P2O7
(3) !"#$! (4) !"#$%! &" (3) It does not contain P– P bond
(4) All of these
56. BiCl3 hydrolysis to give a white cloudy precipitate
of 67. Which of the following have non-linear shape?
(1) BiCl3 (2) HBiO3 (1) XeF2 (2) KrF2
(3) BiOCl (4) Bi (3) I3– (4) OF2

68. Which one of the following is not a pseudo halide?
57. Hypophosphorus acid is also known as
(1) CNO– (2) RCOO–
(1) Phosphonic acid (2) Phosphinic acid
(3) Diphosphoric acid (4) Diphosphonic acid (3) OCN– (4) %!
58. Chlorine on reaction with cold water gives 69. The number of and bonds in P4O6 is
(1) Chlorous acid (1) 12 , 3 (2) 12 , 0
(2) Chloric acid (3) 12 , 5 (4) 15 , 12

70. Most polar among the following is
(3) Hypochlorous acid
(1) HF (2) HCl
(4) Perchloric acid
(3) HBr (4) HI
71. Ammonia on reaction with hypochlorite ion 80. On heating, orthophosphorous acid
produces disproportionates to give
(1) NO (2) N2O (1) H3PO4 and H2O (2) H3PO2 and PH3
(3) N2H4 (4) NO2 (3) H3PO2 and H2O (4) H3PO4 and PH3
72. Which of the following reaction would result in the 81. When XeF4 react with SbF5 the ions formed are
liberation of Cl2 gas?
(1) !"#$% &'!()$!% (2) !"#$!% &'!()$"%
(i) !"# ! $% &
(3) !"#$!% ( !&'$"% (4) !"#$!% & !'($"%
(ii) $% &# 82. Correct acidic nature order is

(1) H3PO2 > H3PO3 > H3PO4
(iii) !"#! $" (2) H3PO4 > H3PO3 > H3PO2
(3) H3PO4 > H3PO2 > H3PO3
(iv) !"#$ %!&' "
(4) H3PO3 > H3PO2 > H3PO4
(1) i, ii (2) i, iii
83. Which of the following metal forms NH4NO3 when
(3) i, iii, iv (4) ii, iv react with very dil. HNO3?
73. Which one of the following species is likely to (1) Ni (2) Cu
have a linear structure?
(3) Mg (4) Fe
(1) SO2 (2) NO2+
(3) CO32– (4) SO42– 84. The number of S = O bonds in H2S2O8 is
74. Which of the following on heating would give (1) 1 (2) 2
laughing gas? (3) 3 (4) 4
(1) NaNO2 + NH4Cl (2) (NH4)2SO4
85. The correct order of Lewis base is
(3) NH4NO3 (4) Cu + HNO3 (conc.)
(1) NF3 > NCl3 > NBr3 > NI3
75. Hypo on treatment with I2 forms
(2) NCl3 > NF3 > NBr3 > NI3
(1) Na2SO4 + S (2) Na2S4O6
(3) Na2SO3 (4) Na2S (3) NF3 > NBr3 > NCl3 > NI3
76. Which of the following is used for the preparation of (4) NI3 > NBr3 > NCl3 > NF3
fluorine by Whytlaw Gray electrolytic method? 86. The product formed when Cl2 is treated with excess
(1) KF (aq.) (2) HF (aq.) of NH3
(3) KHF2 (molten) (4) NH4F (1) N2 and HCl (2) HClO3 and N2
77. NH3 reacts with excess of Cl2 to give (3) N2 and NH4Cl (4) NCl3 and HCl
(1) NH4Cl (2) N2
87. PCI5 in solid state exists as
(3) NCl3 (4) NCl5
(1) [PCl3] [Cl2] (2) [PCl4]+ [Cl–]
78. The van der Waals forces are greatest in
(3) [PCI4]+ [PCI6]– (4) All of these
(1) Neon (2) Argon
88. The basicity of pyrophosphorus acid (H4P2O5) is
(3) Krypton (4) Xenon
(1) 4 (2) 3
!"# !$# %
79. !"## $%& &&' ()*
& #& % ; X is
(3) 2 (4) 1
(1) Ammonium carbonate
89. The strongest oxidizing agent among the following
(2) Urea is
(3) Biurate (1) ClO4– (2) lO4–
(4) N2O2 (3) H2S (4) BrO4–
90. Which of the following acid has S-S bond? 100. Which molecule has minimum bond angle?
(1) H2S2O8 (2) H2S2O7 (1) NH3 (2) H2O
(3) H2S2O6 (4) All of these (3) AsH3 (4) CH4
91. The correct bond energy order of halogen is 101. The shape of XeF6 is
(1) Cl2 > Br2 > F2 > I2 (2) Cl2 > F2 > Br2 > I2 (1) Octahedral
(3) F2 > Cl2 > Br2 > I2 (4) F2 > Cl2 > I2 > Br2 (2) Pentagonal bipyramidal
(3) Distorted octahedral
92. The correct statement is
(4) Square pyramidal
(1) SO2 bleaches by reduction
102. From which compound iodine displaces chlorine?
(2) Cl2 bleaches by oxidation
(1) KCl (2) MgCl2
(3) O3 bleaches by oxidation
(3) NaCl (4) KClO3
(4) All of these
103. Identify the incorrect statements among the
93. Which of the following is incorrect? following
(1) PBr5 contains [PBr4+] cation (1) PH3 is a colourless gas with rotten fish smell
(2) Dipole moment of SO3 gas = 0 (2) Cl2 reacts with excess of NH3 to give N2 and
(3) O2, NO2 are paramagnetic molecule NH4Cl
(4) H3PO4 is stronger acid than H3PO2 (3) Br2 reacts with hot and conc. NaOH to give
94. Species having same hybridization and same NaBr, NaBrO2 and H2O
geometry is (4) Ozone oxidises SO2 to SO3
(1) XeF2, CO2 (2) XeF4, [Ni(CO)4] 104. In ring test of nitrate ion, charge of Fe and NO in
(3) ClF3, NH3 (4) NH3, PCl3 brown ring complex is respectively
95. Heating ammonium dichromate and ammonium (1) +2 and 0 (2) +1 and +1
carbonate produces respectively (3) +1 and 0 (4) +2 and –1
(1) N2, NH3 (2) N2, N2 105. Find the correct match
(3) NH3, NH3 (4) N2, NO2 (1) Yellow P4 – Bond angle – 109°28
96. Among the given oxo acids, the acid having (2) Cl2 – Disproportionates with hot
highest Ka is conc. NaOH
(1) HClO3 (2) HBrO3 (3) HOCl – Weaker acid than HOBr
(3) HIO3 (4) All have equal Ka (4) ClF3 – sp3d2 hybridization
97. Select the incorrect statement about N2O5 106. One mole of calcium phosphide on treatment with
(1) It is anhydride of HNO3 excess of water gives
(2) It is a powerful oxidizing agent (1) One mole of phosphine
(3) It contains one [N O] bond (2) Two moles of phosphoric acid
(4) All of these (3) Two moles of phosphine
98. Colour of iodine solution is disappeared by shaking (4) One mole of phosphorus pentoxide
it with aqueous solution of 107. Which of the following pairs of species react with
(1) H2SO4 (2) PbSO4 water to produce colourless gas that gives white
(3) Na2S2O3 (4) Na2SO4 fumes with HCl?
99. The number of P–O–P bonds in cyclic (1) Calcium chloride and calcium cyanamide
metaphosphoric acid is (2) Calcium carbide and aluminium carbide
(1) Zero (2) Two (3) Magnesium nitride and calcium nitride
(3) Three (4) Four (4) Calcium carbide and calcium nitride
108. Which of the following is correct about Contact 116. Most volatile halogen acid is
process for the manufacture of sulphuric acid? (1) HCl (2) HBr
a. V2O5 is used for catalytic oxidation of SO2 to (3) HI (4) HF
SO3
117. Least bond angle is possesed by
b. SO2 is produced which is absorbed in water
(1) H2O
c. SO3 is directly absorbed in water (2) NH3
d. SO3 is absorbed in concentrated sulphuric acid (3) CH4
(1) Only c (2) c & d (4) CO2
(3) a & d (4) a & b 118. Correct order of boiling point is
109. How many P – H and O – H bonds respectively (1) H2O < H2S < H2Se < H2Te
are present in H4P2O7 molecule?
(2) H2S < H2O < H2Se < H2Te
(1) 1 & 3 (2) 0 & 4
(3) H2S < H2Se < H2O < H2Te
(3) 4 & 0 (4) 2 & 3
(4) H2S < H2Se < H2Te < H2O
110. HI cannot be prepared by the action of KI and
119. Which of the following cannot be used for drying
H2SO4 because
NH3?
(1) HI is much weaker acid than H2SO4 (1) HCl (2) H2SO4
(2) HI gets oxidised by H2SO4 to I2 (3) P4O10 (4) All of these
(3) H2SO4 is a dehydrating reagent 120. Choose the incorrect match :
(4) HI is less volatile than H2SO4 Molecule Hybridisation Shape
111. Which of the following reaction is not feasible? (1) XeF6 sp3d2 Octahedral
(1) 2NaBr + Cl2 2NaCl + Br2 (2) XeO3 sp3 Pyramidal
(2) ClF3 + H2O HClO2 + HF (3) XeF4 sp3d2 Square planar
(3) 2KIO3 + Cl2 2KClO3 + I2 (4) XeOF4 sp3d2 Square pyramidal
(4) All are feasible 121. Which of the following match is incorrect?
112. Which of the following is the anhydride of HClO4? Molecule/Ion Shape Bond angle
(1) Cl2O (2) ClO2
(1) !"! Tetrahedral 109°28
(3) Cl2O7 (4) Cl2O6
113. Complete hydrolysis of XeF6 forms a compound ‘A’ (2) !"#"! Tetrahedral 109°28
which explodes violently in dry state. ‘A’ is
(1) XeO3 (2) XeO2F2 (3) !"##! Pyramidal 109°28
(3) XeOF4 (4) XeF4
(4) !""! Trigonal planar 120°
114. XeF2 reacts with PF5 to form
(1) [XeF]+ [PF6]– (2) [XeF3]+ [PF4]– 122. Correct order among the given below is
(3) [XeF]– [PF6]+ (4) XeF4 I. H+ < H < H– (Atomic/ionic radii)
115. The strongest oxidizing agent among the following II. O<N<F (First ionization energy)
is
III. Br2 < Cl2 < F2 (Oxidizing power)
(1) !"#! IV. Br2 < Cl2 < F2 (Bond energy)
(1) I, II
(2) !"!
(2) II, III
(3) $%#! (3) I, II, III
(4) All have same oxidizing power (4) I, II, III, IV
123. Which of the following is not a component of

SECTION - B
bleaching powder?
(1) CaOCl
(2) CaCl2
(3) Ca(ClO)2 (1) If both Assertion & Reason are true and the
(4) CaOCl2 reason is the correct explanation of the
124. Catalyst used in preparation of HNO3 by Ostwald
process is (2) If both Assertion & Reason are true but the
(1) Pt assertion, then mark (2).
(2) Fe (3) If Assertion is true statement but Reason is
(3) Fe2O3 false, then mark (3).
(4) V2O5 (4) If both Assertion and Reason are false
125. For the trihalides of phosphorus the order of bond
angle would be 1. A : Fluorine is more reactive than chlorine.
(1) F > Cl > Br > I R : F – F bond has low bond dissociation energy
than Cl – Cl.
(2) I > Br > Cl > F
(3) Cl > F > Br > I 2. A : PF5 and IF5 have similar shapes.
(4) Cl > Br > F > I R : PF5 and IF5 are interhalogen compounds.
126. In which of the following bond angle is minimum? 3. A : Helium does not form clathrates.
(1) H2S R : Helium has the smallest atomic size among all
(2) I3– the elements of group 18 & can escape from
the cavities.
(3) !"!
4. A : When PCl3 is hydrolysed then tribasic acid of
(4) H2O phosphorous is formed.
127. Find the incorrect match R : H3PO3 is a tribasic acid.
(1) N2O5(s) – Ionic compound
5. A : Oxidizing power are in order
(2) NO(g) at low temperature – Paramagnetic
nature BrO4– > IO4– > ClO4–
(3) PCl5(s) – Ionic compound R : Standard reduction potential for perhalates will
(4) XeOF4 – Polar molecule be in same order.
128. Which of the following is the correct order of the 6. A : N cannot form NCl5.
melting point of hydrogen halides?
R : P cannot form PH5.
(1) HF > HCl > HBr > HI
7. A : Partial hydrolysis of XeF 6 is not a redox
(2) HF > HI > HBr > HCl reaction.
(3) HI > HF > HBr > HCl R : Complete hydrolysis of XeF 6 is a redox
(4) HI > HF > HCl > HBr reaction.
!" !" !
Chapter 6
Organic Chemistry : Some Basic Principles
and Techniques
5. The C – Cl bond in chlorobenzene as compared

SECTION - A
with C – Cl bond in ethyl chloride is
(1) Shorter and stronger
1. In which of the following compounds, hydrogen
(2) Shorter and weaker
shown is most acidic?
(3) Longer and weaker
" (4) Longer and stronger
! !
6. Which alkene will show maximum
(1) (2) ! hyperconjugation?
" (1) CH3 – CH = CH2
" (2) CH3CH2 – CH = CH2
"
#"!
(3) (4) "
!
!
(3) !"!#$#!#$#!"#%#!""
2. Which of the following is most acidic? !"!
!""# !""# !"!
(4) !"!#$#!#$#!"#%#!""
(1) (2) !"!
7. The correct order of acidic strength is
!#!
!" !" !"
(3) HCOOH (4) CH3CH2COOH
3. Which of the following has highest value of pKa?
!#"! $""
(1) C6H5CH2NH2 % %% %%%
(2) C6H5NHC6H5 (1) II > I > III (2) II > III > I
(3) C6H5CONH2 (3) I > III > II (4) I > II > III
(4) (C6H5)3N 8. The correct increasing order of stability is
4. The number of chiral carbon in mannose and !

fructose in open chain structures are respectively
(1) 4 and 3
I.
(2) 3 and 3
(3) 4 and 4
(4) 3 and 4 ! !
76 Organic Chemistry : Some Basic Principles and Techniques Last Leap for NEET (Part-I)
12. If the rear carbon atom in the given conformer is

II. ! rotated by 60° then the conformer obtained would be
"!!
! !
III. !
! !
!
(1) Staggered (2) Eclipsed
IV. !"!#$#!#$#!"!
(3) Skew (4) Both (2) & (3)
!"!
13. Select the correct order of basic strength in
(1) I < II < III < IV (2) IV < III < II < I aqueous solution
(3) II < III < I < IV (4) III < I < II < IV (1) NH3 < (C2H5)2NH < C2H5NH2 < (C2H5)3N
9. Lowest and highest acidic character is associated (2) C2H5NH2 < NH3 < (C2H5)3N < (C2H5)2NH
respectively with the compounds
(3) NH3 < C2H5NH2 < (C2H5)3N < (C2H5)2NH
!" !" %!!" !"
(4) NH3 < (C2H5)2NH < (C2H5)3N < C2H5NH2
14. Which among the following compounds behave
both as an electrophile as well as nucleophile?
# ## ### #$
(1) I, III a. CH2 = CH2 b. !"!"#$!"$%$!"!
(2) IV, III c. !"!#$#!#$#!"! d. !"!#$#!#$#!%
(3) II, III % &
(4) II, I (1) Both a & b (2) Both b & c
10. The following pair of structure represents (3) Both c & d (4) Only c
!" #
15. 0.3 g of organic compound contain 40% bromine in
# # # # silver bromide determined by Carius method, the
mass of silver bromide is
(1) 0.12 g (2) 0.28 g
(3) 0.18 g (4) 0.021 g
# $% # $%
16. C-atoms in C2(CN)4 are
# !"
(1) Enantiomers (2) Conformers (1) sp hybridised
(3) Position isomers (4) Homologues (2) sp2 hybridised
11. Which of the following carbanion is most stable? (3) sp and sp2 hybridised
(4) sp, sp2 and sp3 hybridised
#$! !#!
17. The total number of optically active isomers for
X – CH2 – (CH – X)3 – CHO are
(1) (2)
(1) 16 (2) 8
!"! !" (3) 4 (4) 2
18. In which of the following bond angles on sp 3
#"! !""
hybridised are not contracted due to lone pair of
electron?
(3) (4) (1) OF2 (2) H2O
!" !"! (3) CH3OCH3 (4) CH3OH
Last Leap for NEET (Part-I) Organic Chemistry : Some Basic Principles and Techniques 77
19. Which of the following has most acidic proton? 26. Which of the following statements is incorrect?
(1) CH3COCH3 (1) But-2-ene can exhibit geometrical isomerism
(2) (CH3)2C = CH2 (2) Propyl amine and isopropyl amine are position
isomers
(3) CH3COCH2COCH3
(3) Methyl propyl amine and diethylamine are
(4) CH3CH2OH
metamer
20. m-Dihydroxybenzene is also called
!"#$%&'
(4) CH3 – CH = CH2 + HBr ()"*+&,)
(1) Catechol (2) Resorcinol
(3) Quinol (4) Pyrogallol !"
!
21. Which of the following carbanion is most stable? #$" #$ #$"

!"#$%& !
(1) (2) !" !#$#!"#%#!" !

27. Which of the following exhibit geometrical
isomerism?
(3) !"!!"!"! (4) !"!
(1) 1-phenyl-1-butene (2) 3-phenyl-1-butene
22. Which of the following has minimum pKb value? (3) But-1-ene (4) 2-methyl-but-2-ene
#$!!$! !"! 28. Which of the following has zero dipole moment?
!"
(1) (2)
(1) Cis-2-butene (2)
!"#"! !"#$!%"
!"
(3) (4) (3) Trans-2-butene (4) 2-methyl propene

29. The dihedral angle HCH in eclipsed conformation of
23. The optical inactivity of meso-tartaric acid is C2H6 is
because of (1) 120° (2) 60°
(1) Absence of chiral carbon (3) 0° (4) 90°
(2) External compensation 30. The most stable carbanion among the following is
(3) Internal compensation
(1) !" "# !"!
(4) Presence of asymmetric carbon atoms
24. The violet colour in the Lassaigne’s test of sulphur !"!
(2) #!$
is due to
(1) Na2[Fe(CN)6]
(3) !"!#!"!"!#!"!
(2) Fe4[Fe(CN)6]3
(3) Na4[Fe(CN)5NOS] (4) !"!!"!
(4) FeCl3
31. The hybridization of carbon atom in the following
25. Which of the following possess highest pKb value? compound from left to right is
! !
(1) (2) !"#$%$#
!" "# #&
(1) sp2, sp3, sp2, sp2, sp
(3) (4) (2) sp2, sp2, sp2, sp2, sp

! " (3) sp3, sp2, sp2, sp2, sp2
! (4) sp3, sp2, sp2, sp2, sp
39. Which of the following is not a pair of resonating

32. The degree of unsaturation in is structure?
(1) 2 (2) 3 ! !
(3) 4 (4) 5 # #
(1) $
33. The number of isomers exhibited by C2BrClFI is ! ! ! !
(1) 3 (2) 4
(3) 5 (4) 6 !" !"
34. Two volatile liquids A and B differ in their boiling
point by 10 K. The process which can be used to (2) #
separate them is
(1) Steam distillation
(2) Distillation under reduced pressure !!
(3) #$ # % " , "#! " $!
!
(3) Fractional distillation
(4) Any one of these
(4) !" ! !"! , !"! ! !""
! ""
35. In paper chromatography #
# #"
(1) Mobile phase is solid and stationary phase is
liquid !
(2) Mobile phase is liquid and stationary phase is ! !
solid
40.
(3) Both phases are liquids
! !
(4) Both phases are solids
!
36. In the Lassaigne’s test the sulphur present in the
If the rear carbon atom is rotated by 180°, then the
organic compound first changes into
conformation obtained would be
(1) Na2SO3
(1) Staggered (2) Eclipsed
(2) CS2
(3) Skew (4) Both (1) & (3)
(3) Na2S
41. Stability of tertiary butyl carbocation can be
(4) Na2SO4 explained by
! ! ! (1) Both inductive and resonance effect
37. (a) (b) ! (2) Both inductive and electromeric effect
!"
!" (3) Both inductive and no bond resonance
Principal functional group present in the (4) Both electromeric and resonance effect
compounds (a) and (b) respectively are 42. Among the following the most stable carbanion is
(1) Ketone, Alcohol
!
(2) Ketone, Ketone
"
(3) Carboxylic acid, Ester
(1)
(4) Carboxylic acid, Ether
38. CH3CH2CH2CH2 !"! !"! !"" !" !"! (2)

"
!
Which is not occurring in the above process? "
(1) Proton shift
(2) Alkyl shift (3)
(3) Hydride shift
(4) Both (1) & (2) (4) !"!#$#%&!#$#%&!
43. In the given compound (1) Single bond resonance
(2) No bond resonance
!!" !"# !"""# "!"####"!!
!""#
!"$# (3) Double bond resonance
The most reactive hydrogen towards free radical (4) Triple bond resonance
substitution is 49. Which carbanion is most stable?
(1) I (2) II (1) !"!!""#!"" (2) !"!%!"#$#!"
(3) III (4) IV
44. Which of the following is a correct statement? (3) !"!$!# #! (4) !"!#!#!"!
(1) If there is conjugation, resonance is certainly !"!
possible
50. The energy required to dissociate C–H bond of
(2) Conjugation is not always necessary for
following compound for the formation of carbocation
resonance
is given below
(3) Resonating structures differ only in position of
-electrons not atoms I. "! ""! #"! #"! ###! !!
(4) Both (2) & (3)
II. !" !!" "!"!" ! ""
45. The given compounds
!#$ !" !#$ "
!"!
are III. !"!#! " "!
!"
!"!
(1) Position isomers (2) Chain isomers
!"!
(3) Functional isomers (4) Metamers
IV. !"!#!#!"" " "#
46. Geometrical isomerism is shown by
!"!
!"! Minimum heat is associated with
!"!
(1) H1 (2) H2
(1) (2)
(3) H3 (4) H4
51. Which of the following compound is having
!"!# maximum unsaturation?
!"!#
(1) (2)
(3) (4)
(3) (4)
! ! !
47. !"" !# !"" ! !"" !" !"" 52. Most stable carbocation among the following
"
# ## ###
!
!#! !#!
!"" !"$
#% (1) (2)
The correct stability order is !" $#

(1) I > II > III > IV (2) IV > III > II > I
(3) II > III > I > IV (4) III > II > I > IV #$! "#"
48. Hyperconjugation is very important phenomenon for (3) (4)
stability of carbocation and free radicals of carbon.
It is also called !"! !"#!
53. The nucleophile in RMgBr is )" '( !

59. !"*!"!#" !"! !"!
$%& # "
(1) Br – (2) R–
(3) MgBr – (4) RMg – The stability of the intermediate of this reaction can
be explained by
54. The priority order of the following groups in IUPAC
(1) Resonance
naming of organic compounds is
(2) Hyperconjugation
! !
–OH, –C C–, !"#"!$%%!&'! (3) Resonance or hyperconjugation
! ! (4) Resonance and hyperconjugation
(1) %"" #$ $# #$ $# #!"
60. Which of the following H is most acidic?
! !
(2) %$" "! !" "#$ "! !
" "
" "
(3) !"!#!"$%$!
$" # # # # !"! !"!#!"!
" " "
! !
(4) $# "#" ! ! ! !
(1) (2)
$
(3) (4)
!"!!!
55. The IUPAC name for the compound, $ 61. Which of the following compound exist in two
"#!
enantiomeric pair?
$
%
will be " !"
!
(1) !" #$ (2)
(1) Methanoic-ethanoic anhydride
$ #$
(2) Ethanoic-methanoic anhydride
(3) 1 methyl-2 formyl-propanoic acid !
(4) 1 methyl -2, 3-propane-di-al # "
56. Which of the following compound can show 62. The intermediates of reactions of paraffins are
keto-enol tautomerism? (1) Carbene
! (2) Carbocation
!
(1) (2) (3) Carbon free radical
"#! (4) Carbanion
! 63. The compound having maximum type of
"#! hybridisation is
(1) (2)
57. The Kjeldahl’s method cannot be used for
(1) Compounds having nitro group (3) (4) !" "#
(2) Compounds having azo group
#
(3) Compounds having nitrogen in the ring ""
64. Characteristic reactions of !"!!!!!"! is
(4) All of these
58. The hybridisation of C* in the compound is (1) Nucleophilic substitution
CH3–CH=C*=CH2 (2) Electrophilic addition
(1) sp2 (2) sp (3) Nucleophilic addition
(3) sp3 (4) sp3d (4) Electrophilic substitution
65. In which of the following reaction hybridisation of 72. Which of the following pair of resonating structure
carbon is changed? is incorrect?
#" ! !
(1) $ !#" $ !""# (1) !"#$%$& !"#$ $&
(2) #$ ! " !
"
!"! !"!
!"
"! ! (2)
(3) $ !% $ !""#
%&$ !"#
(4) # $% # !" &
&
66. The compound having maximum number of 1° (3) !""#!#&#" !""#!
carbon atom is &#"
(1) 2, 2-dimethylpropane
(2) 2, 2, 3, 3-tetramethyl butane (4)
(3) 2, 2, 3, 3, 4-pentamethyl pentane
! !
(4) 1-propyl cyclohexane "
!
" "
!
"
67. The number of asymmetric carbon atoms in
73. Which of the following species is not aromatic?
CH2OHCHOHCHO
(1) 2 (2) 3
(3) 1 (4) 0 (1) (2)
68. Most stable form of cyclohexane is
!
(1) (2) (3) (4)
74. The number of structural isomers found in C4H8 is

(3) (4)
(1) 4 (2) 5
69. Which compound is non-aromatic compound? (3) 6 (4) 7
75. IUPAC name of !"#!$!"%"&'&"!"#!$" is

(1) (2)
"#!"#!$"
!
(1) 2, 3, 4-Trimethyl-3-(1-Methyl ethyl) pent-2-ene
(3) (4) (2) 2, 3, 3-Trimethyl-3-(1-Methyl propyl) but-2-ene
!
(3) 2, 3, 4-Trimethyl-2-(1-Methyl ethyl) pent-2-ene
"
70. The carbon in glucose can be estimated by (4) 2, 4, 4-Trimethyl-3-(1-Methyl ethyl) pent-2-ene
(1) Liebeig method 76. The most stable conformation of ethyleneglycol is
(2) Victor Meyer’s method (1) Partially eclipsed

(3) Carius method (2) Fully eclipsed
(4) Kjeldahl method (3) Gauche
$ (4) Anti-staggered
## 77. Which of the following can exhibit geometrical
71. !"!!!""!!!!""!!""!!"! %&'
isomerism?
%
$$ (1) 1, 2-Dimethyl cyclopropane
!"!!!!!""!!""!!"!#!"! &'( (2) But-2-ene
(1) Chain isomers (2) Metamers (3) Pent-2-ene
(3) Position isomers (4) Functional isomers (4) All of these
78. The IUPAC name of the compound CH3NH–CHO is 86. IUPAC name of !" !#!"#!" ! is
(1) N-methylaminomethanal
!$ !$ !$
(2) N-formylmethanamine (1) Propane–1, 2, 3-tricarbonitrile
(3) N-methylmethanamide (2) 3-cyano pentane–1, 5-dinitrile
(4) N-methylaminocarbaldehyde (3) 1, 2, 3–Tricyanopropane
79. The isomerism exhibited by the molecules (4) Propane–1, 2, 3–trinitrile
CH3–CH2–CH2–OH and !"!#!"#$" is/are
87. Which among the following is non-aromatic?
!"!
(1) Chain isomerism (2) Position isomerism
(1) (2)
(3) Both (1) & (2) (4) Metamerism
80. Lassaigne’s test is performed for qualitative
estimation of (3) (4)
(1) C, H and PO43– (2) N, P and S
(3) N, P and X (4) N, S and X 88. Which among the following pairs is not resonating
structures?
81. Which of the following show pair of aromatic
molecules? (1) CH3–COCH2COOC2H5,
CH3–C(OH)=CHCOOC2H5
! !
(1) and (2) and ! !
! # $$ $
(2) #%"%! & #%"%!
" "
" ! !
! (3) ,
! ! ! ! !
(3) and (4) and ! !
#
! !
" (4) ,
82. Tautomerism will be shown by
(1) Primary nitroalkanes only
89. Which of the following compound is most polar?
(2) Secondary nitroalkanes only
!"
(3) Both Primary and secondary nitroalkanes
(4) Primary, secondary and tertiary nitroalkanes (1) !" (2)
83. Which of the following carbocation is most stable?
(1) "# "! (2) "! " !!

! "
(3) (4) All are equally polar
(3) "# "#"" #" (4) "!! "!
!"
!
84. Which of the following halogen cannot be tested 90. In the given conformer of 2-chlorobutane
by Lassaigne test? !"! "
(1) Br (2) Cl
(3) I (4) F
85. 0.44 gm of an organic compound on Kjeldahlised
gave NH3 which required 17.25 ml of 1N H2SO4 for !#
complete neutralisation. The approx. percentage of " "
nitrogen in the compound is !"!
(1) 25 (2) 35 After dehydrohalogenation by using alcoholic KOH,
(3) 54 (4) 30 the major product formed is
(1) cis-2-butene 97. Which of the following is non-benzenoid aromatic
compound or species?
(2) trans-2-butene
(3) 1-butene !
!"!
(4) No elimination is possible
(1) (2)
91. Which of the following is most reactive when
treated with Na metal?
(1) Methanol (2) Ethyne (3) (4) All of these
(3) Phenol (4) Acetic acid 98. Which of the following is not a pair of homologues?
92. Which of the following is most stable carbocation? (1) Methanol and isopropyl alcohol
!
!"! !"! (2) Ethene, hexene
!
(3) Haxane and cyclobutane
(1) (2)
(4) Propanal and butanal
!
!
(3) !"! (4) !"! 99. IUPAC name of #$%&
93. The IUPAC name of the complex formed in (1) Cyclohexanol bromide
Lassaigne’s test for detection of ‘N’ is
(2) Bromoformyl cyclohexane
(1) Iron hexacyanoferrate (III)
(3) Cyclohexane carbonyl bromide
(2) Iron (III) hexacyanoferrate (II) (4) Both (1) & (3)
(3) Ferric hexacyanoferrate (III) 100. Improper matching of IUPAC name
(4) Ferric hexacyanoferrate (II)
#!""
94. The ratio of and bond is maximum in (1) #"
#"!'#"!'$"
(1) Benzene
()*+,-./0*,-12-)3)4/
(2) Tetracyanoethene
(3) Carbon dioxide (2) !"!#!"#!"!
(4) Toluene !$ !$ !$
%&'()*+,-.,/.,0,
95. The electron cloud of bond lies !)&1'*23&24+
(1) In molecular plane !"#!#!"!
(2) At angle of 120° from bonding plane (3)
$ $
%&'(')*')+,+-
(3) Parallel to bonding plane
(4) Above and below the plane of bonding atoms
(4)
96. Which of the following is inappropriate matching of
species and shape? %56.6/407890(90:;0-4-2-,
(1) CH2O - Trigonal planar 101. Number of isomer of C4H9Br having a chiral carbon
is
(2) H– CN - Linear
(1) 4
(3) !"! - Tetrahedral (2) 1
(3) 3
(4) !"! - Trigonal planar (4) 0
102. Which of the following exists in the form of 109. Which of the following pairs of structures do not
tautomers? constitute resonance structure?
!
(1) CH3—NO2 (2) !"!#$#!"! (1) "#"$$$$%$$$$! and CH3—O—N = O
!
% !
(3) !"!#!#!""#!"! (4) All of these $"
(2) !"!#!$%$& and !"!#!
$ &" $
103. Which of the following is purified by sublimation? (3) CH3CH = CH – CH3 and CH3CH2 – CH = CH2
(1) Acetone (2) Benzoic acid (4) Both (1) & (3)
(3) Ethanoic acid (4) Both (2) & (3) 110. Correct order of stability of following species is
104. Sodium extract of which of the following compound (I) CH2 = CH—CH = O
does not form blood red ppt with aqueous FeCl3? (II) +CH —CH = CH—O–
2
(III) –CH —CH = CH —O+
(1) NH2CSNH2 (2) !"!#$#!"! 2
% (1) I = II = III (2) I > II = III

(3) !"!#!"#!""$"" (4) Both (1) & (2) (3) I > II > III (4) I < II < III
111. Which of the following is most acidic compound?
%"
105. 0.2 g of organic compound is digested with ! !
conc. H2SO4 in the presence of K2SO4 and trace "#!
of Cu, the resulting compound was heated which (1) (2)
gave a gas, the gas needs, 20 mL of 0.1 N H2SO4
for complete neutralizition. What would be % of N !"!#"
in this compound? (3) (4) CH3—H
(1) 14% (2) 21%
112. The compound which does not exhibit geometrical
(3) 28% (4) 35%
isomerism is
106. Phosphorus is estimated in the form of
(1) CH3—CH = CH—CH2Br
(1) (NH4)2PO4 . 12 MoO3
(2) !"!#!"#!"$%$!"#!"!
(2) (NH4)3PO4 . 12 MoO4
(3) (NH4)3PO4 . 12 MoO3 &"
(4) (NH4)2HPO4 . 12 MoO3 (3) !"#$#!"!

107. Which of the following has maximum number of
hyperconjugative structure?
(4) !"#"!$%&
(1) !"! (2) !"!!""
113. Which of the following is not planar species?
!"! (1) 3°-butyl free radical
(3) !" (4) !"!#!$!
!"! (2) 3°-butyl carbocation
108. Most stable carbocation among the following is (3) 3°-butyl carbanion
(1) (CH3)3C (4) Vinyl benzene
114. Which of the following is neither a nucleophile nor
(2) !"! electrophile?
(1) NO2+
(3) !"#!$""# (2) Cl+
(3) CN–
(4) !" !#$#!"#%#!" ! (4) (CH3)4N+
115. Tautomerism is not exhibited by
(2) is non-aromatic compound
(1) ! !
!
(3) !"!#$#!" is more stable than !"! !""
(2) !"#$#%&" !"!
(4) Benzoic acid does not sublime on heating
!
120. 0.25 g of an organic compound containing N on
(3) !
Kjeldahlising required 30 ml of "!#$" for
! ! %
complete neutralization of NH3. The percentage of
(4) ! ! N in the compound is
(1) 83.7% (2) 50%
116. Which of the following carbocation is most stable?
(1) (CH3)3C (2) (CH3)2CH (3) 20.5% (4) 33.6%
(3) (CD3)3C (4) (CD3)2CH 121. The correct IUPAC name of the following
117. Which of the following exist in maximum form of compound is
enol content?
!
& !"
(1) !"!#!#!""#!$%$&$%$!"!
&
(1) 2-Hydroxycyclohex-5-enone
(2) !"!#!#!""#!#!"!
$ $ (2) 6-Hydroxycyclohex-2-enone
(3) 6-Hydroxycyclohex-2-enol
(3) !"!#!
(4) 2-Hydroxycyclohexane carboxylic acid
$
122. In an estimation of sulphur by Carius method,
0.468 g of an organic compound gave 0.678 g of
(4) !"#$#% barium sulphate. The % of sulphur in the
compound is approximately
118. The most reactive species towards H+ ions is
(1) 20% (2) 50%
!"#$#!"!
(1) (3) 10% (4) 100%
""!#%#&
123. Which of the following alkene is least stable?
(2) !!" #$%&%#$! (1) Ethylene

(2) Cis-2-butene
(3) $!" #$%&%#$! (3) Trans-2-butene
(4) 2,3-Dimethyl-2-butene
(4) $"# #$%&%#$!
124. Most stable carbocation is
119. Which of the following is correct? (1) (C6H5 )3C
!"!
(2) (CH3 )3C
!
(1) !"!#$#!"#$#!"!#%#!&" !"!#$#!#$#!"!
(3) (C2H5 )3C
!"! !"!
(4) All are equally stable
125. For the compounds given below 129. In Lassaigne’s test sodium metal is used because
!""# (1) It is very reactive
!% $ #$%$!$%$"# (2) Its melting point is low
A. !"#"!"#"! B. (3) Its compound are soluble in water
!% $ #"$%$!$%$#
(4) All of these
!""#
130. Which of the following is optically active?
$!!"
!" !" $ $
! !
(1) !"#"!"#"!
C. D.
!$! !$!
"# !
! (2) CHCl = CHCl
Optical activity is observed in !"!
(1) B only (2) B & D "
(3) A, B & D (4) All of these (3)
126. The name of organic compound is (4) No one is optically active

131. In the following carbocation, the stability order is
(1) Cyclopropyl pentane
!"!
(2) Bicyclo [2, 4] heptane I. II.
!"! !
(3) Spiro [2,4] heptane !"!
(4) Bicyclo [4, 2] heptane
127. Among the following structures which one is called
erythro isomer? !
III. IV. !"#! "#!
!" !"
% $ $ %
(1) III > IV > II > I (2) IV > II > III > I
(i) % $ (ii) % $ (3) I > II > III > IV (4) III > II > I > IV
# # 132. Optical isomerism is shown by
!"
(1) Butanol-1
$ $ (2) Butanol-2
(iii) % $ (3) 3-pentanol
# (4) 4-heptanol
(1) (i) & (ii) (2) Only (ii) 133. In which of the following free radical, carbon atom
(3) Only (i) (4) Only (iii) is sp 3 hybridised ?
128. The IUPAC name including the stereochemical (1) CF3 (2) CCl3
notation (for the chiral C) is (3) CBr3 (4) All of these
$ 134. Which has a -bond formed by overlapping of
hybrid orbitals?
!"
# # (1) (2)
(1) (S)-2-bromo-(Z)-hex-3-en-4-one !"#$#!"!
(2) (R)-2-bromo-(E)-hex-3-en-4-one
(3) (R)-5-bromo-(Z)-hex-3-ene-2-one
(3) (4) CH2 = C = CH2
(4) (S)-5-bromo-(E)-hex-3-en-2-one
135. Which of the following molecule will be planar? 141. The most stable carbocation in the following
compounds is
(1) HCHO (2) CH2 = C = CH2
(3) CH3COOH (4) All of these
136. IUPAC name of the following compound (1) (2)
[(C2H5)3C]3C – CH3 is
(1) 2, 2, 2-Triethylpropane
(2) 3, 3, 5, 5-Tetraethyl-4-(1, 1 -diethylpropyl)-4- (3) (4)
methylheptane
142. Which of the following is an anti-aromatic ion?
(3) 4-Isopropyl-3, 3, 5, 5-tetraethylheptane
(4) 3, 5-Tetraethylmethylpentane
(1) (2)
137. IUPAC name of
CH3 – CH = CH – CH2 – C CH is
(1) Hex - 4 - en - 1 - yne (3) (4) All of these
(2) Hex - 5 - yn - 2 - ene
143. Nitrogen can be detected by
(3) Hex - 1 - yn - 4 - ene
(1) Soda lime test
(4) Hex - 2 - en - 5 - yne
(2) Lassaigne’s test
138. Which of the following statement is correct about
(3) Beilstein test
the tautomerism?
(4) Both (1) & (2)
(1) In phenol, enol form is more stable than keto
form !"! %"
!
!
!"! 144. !"!#$#!#$#!""#$#%" !"!#$#!#$#!""#
!"!
(2) !"!#$#!#$#% !#'#%#$#&#$#" !"! !"!
!"!
" & In the above reaction most stable intermediate
both tautomers exist in equilibrium formed is
(3) Tautomerism can take place in acidic medium !"!
or basic medium
(1) !"!#$#!#$#!"" (2) !"!#$#!#$#!""#$#!"!
(4) All of these !"! !"!
139. Which of the following will not exhibit geometrical
isomerism? (3) H3O+ (4) !"!#$#!#%#!""%#!"#
$% !"#
!
"# !"! 145. Resonance stabilised free radicals are essentially
(1) (2) !"!#$#!#%#!"#$#!"! (1) Linear (2) Tetrahedral
(3) Planar (4) Pyramidal
(3) CH2 = CH2 (4) All of these 146. The hybridisation of ‘N’ in pyrrole (C4H5N) is
140. Which of the following will have greatest – I effect? (1) sp (2) sp 2
(3) sp 3 (4) dsp 2
(1) ! "#!
147. The hybridisation of carbon in dichloro carbene
(2) – CF3 (singlet) is
(3) – NO2 (1) sp (2) sp 2
(4) – COOH (3) sp3 (4) sp3d
148. Find the incorrect order 155. Which of the following is correct about methyl free
(1) – CH3 < –CH2CH3 < – CH(CH3)2 (+I effect) radical?
(2) – NO2 > – CN > – COOH (– I effect) (1) Carbon is sp 2 hybridised

(2) Unused p-orbital is at right angle to the plane
(3) !"!#$#!""!"!#$#!"%!"!&" (Hyperconjugation) of hybrid orbitals
(3) It is paramagnetic in nature
(4) < < (Resonance) (4) All of these

156. The correct statement about hyperconjugation is
149. The most stable carbocation will be produced by (1) It is a permanent effect
heterolysis of which of the following C – Br bond?
(2) It operates through – electrons
(1) ! !" "#$#%#$#!" !#$#&' delocalisation
" (3) It is weaker than resonance effect
(2) C2H5 – O – CH2 – Br
(4) All of these
(3) CH3CH2 – Br
157. Which of the following is correct about free radical?
(4) All have equal stability
(1) It is formed by homolytic cleavage
150. Stability of carbocations cannot be explained by
(2) Carbon free radical generally have one unpaired
(1) Inductive effect (2) Resonance effect electron
(3) Hyperconjugation (4) Electromeric effect (3) They do not show hyperconjugative effect for
151. Which of the following is a nucleophile? stability
(1) D2O (2) CH3OH (4) Both (1) & (2)
(3) CN – (4) All of these 158. The hybrid state of fourth carbon atom in the
following compound
152. Which of the following is correct about aromaticity
!" !#$#!"#%#!"#!"#!&&"
of the compound?
(1) Molecule should be planar !"!
(1) sp3 (2) sp2
(2) Molecule should have (4n + 2) electrons
(3) sp (4) sp3d
(3) Molecule should have complete continuous
conjugation 159. Which of the following is an electrophile?
(4) All of these (1) SO3
153. Which of the following compounds possess the (2) C6H5N2+

C – H bond with the lowest bond dissociation (3) HCHO
energy? (4) All of these
(1) Toluene 160. Which of the following is most stable carbanion?
(2) Benzene
(1) !"!!""
(3) n-pentane
(4) 2, 2 – Dimethyl propane (2) !"!"#$!"
154. Find the correct match
(3) !" #!
(4) All are equally stable
(1) , (Chain isomers)
161. The IUPAC name of neo-pentylalcohol
(2) , ! (Metamers) (1) 3,3-Dimethyl propanol-1

!
(2) 2,3-dimethylpropanol-1
(3) , (Position isomers)
(3) 2,2-dimethylbutanol-2
(4) All of these (4) 2,2-dimethylpropanol-1
162. Which pair show functional isomer? 170. Which of the following has neither secondary nor
tertiary hydrogen?
$"
(1) Isobutane (2) Isopentane
(1) CH3—CH2—CH2—OH ; !"!#!"#!"! (3) Pentane (4) Neopentane
(2) CH3CH2NH2 ; CH3—NH—CH3 171. A cyclo alkane with a formula C10H18 has how
(3) CH3—CH2OH ; CH3—O—CH3 many rings?
(4) Both (2) & (3) (1) 1 (2) 2
163. Which is temporary effect? (3) 4 (4) 0
(1) Inductive effect (2) Mesomeric effect 172. Angle strain in cyclobutane is
(3) Electromeric effect (4) All of these (1) + 24° 44 (2) + 9° 44
164. Among H2O, NH4+, Cl –, !"! , NH3 nucleophiles (3) – 9° 44 (4) + 0° 44

are 173. Which of the following statement is correct?
(1) CH3COOH will show metamerism
(1) H2O, NH4+ (2) Cl –, NH3, NH4+
(2) Stability of carbanions increases in order
(3) H2O, NH3, NO2+ (4) H2O, Cl–, NH3
!"# !##$#!"!#%#!"#$#!""#&#!"!
165. Which of the following compound show only sp3
(3) Singlet carbene is less reactive than triplet
hybridized carbons?
carbene
(1) Cycloalkane (2) Benzene
(4) C4H6 has only two isomers
(3) Straight chain alkene (4) Ethenal
174. The compound which cannot be detected with the
166. Which of the following cannot exhibit resonance?
help of Lassaigne’s test for N is
(1) !"! !" # $"" (2) !"! !" # !"! (1) C6H5NHCONHC6H5HCl
(2) NH2CONHNH2HCl
(3) !" !#$#%& ! (4) All of these
(3) NH2 – NH2HCl
167. The given two molecules are related to each other
(4) NH2CONH2
as
!" 175. Before testing halogens, Lassaigne’s extract is
boiled with HNO3 acid because
(1) NaCN is soluble in dil. HNO3
!" (2) Na2S is soluble in dil. HNO3
(1) Geometrical isomers (2) Structural isomers
(3) Silver halides are soluble in dil. HNO3
(3) Enantiomers (4) Identical
(4) Na2S and NaCN are decomposed by dil. HNO3
176. Alkyl groups when attached to system behaves
(1) Conjugation is essential for resonance
as
(2) -bond is not necessary for resonance
(1) Electron donor due to inductive effect
(3) If there is conjugation resonance is not always
necessary (2) Electron donor due to hyperconjugation
(3) Electron acceptor due to inductive effect
(4) !"!#$#%"! exhibit resonance (4) Electron withdrawl due to resonance effect
177. Most acidic position in the given compound
169. The IUPAC name of is !$#
!" !"#
! !&#
! "# "#$#!
(1) 3,3-Dimethyl-1-hydroxycyclohexane
!%#
(2) 1,1-Dimethyl-3-hydroxycyclohexane !
(3) 3,3-Dimethyl cyclohexan-1-ol (1) a (2) b
(4) 1,1-Dimethyl-3-cyclohexanol (3) c (4) d
178. Among the following, the least stable resonance 184. Tautomerism is not exhibited by
structure is
# " $ " !
# # (1)
(1) $ ! (2) !
#
"! !"
$ !
$ " " !
# # (2)
(3) # ! (4) # !
"$ "$
179. Cyclic hydrocarbon molecule has all the C and H (3) !"####!"####$"
atoms in single plane. All the C—C bonds have
same bond length, less than 1.54 Å but more than
!
1.34 Å. The angle C—C—C is
(1) 109°28 (2) 180° (4)
!
(3) 60° (4) 120°
185. Which of the following conformers of n-butane has
"!# torsional strain?
180. The configuration of ! " is !"!
!"!
" !"! !"!
"!!#!
#!
(1) R (2) S (1) " " (2) " "

" "
(3) Either R or S (4) Z "
!"#$%%&'&() !"#$$%&'($)*+',-
181. The IUPAC name of the structure is
!"!
"
!!"####$!####$!####$!%
!%%$ $%%!
(3) " !"! (4) Both (2) & (3)
(1) 3-Amino-2-formylbutane-1, 4-dioic acid " "
(2) 3-Amino-2, 3-dicarboxypropanal !"#$%&#''()*+'&,-./0
(3) 2-Amino-3-formylbutane-1, 4-dioic acid 186. In which of the following positive charge is not
(4) 1-Amino-2-formylsuccinic acid involved in resonance?
182. The number of geometrical isomers in case of a !"! #

compound with the structure
!""""#
!" !####!"####!"####!"####!"####! !" " is (1) (2)
#
(1) 4 (2) 3
(3) 5 (4) 2 (3) (4)
183. The molecule 3-Hexen-2-ol can exhibit
(i) Optical isomerism 187. Which of the following molecules has longest
(ii) Geometrical isomerism ‘ !""""! ’ bond length?
!"!
(iii) Tautomerism
(iv) Metamerism (1) !"!####!####!"####!"" (2) !"!####!####!""
The correct answer is !"! !"!

(1) (i) & (ii) (2) (i) & (iii)
(3) (4)
(3) (ii) & (iii) (4) (i) & (iv)
188. Which of the following is non-aromatic? 194. Mixture of ether and toluene is separated by
(1) Distillation
(1) (2) (2) Distillation under reduced pressure
(3) Sublimation
(4) Chromatography
(3) (4)
195. How many chiral centres are present in 2,4-
diphenyl-3-chlorohexane?
189. Find out correct representation of triplet carbene
(1) 4 (2) 3
" (3) 2 (4) 1
(1) " ! " (2) ! 196. Acetone (b.p. = 329 K) and methanol (b.p. = 338 K)
" can be separated from their mixture by
(1) Azeotropic distillation
(2) Fractional distillation
(3) " ! " (4) All of these (3) Steam distillation
(4) Vacuum distillation
190. Find out correct statement regarding resonance 197. The different resonating structures of
p-nitrophenoxide ion is given below, which of the
energy
following resonating structures is not correct?
(1) It is equal to energy of resonance hybrid !
" " ! !
(2) It is equal to the difference in energies of the ! " "
most stable canonical structure and resonance !
hybrid
(3) It is energy absorbed by the molecule (1) (2)
!
(4) It is equal to the energy of least stable "
! "
canonical structure " " " "
! !
191. Which of the following represents the correct order
regarding the ‘–I’ effect of the substituents?
(3) (4)
!
(1) –NR2 > –OR < –F
!
(2) –NR2 < –OR > –F " "
(3) –I < –Cl < –Br > –F
SECTION - B
(4) –NR2 < –OR < –F
192. Blood red colour compound formed on heating In the following questions, a statement of assertion
sodium fusion extract with FeSO4 when ‘N’ and ‘S’ (A) is followed by a statement of reason (R)
both are present in organic compound is
(1) Fe(CNS)2 (2) Fe(CNS)4 reason is the correct explanation of the
(3) Fe(SCN)3 (4) FeCNS assertion, then mark (1).
193. An organic compound weighing 0.62 g gave
0.222 g of magnesium pyrophosphate (Mg2P2O7) in
the estimation of phosphorus by Carius method.
The % of ‘P’ in the compound is (3) If Assertion is true statement but Reason is
false, then mark (3).
(1) 30 (2) 10
(3) 20 (4) 40 statements, then mark (4).
1. A : Inductive effect is a permanent effect. R : Benzene and naphthalene contain same

number of delocalised electrons.
R : –CH3 group shows +I effect.
10. A : Cis-1, 3-dimethylcyclohexane has higher
2. A : Resonating structures should have same
boiling point than trans-1, 3-
number of unpaired electrons.
dimethylcyclohexane.
R : The energy content of all resonating structures
R : Cis-1, 3-dimethylcyclohexane has lower melting
is same.
point than trans-1, 3-dimethylcyclohexane.
3. A: is an anti-aromatic molecule.
11. A : Alkyl groups show +I effect.
!
" R : Halogens are –I and +R groups.
R : The number of -electrons is 6.
12. A : ion is less stable than ion.
!!""
4. A : !!""#! carbocation is less stable than
!!"" R: ion is an aromatic anion while
ion is not an aromatic anion.
! carbocation. 13. A : Cyclohexane is more stable than

cyclopentane.
R : Bond angle of cyclohexane is equivalent to
!"! ideal angle 109° 28 (chair form).
R : !"!#! is more stable than !#"" !"! 14. A : Cyclobutane is less stable than cyclopentane.
!"! R : Angle strain in cyclobutane is more than that
carbocation. of cyclopentane.
5. A : Tropylium carbocation is more stable than 15. A : All resonating structures contribute equally in
benzyl carbocation.
R : Tropylium carbocation is more resonance .
stabilised than benzyl carbocation.
! !
R: is antiaromatic.
6. A: is a weaker base than .
16. A : Phenoxide ion is more stable than ethoxide
R : On increasing lone pair availability, basic ion.
character increases. R : Ethoxide ion is stabilised by resonance.
7. A : Cyclopentadienyl anion is much more stable
!!" "!!
than allyl anion.
17. A : "#$#" is the most stable alkene
R : Cyclopentadienyl anion is aromatic while allyl !!" "!!
anion is only resonance stabilised. due to 12- hydrogen atoms
8. A : (CH3)3C is more stable than (CD3)3C . R : ‘H’ is more electronegative than carbon.
R : Bond energy of C – D bond is higher than 18. A : A Compound having non-superimposable mirror
C – H bond. image is optically active.
9. A : Benzene and naphthalene are aromatic R : Optically active compound must contain chiral
hydrocarbons. carbon.
!" !" !
Chapter 7
Hydrocarbons
SECTION - A !
4.
! !"" "! "!
#
$%!& '()*+ ,-" .
1. ! /"0 # !1"2 $ %& Identify B
Which of the following reaction or reagent can be
used as best reagent for above transformation?
(1) CH4 (2) CH2 = CH2
(1) Clemmensen reduction
(3) CH2 = CH – CH3 (4) CH3CH = CHCH3
(2) Wolff-Kishner reduction
!"!
2. CH2 = CH – CH3 ! . What is A?
#$$ ! %&'() (3) Red P/HI
(1) !" !#!"#!" " (4) All of these
!$ !$ 5. In which of the following, E1 elimination is most

favourable?
(2) CHCl2 –CH2 –CH3
(3) CH2 =CH–CH2Cl
(1) (2)
(4) CH2 = CCl – CH3 !"
!"
3. Which of the following reaction is not correct?
"$"#!
!$%&'( !"
(1) !"#!"$"% !"#"!
!"
6. ! )"*!# #$% &'(&$ product.
'&&&&#&&&&#"#$!%!
The product/s formed in the reaction is/are
!$%&'( (1) Ethane, ethene and butane
(2) !"#$!%!#&&&&#'#( !"#"!
(2) Ethene and butane
")*+,-%
(3) Only butane
#%#$!&! (4) Only ethane
!$%&'(
7. Increasing rate of dehydrohalogenation follows the
(3) !"#$!#$%#$!&#$"#' !"#"! order
(1) RF < RCl < RBr < RI
#$%#$!&"
(2) RI < RBr < RCl < RF
"
) (3) RCl < RF < RBr < RI
(4) !"#$""("#$")"#$!
(4) RF < RI < RCl < RBr
94 Hydrocarbons Last Leap for NEET (Part-I)
!!" 12. The number of moles of HI required for the following

8. !"#$#!"! ( conversion is
)*+,-./
%& '"
$
The compound ‘A’ is !"#$
!"#"$% !"#% !
(1) !"#$#!"! (1) 2 (2) 3
%& (3) 4 (4) 6
13. Decarboxylation of !"#!"!"*#!"#*#!$$%&#'&()

(2) !"#$#!"!
!"#
%&
by electrolysis and with soda lime respectively
!"! gives
#$
(1) 2,3-dimethyl butane and propane
(3)
(2) Isopentane and butane
!"! (3) 3,4-dimethyl hexane and butane

#$ (4) Butane and 3,4-dimethyl hexane
(4)
14. + Cl2 water A.

!"# $%$&!
9. CH3 – C CH !""# '&" '&(
(A). Identify A.
Identify A.
(1) !"!!# #!#$#!"!"!
#$
%"
(1) !" (2) !"
%$ #$ !" #$
(2) !$! !$!$!
!"#"! "!
$ $
(3) CH2OH – C CH (3) (4) !"

#$ #$ #$
(4) !"# #"#$#"!"#$#"!"!!
15. Product of ozonolysis of ortho-xylene is
%!
(1) Glyoxal, methylglyoxal
10. The reaction used for ascending homologous
series is (2) 1,2-dimethyl glyoxal, glyoxal
(1) Decarboxylation (2) Cracking (3) Glyoxal only

(3) Pyrolysis (4) Wurtz reaction (4) Methyl glyoxal, glyoxal, 1,2-dimethyl glyoxal
11. Select the correct chain propagation step
!"#"!
16. !""#$%!&""'"$%"$%"$( )
(1) !"! !#" !""!# "!#
Product A is
(2) !"! !# !"! !#
(1) Isopropyl benzene
(3) !"! !# !# !""!# "!# (2) Isobutyl benzene

(3) 3° butyl benzene
(4) !"" !# !#" !"!#! " (4) n-butyl benzene
Last Leap for NEET (Part-I) Hydrocarbons 95
22. Rate of electrophilic substitution (chlorination) of
#$ !" benzene and hexadeuterobenzene are r1 and r2
17. %
respectively, then
!" &'()*"+
(1) r1 > r2 (2) r1 < r2
The compound A will be
(3) r1 = r2 (4) Unpredicted
#$% !"
23. A compound of formula C4H8 does not decolourise
(1) (2)
bromine water then the compound is
!" !"
(1) But-1-ene (2) But-2-ene
! #$
(3) Cyclobutane (4) 2-methyl propene
(3) (4)
24. An organic compound on ozonolysis gives 1 mole
!"
acetaldehyde and 1 mole acetone then the
#$
compound will be
18. Addition of Br2 to 1,3-butadiene gives
(1) Pentene
(1) 1,2-addition product only
(2) Cyclopentene
(2) 1,4-addition product only
(3) Pent-2-ene
(3) Both 1,2- and 1,4-addition products
(4) 2-methyl-but-2-en
(4) No reaction
25. The treatment of RMgBr with R C CH produces
!"!#"
(1) RH (2) R H
!
19. $ . Then, P will be (3) R – C CR (4) R – R
%&'()*+
26. Cyclohexene on ozonolysis yields
!"#$#!"! (1) CH3CH2CHO (2 moles)
(1) (2)
(2) !"! ! $ (2 moles)
"
!"! !
!!
(3) (4) (3) "#""##"#! "#" " "#"
(4) OHC – (CH2)4 – CHO

20. An alkane of formula C 6 H 14 form only two
27. The correct order of reactivity of halogens when
monobromo alkane, the alkane is
reacts with alkane
(1) Hexane (1) Br2 > Cl2 > F2 (2) F2 > Cl2 > Br2
(2) 2-methyl pentane (3) Br2 > F2 > Cl2 (4) Cl2 > Br2 > F2
(3) 2, 3-dimethyl butane 28. When 2-butyne is treated with dil. H2SO4 and
(4) 2, 2-dimethyl butane HgSO4, the product formed is
21. From the following reaction (1) 2-butanol (2) 2-butanone

(3) Butanol (4) Butene
!"
! "! #$ " % 29. When mixture of two alkyl halide reacts with
!! &'# !!! ()*+,$"
! "#$%&
sodium metal in dry ether, mixture of 2-methyl
propane, ethane and 2, 3-dimethyl butane was
The compound P will be
obtained. The alkyl halides are
(1) 2-chloropropane and chloroethane
(1) (2)
(2) Chloromethane and chloroethane
(3) 2-chloropropane and methyl chloride
(3) (4)
(4) 1-chloropropane and chloromethane
30. A hydrocarbon on reductive ozonolysis gives 35. An alkyne on oxidation with KMnO4 gives
formaldehyde, glyoxal and acetaldehyde. Then the
hydrocarbon is
!"!!##"$%$!#!
(1) CH3CH = CH – CH = CH2
(2) CH3CH = C = CH – CH3
The alkyne should be
(3) CH2 = CH – CH2 – CH = CH2
(4) CH3CH2 – CH = C = CH2 (1) !"!!# !"
31. Propene when treated with chlorine at about 500°C

forms (2) ! !"
(1) CH2 = CH – CH2Cl (2) !"!#! !# !#"
#
!" (3) ! !"""!#!
!"
!
(3) !"!#!!#!!#!!" (4) !# !# !#" (4) !"!#!###!!""
"
32. Propane on heterolytic cleavage produces 36. The total number of structural isomeric dihalo
derivatives possible in n-pentane are
(1) !" !#$%&#!" !!" " (2) !"!!""##$%&##!"!
(1) 5 (2) 6
(3) 8 (4) 9
(3) !"!#$%&#!"!!"" (4) !" !#$%&#!" !!" "
37. A chiral centre is generated when 2-methyl - 2 -
"
!"#!$!"% butene is treated with
$
(1) Dil. H2SO4
33. !"!#!""#!"#!"!
&'()*+%# (2) B2H6 / H2O2 / OH–
%
!& (3) (ACO)2Hg / NaBH4 – H2O
A and B respectively is (4) HCl
(1) CH3 – CH2 – CH = CH2, CH3 – CH= CH – CH3
!"!#$#!""
(2) CH3 – CH = CH – CH3, CH2 – CH2 – CH = CH2
(3) CH3CH2 – CH = CH2, CH3 – CH2 – CH = CH2 38. + Reagent + catalyst
(4) CH3 – CH = CH – CH3, CH3 – CH = CH – CH3
In the above reaction, reagent / catalyst will be
!"!
(1) CH3CH2 — Cl / Anhyd.AlCl3
!"#! $%&$
34. !"'## $%&$ A (major) (2) CH2 = CH2, Conc. H2SO4
!"! (3) CH3CH2 — OH, BF3
The product ‘A’ in this reaction (4) All of these
39. Correct order of given four alkenes for
!"! !"!
#$" hydrogenation reaction will be
(1) (2) !"!#####!"! !" !####!"#####!" "
!"! $ $$
!"!
#$" !"!#
!"! ! !"" !"!#####!"#####!"#####!"!

!"!
#$" $"# #$" !"!# $%
$$$
(3) (4) (1) III > IV > II > I (2) I > II > IV > III
!"! !"!
#$" #$" (3) I > II > III > IV (4) II > I > III > IV
40. Acetylene when treated separately with Ni(CN)2 in "#!
THF and passed in red hot iron tube gives two " %$"$!
46. ! "#!!"!"#"!"#!
product A and B. The correct information about "
products A and B is "$
(1) Both A and B are aromatic The major product of this reaction
(2) A is anti-aromatic and B is aromatic !#! !#!
(3) A is non-aromatic and B is anti-aromatic
(1) !"!#!$!#!
(4) A is non-aromatic and B is aromatic
41. Which of the following is most reactive towards
electrophilic substitution? !$! !$!
! !
(1) Toluene (2) Isopropyl benzene !"#"!#!$!
(2) ! !
(3) Neo-butyl benzene (4) o-nitrotoluene
$ $
!"#"! $" #%" &# '(
42. !"#$!#% & ',
!"!#!"#!"!
(3)
then B is !"" !""
!"!#" !"!!# !"!

(4)
(1) (2)
47. Which compound in the following will give only one

!" !""#
monochlorination product in presence of light?
(3) (4) (1) (CH3)4C (2) (CH3)3CH
!"!!""
43. What is the product formed when acetylene reacts
with two moles of hypochlorus acid? (3) (CH3)2CH2 (4)
(1) Cl2CHCHO (2) ClCH2COOH

!"
(3) ClCH2CHO (4) CH3COCl
!"!#$%!""
44. Toluene reacts with excess of Cl2 in the presence 48. $%&'()*('+,-.
of sunlight to give a product which on hydrolysis #!!
give Major product of the reaction is
!"!#" !"! !"
!# $%
(1) (2) (1)
#!!
!"
!""# !"#
(2)
(3) (4) $% #!!
!"
45. The order of % P character in Alkane, Alkene and
(3)
Alkyne #!!
(1) Alkane > Alkene > Alkyne $%
!"
(2) Alkyne > Alkene > Alkane
$%
(3) Alkane > Alkyne > Alkene (4)
(4) Alkyne > Alkane > Alkene #!!
! "#! !"#$%&'(
54. !"!#!""#!"#!"! %
! ! !"#!$%&'(! )*!+,-.
49. $
!"#!$%&")(#
! ! What is ‘A’?
!
(1) CH3–CH = CH–CH3
(2) CH3–CH2–CH = CH2
! "#!
! ! ! ! (3) !" !#!$%$!" "
!"#!$%&'(!
!"#!$%&")(# !"!
! ! ! !
! ! (4) CH3–C C–CH3
55. !""#!"!#!"!#!" !#!"" !""#!"#!"!#!" "
$ "#! !""
$ $ !"#!$%&'(! $ $ $ $$
!"#!$%&")(# !"!
$ $ $ $
$ $ !"!#!#!"!
!"!
Correct statement about the above reaction $$$
(1) Rate of reaction is maximum for The correct decreasing order of melting point of
above alkanes is
(2) Rate of reaction is maximum for (1) I > II > III (2) II > I > III
(3) Rate of reaction is maximum for (3) III > I > II (4) III > II > I
56. Which of the following alkyl benzene having highest
(4) Rate of reaction is equal in , ,
electron density?
!""!"! !"!#
50.
(1) (2)
The major product is
!""!"! !"!!"!#$
(1) (2)
#$ (3) (4)
$% 57. The correct increasing order of bond energy of given

!"#!"! !"!!"" bonds undergoing homolytic fission is
(3) (4)
#$
!
"
# !
51. The electrophiles in nitration and sulphonation of ! !
benzene are respectively $ "#!
(1) NO+, SO2+ (2) NO2+, SO3– ! !
(3) NO2+ SO2+ (4) NO2+, SO3 (1) b < c < d < a (2) d < a < b < c
52. Bond angle in benzene will be (3) a < b < c < d (4) c < b < d < a
!" #$!% !"&'()*!$!
(1) 90º (2) 72º 58. ! " # $
+*,-./ +*,-./
(3) 120º (4) 180º A is(Only alkyne which on hydration produces
53. 2-Methyl pentane reacts with 1 equivalent of Cl2 aldehyde)
then major product formed would be The isomer of D is
(1) 2-chloro-4-methyl pentane
(1) (2)
(3) (4)
59. Which of the following alkene does not give positive 64. Which of the following statement is incorrect?
test of unsaturation with Baeyer’s reagent? (1) Among isomeric alkanes, boiling point
(1) Propene decreases with increase in branching
(2) 2, 3-Dimethyl but-2-ene (2) Melting point of alkanes depends on symmetry
(3) 2-Methyl-but-2-ene (3) Melting point of octane is lower than that of
nonane
(4) But-2-ene
(4) Each carbon atom in alkane is sp3 hybridised
60. Which of the following has highest degree of
unsaturation? 65. Alkane which undergoes sulphonation is
(1) CH3–C C–CH3 (1) Ethane (2) Butane

(3) Hexane (4) All of these
(2) !"#"!$%$&#" #""
66. ! '$()*
"
!"#$%&'
(3) !" "! The product ‘y’ is
!"!!#
(1) (2) !"
(4) CH2 = CH–CH = CH2
61. In the pyrolysis of alkanes which bonds break? !"!!#
(3) (4)
(1) C–C bond !"
(2) C–H bond !"#$%&'!()(!

67. !"#$!#$"#$"#% &
(3) C = C bond
(4) C C bond What is product ‘A’?
!"#!"!$" !"!!"!!""
!"#$%&$'(
% (1) (2)
62. !"!#!#!"!
)$!*)$!+,-.$ !"!#!$!
$ %(/01(
& !"!!""
(3) (4)
x and y respectively are
" 68. Benzene hexachloride is used as a powerful
insecticide under the name of
(1) !"!#!#!"!$ CH3CH2CH3
%" (1) Lindane (2) Gammexane
" (3) 666 (4) All of these
(2) CH3CH2CH3, !"!#!#!"! 69. Which of the following statement is correct?
$" (1) Alkyne is more reactive towards electrophilic
&" &" addition than alkene
(3) !"!#!#!"!$%!"!#!#!"!$ (2) Addition to HBr in unsymmetrical alkene takes
" " place according to anti-Markownikoff’s rule
(4) CH3CH2CH3, CH3CH2CH3 (3) "!! " !"!! is more stable than
63. Which of the following alkanes gives alcohol on "!!"!" " !"!!
oxidation with KMnO4? (4) All of these
(1) 2, 2-Dimethyl propane 70. Which of the following alkane cannot be prepared
(2) Propane by Wurtz’s reaction?
(3) 2-Methyl propane (1) CH4 (2) CH3CH3
(4) All of these (3) CH3CH2CH3 (4) CH3CH2CH2CH3
71. The most appropriate method for the preparation of 75. Reduction of butyne-2 produces different products
both symmetrical and unsymmetrical alkanes is !"#$"%&'(!
!
(1) Frankland reaction as given !"!#!$ $!#!"!
!")*$+,-.+/+$01/
"
(2) Corey-house synthesis
(3) Wurtz’s reaction The product ! and ! are respectively
(4) All of these (1) cis and trans butene-2

(2) trans and cis butene-2
,!!-.$'"!&/
!"#$%&'(&)*%+%)& %
(3) Both are cis 2-butene
72. !"!#!"$!"#!"!
,!!-.$'"!&/
(4) Both are trans 2-butene
0120$%&'(&)*%+%)&
& 76. Gases produced at cathode and anode on Kolbe’s
A and B respectively are electrolysis of HCOONa will be respectively
(1) !" !#!"#!"$!" !%&!"!#!"$!"#!"! (1) C2H6 and CO2
!' !' !' !' (2) H2 and H2
(3) CO2 and H2
(2) !" !#!"$!"#!" !%&!"!#!"#!"$!"!
(4) C2H6 and H2
!' !' !' !'
77. Reductive ozonolysis of an alkene produces
(3) !" !#!"#!"$!" !%&!"!#!"#!"$!"! acetaldehyde and formaldehyde, its oxidative
!' !' !' !' ozonolysis will produce
(1) CH3COOH and HCOOH
(4) !" !#!"$!"#!" !%&!"!#!"$!"#!"!
(2) CH3COOH, CO2 and H2O
!' !' !' !'
(3) HCOOH, CO2 and H2O
*+,-+.#/
! (4) CH3COOH, HCOOH, CO2 and H2O
!"#$!%&'()
#$!%#%$
73. 78. Best yield of propane can be obtained from CH3Cl
#$!%#%$ $1$! and C2H5Cl using the
0"$" "
The product A and B respectively are (1) Wurtz reaction
(2) Frankland reaction
(1) Meso form, meso form
(3) Ullmann reaction
(2) Racemic mixture, racemic mixture
(4) Corey-House synthesis
(3) Meso form, racemic mixture
79. The major product on monochlorination of 2-methyl
(4) Racemic mixture, meso form butane will be
74. An hydrocarbon on ozonolysis followed by (1) 1-chloro-2-methyl butane
reductive hydrolysis gives 1 molecule of each (2) 2-chloro-2-methyl butane
acetone, CO2 and acetaldehyde. The structure of
(3) 2-chloro-3-methyl butane
hydrocarbon is
(4) 1-chloro-3-methyl butane
(1) CH2=C=CH–CH=CH–CH3
%&!%&"
!"!#$
(2) !"!#!$!$!"#!"! !"#
80. !"!#%&
!"! !$#
(X) and (Y) in this reaction are respectively
(3) !"!!"#!#!"$!""
!"! !"!!"!!# !"!!""
(4) !"!#!#!"$!$!"" (1) $%&

!"!
!#
!# !"! %$# &
84. !#!"" !
!"!"" !"!!"" % $$# "!!
!"!
(2) $%& What is the product formed in this reaction?
$% $"
!# ! !" !
!"! !
!"!!"!!# !"!!"" (1) !#!" ! (2) !#!" !
!# !"! !"!
(3) $%&
%" %$
!" ! ! !" ! !
(3) !#!""$ (4) !#!""$
!#$!"!"" !"!!"" !"!
!"!
(4) %&' !"!#"
!)*+ ( '"%& !
!# 85. !
"#$ !
!" The major product of above reaction may be

81. The reaction Cl–CH2CH2CH2 CH2 –Cl #$%&'
!"! !"!
is (1) (2)
(1) Wurtz reaction
(2) Fittig reaction !"!
(3) Freund’s reaction

(3) (4)
(4) Wurtz-Fittig reaction !"!
&!% & 86. In the reaction sequence
% !"!#$$%" !"!#$%& '()*!+"
82. !"#$ !"!#$#!# #!#$#" !""#%#&'( &)(
'(()*""+,"
%
& %&! (B) will be
(1) CH3 – C C – CH3
Product (A) in this reaction will be
(2) CH3 – C C – MgBr
(1) Meso compound
(3) CH3 – C C – COOH
(2) Dextrorotatory mixture
(4) CH3 – CH = CH – COOH
(3) Laevo-rotatory mixture 87. Primary amine does not undergo E-2 elimination,
(4) Racemic mixture because
!"#! (1) It has maximum basic nature

$% -*-."
(2) Alkene obtained will be less stable
83. #"!
012/ -.! ,)*+$# "#$%&'( ! (3) !""! is poor leaving group
(4) Nitrogen has Lewis basic character
The product (A) is
!"#! !"#! !"!
"
$#"
88. %&'( !"!!""!""!#!!""!"! $"# )* heated
(1) (2) "
$#" !"!
!"#! (1) Propene is the major product

(2) Ethene and C3H7N(CH3)2 are the products
(3) (4) Mixture of (1) & (3) (3) Ethene and propene are obtained with ethene
as the major product
$#" (4) Equimolar amounts of ethene and propene are

obtained
89. Arrange the following in increasing order of heat of 93. Identify the end product in the following reaction
hydrogenation
!
!!$ # !"
!"% ! !" !
! ! ! ! !
(1) CH3–CH2–CHO (2) CH3COCH3
!"# !""# !"""# !"$# "

!
(1) I < III < IV < II (2) I < IV < II < III (3) CH3–CH=CHOH (4) !"!#!$!"!
!
(3) III < IV < II < I (4) III < II < I < IV %"
90. A hydrocarbon with molecular formula C5H12 on 94. Which of the following alkene is most reactive
monochlorination can give four optically active towards electrophilic addition?
product, the structure of the hydrocarbon is (1) Ethene (2) Buta-1, 3-diene
(1) CH3–(CH2)3–CH3 (3) Propene (4) 2-butene
(2) (CH3)3C–CH3
95. C—H bond length is minimum in
(3) !" !"!""!" ""!" ! (1) Ethene (2) Ethyne
!
!" ! (3) Ethane (4) Methane
(4) All structure will give optically active product on 96. Compound having carbon of maximum p character
monochlorination (1) Methane (2) Ethene
91. The product of acid catalyzed rearrangement in the (3) Ethyne (4) Carbon dioxide
following reaction is
97. Which of the following represents the given mode
of hybridisation sp – sp3 – sp2 – sp2 starting from
!"!
!! first carbon atom?
"! !"
(1) (2)
!"" !""
(3) !"# (4)
!
!"! 98. During nitration of an organic compound with HNO3
! !"!
! and H2SO4, HNO3 acts as
(1) (2)
(1) Acid (2) Base
"!! ! !"!
!"! (3) Neutral (4) Salt
!"!
99. Monochloro derivative of which carbon are formed
$ % & '
!"!!"! !"! in maximum % !"!#!"#!""#!"!
! !
"!! !"! !"!
(3) (4)
(1) 1st (2) 2nd
!
!"" (3) 3rd (4) 4th
100. Among the paraffins it is generally found that with
92. Which of the following alkanes give only one
an increase in the molecular weight
monochloro substitution product in chlorination?
(1) The freezing point decreases
(1) 2-Methyl butane
(2) The boiling point decreases
(2) 2, 2-Dimethyl propane
(3) Pentane (3) The boiling point increases
(4) Hexane (4) The vapour density decreases
101. Alkene of highest heat of hydrogenation 106. The major product of the reaction
!()
!!"# "!$"!%&%"!" '#" *
(1) (2)
!!"# "!$%$"!"$%$"!" &#"
(1)
'(
(3) CH2 = CH2 (4)
!!"# "!"$%$"!$%$"!" &#"

102. Which process is not governed by peroxide effect? (2)
'(
(1) CH3—CH = CH—CH3 + HBr
(3) !!"#$#% "!#&#"!#$#"! " '(
(2) CH3—CH = CH2 + HCl
(3) CH3—CH3 + Br2
(4) ! !"#$#% &% "
(4) All of these
#$!%&' (
!"!#$#!"" )%*+,-
!"!!""
107.
!"!#
103. %&' #$!%.%/0!0"
$%&'()*+,&-.
)%*+,-
Product (P) in the above reaction is Product and are respectively
!!"" !!""
!"!#$#!"!%& !"(%&)!""
(1) '
(1) (2)
&'
#$
#$ !"#$#!"! !""#$#!""&'
(2) %
%&
!"#$#!"! &'
!"!!"!#$
!"#$#!"! !""!"!
(3) %
(3) (4)
&'
%&
104. Friedel Craft alkylation reaction is most easily
shown by !"#$#!"! in both cases
(4)
(1) !"! #
!"!# $!"!#"
108. !"#
(2) #$! !" ! !"!
Identify the compound (A) in the reaction
!""# (1) (2)

(3)
(3) (4)
(4) $#! 109. Which of the following compounds can form only
two chloro derivatives upon monochlorinations?
105. The treatment of methanol with ethylmagnesium
iodide liberates a gas at STP. The gas is (1)
(1) CH4 (2) CH3CH3 (2) !"!

(3) CH3OH (4) !" !#$#!"#$#%" (3) (CH3)2 – CH2
!"! (4) (CH3)4C
(1) cis-2-butene
!
110. !#!$%$!#$%$!#"$%$!#! !#!!#$&$!#$%$!#! ;
(2) trans-2-butene
"
!"
(3) n-Butane
!#"$&$!#$%$!#"$%$!#!
(4) A mixture of cis and trans-2-butene
A and B are
116. The correct statement about bromination of
!
(1) Alc. KOH, !"#$#%" &" benzene is
! (1) It form – complex
(2) !"#$#%" &" , alc. KOH
(2) It form – complex
(3) Na in NH3, alc. KOH (3) It neither form – complex nor – complex
(4) Alc. KOH in both will give major product (4) Both (1) & (2)
!"#$%!
111. ! "#$!% & !""#$&'()*!)%%*
'
"& %"
! '
()#$*"+,#
!"#$+*"$,$+*" 117. !!"#$#"# #"#$#"!#$#"#%#"
#
()*+,-#./,0#1* !""#$%* !"#$!%!&!'
! "!! (
'$"'$!'$"
! can be (1) ‘A’ is optically active while ‘B’ is optically

(1) CaC2 inactive
(2) Al4C3 (2) ‘A’ is optically inactive while ‘B’ is optically
active
(3) Mg2C3
(4) NiC2 (3) Both ‘A’ and ‘B’ are optically active
112. Which of the following is most reactive towards (4) Both ‘A’ and ‘B’ are optically inactive
electrophilic substitution? 118. To prepare a pure sample of n-hexane using Na
(1) Toluene metal as one reactant, the other reactant or
(2) Ethyl benzene reactants will be
(3) Benzene (1) Ethyl chloride and n-butyl chloride
(4) 3° butyl benzene (2) Methyl bromide and n-pentyl bromide

113. When cyclohexane is poured in water it floats (3) Ethyl bromide and n-butyl bromide
because
(4) n-propyl bromide
(1) It is in boat form
119. Acetylene may be obtained by the electrolysis of
(2) Water is more denser than cyclohexane aqueous solution of
(3) It is in chair form (1) Sodium formate
(4) It is in crown form
(2) Sodium fumerate
114. Which species as given below will undergo
(3) Sodium acetate
electrophilic attack most readily on the ring?
!" (4) Sodium succinate
(1) (2) 120. Which of the following groups activate the benzene
ring when directly attached?
!! !"
(1) –NO2
(3) (4)
(2) –COOH
115. Dehalogenation of meso-2,3-dibromobutane with Zn (3) –OH

in ether gives (4) Both –OH and –COOH
!""# !"
!"# #
121. !"!#$#!#$#!"#%#!"" ( , A is (1) $%! $% & $%& $%! & !"
&' (2) Br — CH2 — CH CH — CH2 — Br
! "" # (3) !" !#$#!"#$#!"#%#!" !
(1) !" !#$#!#$#!"#$#!" !
&' &'
%& !$"#
(4) !" !#$#!""#$#!"#$#!" "
! $" #
(2) !" !#$#!#$#!"#$#!" ! %& %&
%& !""# 125. The addition of HI in the presence of organic

peroxide does not follow anti-markovnikov’s rule
!$"" because
(3) ! !" "#$#!#$#!"#$#!" # (1) HI bond is too strong to be broken
homolytically
!" # %&
(2) Iodine free radical formed but readily combine
!$"" with each other to form I2 molecule rather than
(4) ! !" "#$#!#$#!"#$#!" # to attack the double bond
%& !"# (3) Iodine combines with H to give back HI

(4) HI is a reducing agent
!"#$%&'
122. !"!#$#!"!#$#!"! '##()%&! !"#""
126. !"#$!#$"#$!#%"""""""""""""&'()*+,
%& %&
Major product of the above reaction is
The above reaction is an example of
!"!!"!!""
(1) -elimination
(1)
(2) , -elimination
(3) , -elimination !"!
!"
(4) Condensation reaction (2) !"!
123. Which of the following compound is heterocyclic
aromatic compound? !#
!"!!"!!""
(1) (2) (3)
!#!!#!!#"
(4)
(3) (4)
!"
$ ! 127. During the preparation of ethene by Kolbe’s
" electrolytic method using inert electrodes the pH of
124. Identify the end product the resulting solution
(1) Increases progressively as the reaction
!"!!#! %"&'()*!
!"# "# $ % proceeds
$%!!# +,-.#/
(2) Decreases progressively as the reaction
01"
" proceeds
-9<.1 2.345436
5.#7/38,93( (3) Remains constant through out the reaction
:46:,8/-;/198"1/
(4) May decrease if the concentration of the
The product C of reaction is electrolyte is not very high
128. Electrophilic as well as nucleophilic addition (3) CH3 — (CH2)2 — CH3

reactions are shown by (4) !"! # !" # !"!
(1) Alkane (2) Alkene $
!"!
(3) Alkyne (4) All of these
129. The compound CH 3 CH 2 C CH can be 133. The correct order of nitration of following compound
distinguished from alkane and alkene using " ! #
(1) Bromine in CCl4 (2) Ammonical Cu2Cl2 " " ! ! # #
(3) Ammonical AgNO3 (4) Both (2) & (3)
" " ! ! # #
!"
130. !"# !" # !$ %&'()*+ . " ! #
The major product of the reaction is $ $$ $$$
(1) I > II > III (2) I < II < III
(1) !"! !" # !$
% (3) I = II = III (4) II > I > III
& 134. Of the five isomeric hexanes, the isomer which can
give two monochlorinated compounds is
(2) X — CH2 — CH2 — CN
(1) n-hexane (2) 2,3-dimethylbutane
(3) Both (1) and (2) in equal ratio
(3) 2,2-dimethylbutane (4) 2-methyl pentane
(4) CH2 CH — X
135. Which of the following compounds does not form
!"# benzoic acid by the oxidation with KMnO4 ?
'
131. !"!#$#!"#%#!"!#%#!# #!" !"!
!!
$%&'()
&
(1)
A and B respectively is
(1) !"!#$#!"#$#!""#$#!# #!" and !"!#$#!""

%&
(2)
CH2 = CH – CH2 – CH = CH2
(2) CH2 = CH – CH2 – CH = CH – Br and "#!%&%"#%&%"#!
CH3 – CH2 – CH2 – C CH
(3)
(3) !"!#$#!"!#$#!"!#$#!# #!" and
%& !"!
CH3 – CH2 – CH2 – C CH !"!#$#!#$#!"!
(4) !"!#$#!""#$#!""#$#!#%#!"" and (4)

&'
136. How many moles of H2 would be required to
CH2 = CH – CH2 – CH = CH2 produce saturated hydrocarbon from given
compound?
!! "#$%&'!!("" )* !+#!,&
132. !"- !". ! !" !+!
# $
The product B is
!
""
(1) #$! % #$" % #% #$!
(1) 1 (2) 4
(2) CH3 — CH2 — CH3 (3) 8 (4) 5
137. In which of the following, dipole moment is not 145. The correct order of reactivity towards nitration
zero? reaction
" !# !"! "
!"!
! !
(1) (2) ! I. II.
!
" !# " !"!
!" !"! !"
!"
III. IV.
(3) (4) !"!
!" !" (1) I > II > III > IV (2) II > I > III > IV
!"
138. Alkanes can be obtained by the hydrolysis of (3) II > I > IV > III (4) III > IV > I > II
(1) CaC2 (2) Mg2C3 !"!#$$%" )*)+!
146. &'( &,(
(3) Be2C3 (4) Al4C3
139. The end product in the given reaction Compounds x and y are respectively
! "#$ %&'()!(*
!"+ # "##$ ,!-
!$ B is (1) !"#$#!"! ' !# #!"
(1) ! (2) %& %&

!
! (2) !"#$#!"!%#&' (
(3) (4)
!# #!"
!
140. Mesitylene is a polymerisation product of (3) !"#"!$! ' !$!
(1) Acetylene (2) Propyne %&
(3) Ethylene (4) Vinylacetylene
(4) "# #"$ ! "$!#%#"$!
141. Ethane gives_____different substitution product on
reaction with chlorine 147. An alkene ‘A’ contains three C – C bond, eight
(1) 1 (2) 6 C – H bond and one C – C bond. ‘A’ on
ozonolysis gives two moles of an aldehyde of
(3) 7 (4) 9
molar mass 44 u. IUPAC name of ‘A’ is
142. Which of the following alkane is liquid at room
temperature? (1) Propene (2) But-2-ene
(1) Propane (2) Butane (3) 2-methyl-but-2-ene (4) Pent-3-ene
(3) Nonane (4) Ethane 148. Identify the alkyne in the following sequence of
reactions
143. In which of the following polysubstitution may
takes place? !! !+,-!
!"#$%& ! -.#$#'*/0/ ' ()* *()
"#$%&#''() #$'* !!,-!
(1) Acylation of benzene
(2) Methylation of benzene (1) H3C – C C – CH3
(3) Nitration of benzene (2) H3C – CH2 – C CH
(3) HC C – CH2 – C CH
(4) Sulphonation of benzene
(4) H2C = CH – C CH
144. 1-butene and 2-butene can be differentiated by
149. Addition of water to CH3 – C CH is
(1) Hydrogenation
(1) Electrophilic addition
(2) Oxidation by acidic KMnO4 (Hot)
(2) Nucleophilic addition
(3) Baeyer’s reagent test
(3) Electrophilic substitution
(4) Both (1) & (2) (4) Isomerisation
150. The reagent which is most appropriate for the 154. Which of the following on dehalogenation will give
following conversion, trans alkene?
#$
!"
!" # # !"! !"!
(1)
!"! "
is/are
#$
(1) Alcoholic KOH #$
(2) Alc. KOH followed by NaNH2 "!! !
(2)
"!! !
(3) Aq. KOH followed by NaNH2
#$
(4) All of these #$
151. 1 - Bromo - 3-chlorocyclobutane will react with two !"! !"!
moles of Na in ether producing (3) !"! !"!
#$
(1) #$
" "
(4) !"! !"!
!"
#$
(2)
!"
!"
155. #"$%&'(
!" #$%&'()'$
!" )*+,-./
(3)
What is product?
(1) !" !!"####!" "
(4)
(2)
(3) !" #$!"

!"#$!
152. !"#$%$&'( %"#&"$'()
)*+,"-#
Product is (4)
(1) Glyoxal !"#$%

156. !"!####$" 123 &'()*#+*),-./0
&"'(#%#
(2) Methylglyoxal
What is A?
(3) Dimethylglyoxal
(4) Acetone (1) !"!
153. Benzene can be converted to BHC when

(2) !"!
(1) Cl2 is bubbled through benzene
(2) Benzene and Cl2 mixture is kept in dark

(3)
(3) Cl2 is shaken with benzene
(4)
(4) Cl2 and benzene is exposed to light
160. !"!####!"####!""##$##"!% !"#$%&'"
!""##$% &'()*#+*),-./0
!"#$%&'"()*)
157. &%2( &'(#)%*+,#',+-./01
The intermediate of reaction is
!""##$%
What is P? (1) !"!####!"####!"!
(2) !"!!""####!""
(1)
(3) !"!####!"####!"!
(2) (4) !"!####!"####!"!

161. Which of the following will give acetone?
(3) !"
!""""
#$!! %&#
(a) !"!####!####!"
!! &
!!""#$"%
(4) (b) !"!####!####!" """
&" '("!&!
!"#$% !&'"()* !"#$!

158. !""""!""""!""""! #$%&'()*
(c) %&'()*)(+',
The product is
!"#
(d)
$%&'!()'!
(1)
(1) (a), (b) & (d) (2) (a) & (d)
(3) (a), (b) & (c) (4) (a) & (c)
(2)
!" !"
!"
162. #"$%&'(
#$%&'()'$ *+",-$.
!" !"
The major product is
(3) Both (1) & (2)
(1)
(4)
(2)
!"#$% &'()!
159. ' #$% #&%
)!*+"!"
(3)
The compound ‘A’ and ‘B’ respectively are
(1) !
(4)
163. Mg 2 C 3 and CaC 2 react with H 2 O to produce

(2) Both
respectively
(1) Propyne and ethane
(3) !
(2) Propane and ethane
(3) Propyne and ethyne
(4) "# ! "#!
(4) Ethene and ethyne
!"! 169. Product of reaction will be
164. !"!#$#!"#$#!"#$#!"! + potassium tert.butoxide (Y) !"!#!

"#"#$%"#%&%"#%$%"#" !
*+,'$-./01 #!$%&'($)
%&
(Y) as a major product, is !$! !$!
(1) !"#"!
!"! !$! !$!
(1) !"!#$#!"#$#!"#$#!"! !$! !$!

(2) !"#"!
%" $ $
!"! $ !$ !
(3) !"#"!
(2) !"!#$#!#%#!"#$#!"! !$! $
!"! (4) Mixture of (2) & (3)
(3) !"!#$#!"#$#!"#%#!"" 170. When trans-1-bromo-2-phenyl cyclohexane react
(4) CH3 – CH = CH – CH3 with alcoholic KOH, it mainly gives
165. Elimination reaction by alc. KOH will be fastest in (1) 1-Phenylcyclohexene
!" (2) 3-Phenylcyclohexene

(1) (3) 2-Phenylcyclohexene
(4) Phenol
171. Correct order of melting point is
(2)
!" (1) n-pentane > Neopentane > Isopentane
!" (2) Neopentane > n-pentane > Isopentane
(3) (3) Neopentane > Isopentane > n-pentane

(4) Isopentane > Neopentane > n-pentane
172. –CCl3 is deactivating if attached to the benzene
(4) ring. The most appropriate factor for this is
!"
(1) Resonance
166. Tertiary butyl bromide undergoes elimination
reaction through (2) Electromeric effect
(1) E1 mechanism (2) E2 mechanism (3) Hyperconjugation

(3) E1cB mechanism (4) Both (1) & (2) (4) Reverse hyperconjugation
167. Fehling’s solution test is given by 173. The cyclic compound having minimum angle strain
(1) Benzaldehyde (1) C3H6 (2) C4H8
(2) Acetone (3) C5H10 (4) C6H12
(3) Acetaldehyde 174. Which of the following does not decolourise
(4) Both (1) & (3) Baeyer’s reagent?
168. Major product of the reaction is (1) CH3 – C C – CH3
(2) CH2 = CH – CH CH – CH = CH2
!"#$%&!'('!
"#$%&! !
)*+,-&./')
(3)
(1) C6H5Cl (2) C6H6Cl6
(3) C6Cl6 (4) C6Cl12 (4) H2C = C = CH2
175. The (major product) of monobromination 3. A : Monochlorination of isopentane generates two
chiral carbon atoms.
of "# is R : 1°, 2° as well as 3° carbon free radicals are
formed during the reaction.
!"!
4. A : Alkynes give some nucleophilic addition
#" reactions but alkenes do not.
$%
(1) R : The carbanion formed in reaction of alkynes is
!"! more stable than carbanion formed in alkenes.
5. A : Acetylene may undergo dimerisation or
%"
trimerisation in the presence of Cu2Cl2 and
NH4Cl.
(2) R : Propyne on heating in presence of Cu-tube
!"!
#$ forms mesitylene.
%" 6. A : NBS gives benzylic substitution on reaction

with toluene.
(3) R : But-2-yne has acidic hydrogen.
#$ !"!
7. A : Lower the heat of hydrogenation of an alkene,
%" the more stable it is.
#$ R : Diels-Alder reaction may take place between
(4) buta-1, 3-diene and ethylene.
!"!
8. A : Hydration of ethene and ethyne proceeds via
same mechanism.
SECTION - B
R : Ethyne is more reactive than ethene towards
Assertion - Reason Type Questions chlorination reaction.
In the following questions, a statement of assertion 9. A : Buta-1, 3-diene is more stable than but-2-ene.
R : Buta-1, 3-diene is resonance stabilised
(1) If both Assertion & Reason are true and the molecule.
reason is the correct explanation of the 10. A : Wurtz reaction is not given by t-butyl chloride.
R : t-butyl chloride cannot form a free radical.
11. A : But-1-yne and But-2-yne can be distinguished
by ammonical silver nitrate solution.
R : But-2-yne will react but but-1-yne does not.
12. A : Alkenes are more reactive than alkynes
false, then mark (3).
towards electrophilic addition reactions.
R : Alkenes form more stable carbocation than
statements, then mark (4). alkyne in electrophilic addition reaction.
1. A : Aniline does not undergo Friedal Craft’s 13. A : During pyrolysis of alkanes, C — C bond is
reaction. broken in preference to C — H bonds.
R : –NH2 group is strongly deactivating. R : Bond energy of C — C bond is lower than that
of C — H bonds.
2. A : Acetylene on reaction with sodium gives
hydrogen. 14. A : Cis-2-butene has higher boiling point than the
trans isomer.
R : sp hybridised carbon atoms of acetylene are
less electronegative than sp2 hybridised carbon R : Cis-isomer is more closely packed in the
crystal lattice structure.
atoms.
15. A : Tert-butyl benzene on nitration gives ortho and 18. A : Alkenes show nucleophilic addition reactions.
para nitro-t-butyl benzene. R : Alkenes are the rich source of -electrons
R : Tert-butyl group is ortho, para directing group. which attract nucleophile.
19. A : 1,1-dichloro ethane on reaction with sodium in
16. A : Neopentane forms only one monochlorinated
presence of dry ether gives but-2-ene.
product upon free radical chlorination.
R : Wurtz reaction is more efficient in the
R : Neopentane has four identical methyl groups preparation of alkenes.
attached to a quaternary carbon.
20. A : Hydroxylation of cis-but-2-ene with osmium
17. A : Both alkanes and alkenes can be prepared by tetroxide and NaOH gives meso compound.
Kolbe’s electrolysis method.
R : Hydroxylation of alkene with osmium oxide and
R : But-1-yne is more acidic than but-2-yne. NaOH is syn in nature.
!" !" !
BOTANY
CHAPTER No. TOPIC PAGE No.
1. Biological Classification ........................................................................... 113 – 142
2. Reproduction in Organisms and Sexual Reproduction in Plants .......... 143 – 168
3. Molecular Basis of Inheritance ................................................................ 169 – 186
4. Anatomy of Flowering Plants ................................................................... 187 – 200
5. Morphology of Flowering Plants .............................................................. 201 – 216
6. Principles of Inheritance and Variation .................................................... 217 – 236
7. Cell : The Unit of Life .............................................................................. .237 – 250
8. Ecosystem ............................................................................................... 251 – 258
9. Environmental Issues .............................................................................. 259 – 266
Chapter 1
Biological Classification
6. Members of the chrysophytes
SECTION - A
(1) Are macroscopic planktons
1. Heterocyst in blue green algae (2) Are present in fresh water as well as in marine
water
(1) Lacks photosystem-I
(3) Have stiff cellulose plates on the outer surface
(2) Are specialised cells for photosynthesis
(4) Cause PSP in human beings
(3) May perform reproduction
7. Mark the odd one (w.r.t. Euglena)
(4) Performs nitrogen fixation in aerobic condition
(1) Bears long tinsel type flagellum
2. Mark the incorrect statement
(2) Shows dual mode of nutrition
(1) Chemoheterotrophic nutrition occurs in
Halobacterium (3) Sexual reproduction involves zygotic meiosis
(2) Species of Mycoplasma are mostly parasitic (4) Paraflagellar body is a photosensitive structure
(3) Gramicidin antibiotic is eubacterial in origin 8. Somatic phase of the acellular slime moulds is
(4) Black leg, tetanus and anthrax diseases are
(1) Naked, multinucleate and diploid
caused by same bacterial genus
(2) Walled, uninucleate and haploid
3. Holophytic protistans are similar in the presence
of (3) Walled, multinucleate and diploid
(1) Primordial utricle (2) Chlorophyll-a (4) Naked, uninucleate and haploid
(3) -carotene (4) Cell wall 9. Which of the following feature is not concerned
4. According to three kingdom classification, the with communal slime moulds?
eukaryotic members are present in
(1) Anisogamous type of sexual reproduction
(1) Protista only
(2) Holocarpic and monocentric
(2) Fungi and plantae
(3) Spores have cellulosic wall
(3) Animalia and monera
(4) Peridium is present in sporangia
(4) All three kingdoms
10. In basidiocarp of Agaricus campestris, each gill
5. Cytoplasm of the eubacterial cell has
(1) Is granular due to presence of 80 ‘S’ (1) Two zones of monokaryotic hyphae
ribosomes
(2) Three zones of monokaryotic and diploid
(2) Lacks sap vacuoles hyphae
(3) Shows streaming movements (3) Three zones of dikaryotic hyphae
(4) Lacks gas vacuoles always (4) Two zones of dikaryotic and diploid hyphae
Aakash Educational Services Limited - Regd. Office : Aakash Tower, 8, Pusa Road, New Delhi-110005 Ph.011-47623456
114 Biological Classification Last Leap for NEET (Part-I)
11. In which of the following statement all listed fungi 18. Crozier formation as a method of dikaryotisation,
belong to the same class? a short dikaryotic phase with septa having central
(1) Puff balls, honey mushroom, stinkhorn, pore and cleistothecium as fruiting body are
toadstools features related to
(2) Deathcup, sponge mushroom, sacred (1) Penicillium (2) Peziza

mushroom, shelf fungi (3) Neurospora (4) Claviceps
(3) Morels, truffles, pink mould, pin mould 19. Archaebacteria can survive in extremes of
(4) Ergot fungi, Baker’s yeast, stinkhorn, dung conditions due to
mould
(1) Presence of introns in DNA
12. Which of the following is incorrectly matched?
(2) Branched chain lipid with phytanyl side group
(1) PSP – Dinoflagellates in cell membrane
(2) Statospores – Diatoms (3) Presence of more than one type of RNA
(3) Pseudoplasmodium – Acellular slime moulds polymerase
(4) Diplanetism – Saprolegnia (4) Absence of muramic acid in cell wall
13. Chemosynthetic autotrophic bacteria 20. Acellular slime moulds
(1) Play a great role in recycling nutrients (1) Do not possess capillitia in sporangium
(2) Oxidises various organic substances (2) Have isogamous sexual reproduction and
(3) Release O2 due to involvement of OEC zygotic meiosis
(4) Are most abundant in nature (3) Produce holocarpic and polycentric plasmodia
14. Myxomycetes show (4) Aggregate to form pseudoplasmodium
(1) Prokaryotic, pigmented, mycelial bacteria 21. Select the incorrect statement w.r.t. edible
mushrooms.
(2) Pigmented, slimy body, photosynthetic fungi
bacteria (1) Rhizomorph do not have root cap like
structure
(3) Eukaryotic, non-pigmented, saprophytic
(2) Spawn is used for their culture
(4) Slimy body, prokaryotic, oxygenic
(3) Edible part is actually basidiocarp
15. Fruiting bodies are edible for which of the fungi?
(4) Dikaryotisation occurs by crozier formation
(1) Zygomycetes, oomycetes
(2) Basidiomycetes only 22. The causal agent of the disease responsible for
great Irish famine spreads by the formation and
(3) Ascomycetes, basidiomycetes release of
(4) Phycomycetes, basidiomycetes (1) Chlamydospores (2) Blastospores
16. Bacteria differs from BGA in
(3) Conidiosporangia (4) Oidia
(1) Being prokaryotic in nature
23. Sexduction phenomenon occurs due to
(2) Performing oxygenic photosynthesis conjugation between
(3) Having peptidoglycan in cell wall (1) F+ × F– (2) F+ × F+
(4) Presence of flagella in some forms (3) F– × F– (4) Hfr × F–
17. All given features are characteristic to
24. Gram positive bacteria have
dinoflagellates, except
(1) Pectocellulosic plates covering the body (1) Only proximal set of rings as L and P
(2) Presence of chlorophyll a and c as (2) Both proximal and distal set of rings
photosynthetic pigments
(3) Proximal set with S and M rings present in
(3) Bioluminiscent nature of certain members plasma membrane
(4) Their frustules can be used as bacterial filters (4) Two rings present in LPS layer of cell wall
Last Leap for NEET (Part-I) Biological Classification 115
25. Cell envelope in bacteria consists of 32. Unicellular, simplest, free living prokaryotes which
(1) Plasma membrane only are also said to be “Bacteria with their coats off”,
show one of the following features
(2) Plasma membrane and mesosome
(1) Colonies give fried egg like appearance in
(3) Glycocalyx only culture medium
(4) Glycocalyx, cell wall and plasma membrane
(2) Mycolic acid is present in their cell wall
26. Find odd one out w.r.t. mode of nutrition in
(3) Pleomorphic nature with sculptured cell wall
bacteria
(1) Purple sulphur bacteria (4) Reproduce by binary fission only
(2) Sulphur bacteria 33. Organisms showing great diversity in the mode of
nutrition are included in
(3) Green sulphur bacteria
(1) Monera (2) Protista
(4) Purple non sulphur bacteria
(3) Fungi (4) Plantae
27. Which one of the following groups of bacteria
obtain energy by oxidizing nitrite into nitrate? 34. A group of protist is known as ‘whirling whips’
(1) Nitrosomonas and Penicillium because of the
(2) Nitrosococcus and Nitrocystis (1) Presence of pecto-cellulosic cell wall
(3) Nitrocystis and Nitrobacter (2) Spinning movement of flagella

(4) Nitrobacter and Nitrosomonas (3) Presence of contractile and noncontractile
vacuole
28. When the plasmid integrates with bacterial
chromosome, it is called as (4) Emission of light during night
(1) F+ (2) Super female 35. Which one of the following is incorrect for the
(3) Super male (4) F– members of chrysophyta?
29. Find the correct match w.r.t. role of bacteria (1) These are nonmotile, bivalved organisms
(a) Sewage disposal (i) Acetobacter (2) Presence of primordial utricle around a central
aerogens vacuole
(b) Curing of tobacco (ii) Clostridium (3) Reserve food materials are paramylon and
leaves butylicum volutin granules
(c) Decomposition of (iii)Bacillus (4) Movement occurs by mucilage propulsion
DDT megatherium
36. Auxospores are formed in the life cycle of
(d) Riboflavin production (iv) Escherichia coli diatoms, these structures are
(1) a(iv), b(iii), c(i), d(ii) (2) a(iv), b(ii), c(i), d(iii) (1) Vegetative cells with ploidy level N
(3) a(iii), b(iv), c(i), d(ii) (4) a(ii), b(iii), c(i), d(iv) (2) Asexual spores with ploidy level N
30. Monerans showing oxygenic photosynthesis
(3) Statospores with 2N ploidy level
(1) Are photolithotrophs
(4) Sexual spores with ploidy level 2N
(2) Have nonpeptidoglycan nature of cell wall
37. Holophytic spindle-shaped protistan with blunt
(3) Have photoorganotrophic mode of nutrition anterior end and pointed posterior end shows
(4) Are Gram positive bacteria which one of the following features ?
31. Obligate anaerobic monerans with pseudomurein (1) Have heterokont acronematic flagella
in their cell wall
(2) Photosensitive paraflagellar body is present
(1) Have exonic ss-DNA without histone on the outer surface of reservoir.
(2) Show photoautotrophic nutrition (3) Stigma is attached to the membrane of the
(3) Show presence of introns reservoir
(4) Have unbranched chain of lipids in cell (4) Paramylon as reserve food material is stored
membrane in the matrix of chloroplast.
38. Vegetative stage or plant body of Physarum is 45. Select unicellular group of fungi out of the
called ______ and its ploidy is ______ following genera
(1) Pseudoplasmodium, N (a) Saprolegnia
(2) Plasmodium, 2N (b) Saccharomycoides
(3) Myxamoebae, N (c) Schizosaccharomyces
(4) Microcyst, 2N (d) Pythium
39. Acellular slime moulds differ from cellular slime (e) Synchytrium
moulds in
(f) Morchella
(1) Being holocarpic and monocentric nature
(1) (a), (b), (c), (d) and (e)
(2) Having peptidoglycan type of sporangial wall
(2) (b), (c) and (e)
(3) Presence of peridium around sporangium
(4) Presence of anisogamous type sexual (3) (b), (c), (e) and (f)
reproduction (4) (a), (d), (e) and (f)
40. In the life cycle of communal slime moulds, which 46. Select an incorrectly matched pair
one of the following statement is incorrect?
(1) Diplanetism – Saprolegnia
(1) Complete absence of flagellated cells during
(2) Endogenous asexual – Sac fungi
life cycle
(2) Spores with cellulosic wall spore
(3) Chemotropic movement of myxamoebae (3) Torulating spore – Oidia
(4) Primitive form of multicellularity and division of (4) Thallospore as thick – Chlamydospore
labour is exhibited by pseudoplasmodia walled structure
41. Select odd one out w.r.t. mode of nutrition 47. Plasmogamy or sexual reproduction in the
members of class zygomycetes takes place by
(1) Paranema
(2) Rhabdomonas (1) Planogametic copulation
(3) Dictyostelium (2) Gametangial contact
(4) Physarella (3) Gametangial copulation

42. Which one of the following statements is (4) Somatogamy
incorrect w.r.t. fungi? 48. Find odd one out w.r.t. pathogens of same group
(1) Mostly terrestrial and prefer to grow in shady (1) Tikka disease in ground nut
places at optimum pH (5 - 6)
(2) Red rot of sugarcane
(2) Fungi growing on burnt wood are epixylic
(3) Black rot of cabbage
(3) Salmon disease causing pathogen is water
mould (4) Early blight of potato
(4) Thalloid plant body is nonvascular 49. Which one of the following fungicides was used to
gametophyte control downy mildew disease of grapevine?
43. In the members of class oomycetes, cell wall is (1) Burgandy mixture (2) Chestnut mixture
made up of (3) Soda bordeaux (4) Bordeaux mixture
(1) Chitin (2) Cellulose
50. Select the correct statement w.r.t. mycorrhiza
(3) Suberin (4) Lignin
(1) Ectomycorrhiza forms hartig net in the
44. Dikaryotic mycelium or hyphae is a short-lived intracellular spaces of cortex cells
structure in
(2) Endotrophic mycorrhiza are mostly
(1) Asexual stage of phycomycetes basidiomycetes members
(2) Asexual stage of deuteromycetes (3) VAM is a special type of endomycorrhiza and
(3) Sexual and vegetative stage of absorbs phosphate
basidiomycetes
(4) Mycorrhizal or fungal roots have root cap and
(4) Sexual stage of ascomycetes root hairs
51. In which one of the special structure of lichens, 57. In which of the following group of organisms,
the fungal partner is same as in the thallus but chromosomes do not have histone proteins but
algal partner is different from the thallus? nuclear membrane and nucleolus remain present
even during cell division?
(1) Cyphellae (2) Cephalodia
(1) Ceratium and Gymnodinium
(3) Isidia (4) Soredia (2) Navicula and Melosira
52. Bacteriophages are related to all features, except (3) Dictyostellium and Physarum
(1) Naked viruses with binal symmetry (4) Xanthomonas and Pseudomonas
(2) Double stranded linear DNA as genetic 58. Which of the following feature is not possessed by
material diatoms?
(3) Lysozyme secretion by capsid (1) Formation of statospores
(4) Long and contractile tail in T-even phages (2) Presence of chl. a and c
(3) Presence of pusule, a non-contractile vacuole
53. Find correct match between column I and II
(4) Movement by mucilage propulsion
Column I Column II
59. The oblique and parallely arranged strips which
(a) Red tide (i) Trichodesmium are responsible for metaboly are present in
erythraeum
(1) Flagella
(b) Red sea (ii) Chlamydomonas
nivalis (2) Paraflagellar body
(c) Red snow (iii) Gymnodinium sp. (3) Cytoplasm

(4) Pellicle
(d) Red rust (iv) Cephaleuros sp.
60. In case of communal slime moulds many cells
(1) a(iii), b(i), c(ii), d(iv) (2) a(iii), b(i), c(iv), d(ii)
come close together to form pseudoplasmodium
(3) a(i), b(iii), c(ii), d(iv) (4) a(ii), b(i), c(iii), d(iv) stage. Which of the following factor is responsible
for it?
54. Bacteriochlorophyll is not found in which of the
following group of bacteria? a. Exhausted food supply
(1) Purple sulphur bacteria b. Stimulation by cAMP

c. A chemical called acrasin
(2) Purple non-sulphur bacteria
(1) Both (a) & (b) (2) Only (c)
(3) Sulphur bacteria
(3) Both (b) & (c) (4) All of these
(4) More than one option is correct
61. Match the following
55. During conjugation in E.coli, plasmid gets
Column - I Column - II
integrated with main bacterial chromosome to
convert it into a. Cytopharynx (i) Slime moulds
(1) Super male (2) Super female b. Kieselguhr (ii) Dinoflagellates

c. Sporocarp (iii) Euglenoids
(3) F+ (4) Pathogenic form
d. Cingulum (iv) Diatoms
56. Which of the following statement is correct?
(1) a(ii), b(i), c(iv), d(iii) (2) a(iv), b(iii), c(i), d(ii)
(1) Beijerinckia and Clostridium are symbiotic
(3) a(iii), b(iv), c(i), d(ii) (4) a(iii), b(ii), c(iv), d(i)
N2 - fixing bacteria
62. Which of the following is/are the features of
(2) Nocardia and Mycobacterium are mycelial
phycomycetes?
bacteria
a. Coenocytic hyphae
(3) Cyanobacteria growing endozoically in
b. Hyphal wall contains cellulose
poriferans are called cyanellae
c. Septa of hyphae possess simple pores
(4) Thermoacidophiles develop bacteriorhodopsin
in their membranes to trap sunlight for ATP (1) (a) and (b) (2) (b) and (c)
synthesis (3) (a) and (c) (4) Only (a)
63. Match the following 68. Fuligo and Physarum are characterised by all,
except
Column I Column II
(1) Capillitia in sporangium
a. Mucor mucedo (i) Death cup
(2) Absence of cell wall in vegetative phase
b. Amanita phalloides (ii) Dung mould
(3) Non-motile swarm cells
c. Armillaria mellea (iii) Predator fungi
(4) Polycentric plasmodium
d. Dactylaria (iv) Honey mushroom
69. Cellular slime moulds
(1) a(i), b(ii), c(iii), d(iv) (1) Produce naked sporangia
(2) a(iii), b(iv), c(ii), d(i) (2) Have dominant diploid phase
(3) a(iv), b(iii), c(ii), d(i) (3) Form haploid macrocyst by mitosis
(4) a(ii), b(i), c(iv), d(iii) (4) Possess saprobic nutrition only
64. Under favourable conditions, hyphae of secondary 70. Kingdom which includes only heterotrophs with
mycelium of Agaricus collect at places and give extracellular digestion is classified into various
rise to rounded or pyriform compact mass i.e., classes on the basis of all except
(1) Spawn (1) Morphology of vegetative structure
(2) Buttons (2) Types of meiospores
(3) Sterigmata (3) Structure of sex organs and fusion product
(4) More than one option is correct (4) Life cycle and cell wall
65. The superficial outgrowths of the lichens which 71. Choose the incorrect statement w.r.t. club fungi
are primarily meant for increasing surface area (1) Presence of dolipore septum in majority of
and photosynthetic activity and also help in members
propagation, are called
(2) Secondary mycelium is long - lived
(1) Cephalodia (2) Soredia (3) Sex organ is called basidium
(3) Isidia (4) Cyphellae (4) Basidiospores are produced exogenously
66. Whirling whips included in kingdom protista of 72. Holophytic protistans as whirling whips show one
Haeckel of the following features
(a) Possess heterokont flagella with distinct 9 + (1) Movement by mucilage propulsion
2 organisation (2) Walls are embedded with silica
(b) Have isogamous reproduction and diplontic (3) A non-contractile vacuole is present
life cycle
(4) The reserve food is oils and leucosin
(c) Synthesise 50% of organic matter in the
73. When plasmogamy in fungi is brought about by
biosphere
fusion of female and amoeboid male gamete by
(d) Do not have histones in DNA fertilization tube formation, it is called as
(1) (a) and (c) are correct (1) Gametangial copulation
(2) (a) and (d) are correct (2) Gametic copulation
(3) (b) and (c) are correct (3) Gametangial contact

(4) Spermatization
(4) (b) and (d) are correct
74. Find the incorrectly matched pair with respect to
67. Photosynthetic protists which resemble like a soap
different classes of fungi
box
(1) Zygomycetes - Plasmogamy by
(1) Produce saxitoxin which impairs Na + crozier
metabolism in human beings
(2) Ascomycetes - Endogenous
(2) Form rejuvenescent spore called statospore ascospores
(3) Possess siliceous frustule with fine pores (3) Basidiomycetes - Clamp connection
(4) Cannot be a good indicator of water pollution (4) Deuteromycetes - Bengal famine
75. Archaebacteria differ from eubacteria in presence of 81. In which fungal group monokaryotic mycelium is
long lived while dikaryotic mycelium is short lived?
(1) Peptidoglycan in their cell membrane
(1) Ascomycetes (2) Deuteromycetes
(2) Well defined nucleus
(3) Basidiomycetes (4) Zygomycetes
(3) Branched chain lipids in their cell wall
82. Find the correct match
(4) Introns in their DNA Column I Column II
76. In methanogens, the pseudomurein is made up of a. Acetobacter (i) Ammonification
NAG and aerogens
(1) NAM b. Bacillus megatherium (ii) Control DDT
pollution
(2) D-amino acids
c. Pseudomonas (iii) Curing of tobacco
(3) Branched chain lipids
fluorescence leaves
(4) N-acetyltalo samiuronic acid d. Bacillus ramosus (iv) Retting of fibre
77. All of the following features are possible in (1) a(ii), b(iii), c(iv), d(i) (2) a(ii), b(iii), c(i), d(iv)
oomycetes, except (3) a(iii), b(ii), c(iv), d(i) (4) a(ii), b(i), c(iii), d(iv)
(1) Coenocytic mycelium 83. Anticoagulant substance in endospore of bacteria
(2) Gametangial contact is found in
(1) Exosporium and spore coat
(3) Motile stage
(2) Spore coat and cortex
(4) Clamp connection
(3) Cortex and core wall
78. Choose the correct statement w.r.t. cellular slime (4) Cortex and cytoplasm
moulds
84. Gram negative monerans lacking cell wall show
(1) Sporangium contains capillitia reproduction by
(2) Somatic body is free living diploid plasmodium (1) Elementary bodies
(3) Sexual reproduction is isogamous (2) Binary fission
(4) Absence of swarm cells in the life cycle (3) Conidia formation
(4) Endospore formation
79. Select an incorrect statement with regard to
different nutritional categories 85. Self feeders bacteria utilising light energy and
aliphatic organic compounds as e– and H-donor in
(1) Photo-organotrophs use organic compounds
their mode of nutrition are called
as electron donor
(1) Photolithotrophs (2) Chemolithtrophs
(2) Methanogenic archaebacteria are chemo-
organo-heterotrophs (3) Photoheterotrophs (4) Chemoheterotrophs
(3) Chemolithotrophs use inorganic electron 86. Maximum possibility of transfer of nucleoid genes
donor alongwith chemical energy from donor to recipient bacteria is expected when
conjugation occurs in between ________ strains
(4) Facultative autotrophs can grow
autotrophically and heterotrophically and are (1) F+ × F– (2) Hfr × F–
called mixotrophs (3) Hfr × Hfr (4) Hfr × F+
80. Dinoflagellates have a mesokaryotic cell 87. What is true for photosynthetic protistans having
organisation. Which of the following features is not silicified, bivalved frustules?
related to such cellular organisation?
(1) Contractile vacuoles are usually absent
(1) Single nuclear membrane
(2) Movement is brought about by mucilage
(2) No spindle formation propulsion
(3) Presence of histones (3) Movement by heterokont flagella
(4) Permanently condensed chromosomes (4) Reserve food is carbohydrate and oil
88. Theca is replaced by pellicle in 96. Fungi differs from bacteria in

(1) Zooflagellates (1) Nature of cell wall
(2) Zooxanthellae (2) Mode of nutrition
(3) Gymnodinium and Noctiluca (3) Nature of reserve food materials
(4) Navicula and Melosira (4) Type of cell division

97. Asexual reproduction by conidia formation is quite
89. Dinoflagellates show
common in
(1) Ribbon shaped chloroplast (1) Oomycetes (2) Zygomycetes
(2) Prokaryotic organisation (3) Ascomycetes (4) Basidiomycetes
(3) Spiral movement 98. Find the correct match
(4) Spinning movement Column-I Column-II
90. Photoreceptive structure in Euglena contains a. Sponge mushroom (i) Agaricus
______ pigment and it is ______ b. Button mushroom (ii) Dermatocarpon
(1) Carotenoids; present in chloroplast c. Oyster mushroom (iii) Morchella
(2) Astaxanthin; attached to the membrane of d. Stone mushroom (iv) Pleurotus
reservoir
(1) a(iii), b(i), c(ii), d(iv) (2) a(iii), b(i), c(iv), d(ii)
(3) Astaxanthin; found in cytoplasm
(3) a(i), b(iii), c(iv), d(ii) (4) a(iv), b(i), c(iii), d(ii)
(4) Haematochrome; attached to cell wall 99. Gills are found in
91. Somatic body of acellular slime mould is (1) Fruiting bodies of Aspergillus
(1) Free living, multinucleate and walled (2) Fruiting bodies of Peziza
protoplasmic mass
(3) Fruiting bodies of Agaricus
(2) Multinucleate, diploid, freeliving and naked
(4) Rhizomorph of Agaricus
protoplasmic mass
100. Special structure present on the upper surface of
(3) Coenocytic, naked haploid protoplasmic mass
lichen thallus for assimilation and reproduction is
(4) Coenocytic, walled myxamoebae (1) Cyphellae (2) Cephalodia
92. The sporangium of Dictyostelium shows (3) Soredia (4) Isidia
(1) Absence of capillitium 101. Choose the incorrect statement
(2) Peridium as sporangial covering (1) Cell wall is absent in mycoplasma
(3) Holocarpic and polycentric condition (2) Iwanowsky discovered virus
(4) Formation from plasmodium (3) VAM is related to pollution indication
93. Asexual reproduction by the formation of palmella (4) 'Black leg' is a bacterial disease
stage is reported in some species of
102. Choose the incorrect statement for Mycoplasma
(1) Diatoms (2) Dinoflagellates
(1) Unicellular and prokaryotic
(3) Euglena (4) Spirogyra
(2) Non-motile and pleomorphic
94. Myonemes are found in the ______ of Euglena
(3) Lack cell wall and resistant to penicillin
(1) Epiplasm (2) Endoplasm
(4) Circular and single stranded DNA
(3) Contractile vacuole (4) Eye spot
103. Select the correctly matched pair
95. A noncontractile vacuole called pusule is found in
(1) Primordial utricle – Dinoflagellate
(1) Euglena
(2) -carotenes – Diatoms
(2) Navicula
(3) Paramylon – -1, 3 glucan
(3) Gonyaulax
(4) Acrasin – Chemotropic
(4) Melosira movement
104. Match the following column 111. Dolipore septum and lateral clamp connections
are related to
Column I Column II
(1) Cup fungi (2) Sac fungi
a. Diplanetism (i) Tuber aestivum
(3) Club fungi (4) Algal fungi
b. Cleistothecium (ii) Penicillium
112. Choose the incorrect match
c. Truffel (iii) Lycoperdon
(1) Litmus – Rocella
d. Puffballs (iv) Saprolegnia
(2) VAM – Orchid
(1) a(iii), b(ii), c(i), d(iv) (2) a(iv), b(ii), c(i), d(iii) (3) Tikka disease – Groundnut
(3) a(iv), b(iii), c(ii), d(i) (4) a(iii), b(iv), c(ii), d(i) (4) Helotism – Ectomycorrhiza
105. The phycobiont in lichens is mostly from 113. Select the correct statement w.r.t. Monera
chlorophyceae. Select the most common chloro
(1) All unicellular and Gram negative
phycobiont among the following
(2) Very simple in behaviour
(1) Trebouxia (2) Chlorella
(3) Show the most extensive metabolic diversity
(3) Palmella (4) Protococcus
(4) Show intracellular transport by cyclosis
106. Thick walled sexual spore formed by gametangial
114. Distal set of rings in basal body of flagellum are
copulation in a group of fungi is ____________
present in
and it is quite common in the members of class
________. (1) Gram positive bacteria
(2) Both Gram positive and negative bacteria
(1) Oospore, Oomycetes
(3) Gram negative bacteria
(2) Zygospore, Zygomycetes
(4) Coccus and Chlamydomonas
(3) Zygote, Ascomycetes
115. Select the incorrect statement w.r.t. Gram
(4) Basidiospore, Basidiomycetes positive bacteria
107. Select an incorrect match (1) The walls contain very little amount of lipids
(1) Ascomycetes – Morchella (2) Cell wall is more rigid
(2) Deuteromycetes – Alternaria (3) Mesosomes are rare
(3) Basidiomycetes – Puccinia (4) Flagellation less common
(4) Phycomycetes – Erysiphe 116. In bacteria, DNA has no free ends and not
associated with
108. Find out the character associated with
cyanobacteria but not with eubacteria (1) Polyamines
(1) Nucleoid representing genetic material (2) Histone
(2) Histone absent (3) RNA

(3) Oxygenic photosynthesis
117. Bacteria which are capable of switching over to
(4) Cyst formation
anaerobic mode to get energy for their survival,
109. Peptidoglycan forms several layers in the cell wall are
of (1) Obligate anaerobes
(1) Bacillus (2) Facultative anaerobes
(2) Salmonella (3) Facultative aerobes
(3) BGA (4) Obligate aerobes
(4) Escherichia 118. Purple sulphur bacteria
110. Siliceous shells of diatoms do not decay hence (1) Use H2S as e– and H+ donor
pile up and form heaps called (2) Possess bacterioviridin pigment
(1) Cystoliths (2) Kiesulguhr (3) Use inorganic sulphur
(3) Nummulites (4) Statoliths (4) Are photoorganotrophs
119. Find odd one out w.r.t. chemolithotrophs 126. Due to formation of necridia, the filament of
cyanobacteria breaks into
(1) Nitrococcus and Nitrocystis
(2) Beggiatoa and Thiobacillus (1) Elementary bodies (2) Akinetes
(3) Ferrobacillus and Leptothrix (3) Hormogonia (4) Heterocysts
(4) Methanomonas and Azotobacter 127. Archaebacteria differs from eubacteria in
120. Which one of the following pairs of monerans are (1) Presence of D-amino acids in cell wall
able to reduce carbon and nitrogen both? (2) Presence of introns
(1) Chromatium and Mycoplasma (3) Absence of branched chain lipids in cell
(2) Nostoc and Frankia membrane
(3) Azotobacter and Clostridium (4) Absence of chemolithotrophic nutrition

128. Thermoacidophiles are able to withstand at
(4) Anabaena and Tolypothrix
extremely low pH and high temperature due to
121. Anticoagulant nature of endospore is due to the
(1) Presence of pseudomurein
presence of
(2) Branched chain lipids
(1) Dipicolinic acid (2) Diaminopimelic acid
(3) Absence of cell wall
(3) D-glutamic acid (4) PHB
(4) Presence of sap vacuoles
122. Bacterial cell divides every two minutes. It takes
20 minutes a cup to be one-fourth full. How much 129. Bacteria with their coats off
time it will take to fill the cup?
(1) Are highly pleomorphic and saprophytic only
(1) 24 minutes
(2) Give fried egg appearance in vitro
(2) 60 minutes
(3) Have only one type of nucleic acid
(3) 40 minutes (4) Are infectants of animals only
(4) 50 minutes 130. Holophytic protistans with armoured nature are
123. Sterile male method of conjugation is present in (1) Diatoms (2) Dinoflagellates
between the
(3) Euglenoids (4) Slime moulds
(1) F– and F–
131. Life cycle involves zygotic meiosis in
(2) F+ and F–
(1) Gymnodinium (2) Noctiluca
(3) Hfr and F–
(3) Lyngbya (4) Melosira
(4) Hfr and Hfr
132. Flagella are heterokont in
124. The mode of genetic recombination in Salmonella
typhimurium was demonstrated by (1) Dinoflagellates
(1) F.Griffith (2) Diatoms
(2) Avery et.al. (3) Euglena
(3) Zinder and Lederberg (4) More than one option is correct
(4) Lederberg and Tatum 133. Photosynthetic protists as whirling whips show
125. Gram negative monerans with 4-layered cell wall (1) Silicified cell wall (2) Contractile vacuole
show (3) Paraflagellar body (4) Grooves in theca
(1) Unicellular or multicellular thallus structure 134. Mesokaryon type nucleus is associated with the
(2) Anoxygenic photosynthesis members of
(3) Nitrogen reduction but no carbon reduction (1) Pyrrophyta (2) Chrysophyta
(4) Alternation of generation (3) Bacillariophyceae (4) Euglenophyta
135. Reserve food material in wall-less photosynthetic 142. Polycentric and holocarpic member is
protists is (1) Dictyostelium
(1) Leucosin (2) Paramylon
(2) Polysphondylium
(3) Chrysolaminarin (4) Glycogen
(3) Physarum
136. The common mode of asexual reproduction in
(4) Penicillium
Euglena is by
143. Motile stage is present in
(1) Longitudinal binary fission in favourable
condition (1) Physarella and Anabaena
(2) Longitudinal binary fission in unfavourable (2) Diatoms and cellular slime moulds
condition (3) Acellular slime moulds, cyanobacteria and
(3) Palmella stage dinoflagellates
(4) Cyst formation (4) Spirochaetes, plasmodial slime moulds and
137. Select the correct match pyrrophytes
Column - I Column - II 144. Choose odd one out w.r.t. Ascomycetes
a. Red tide (i) Gymnodinium (1) Sponge mushroom
b. Red sea (ii) Trichodesmium (2) Pigmented moulds

c. PSP (iii) Noctiluca (3) Toadstool
d. Bioluminescence (iv) Gonyaulax catenella (4) Cup fungi
(1) a(ii), b(iii), c(i), d(iv) (2) a(ii), b(i), c(iv), d(iii) 145. Common type of asexual spore in a group of fungi
having shorter dikaryophase in their sexual life
(3) a(i), b(iii), c(ii), d(iii) (4) a(iv), b(ii), c(iii), d(i)
cycle is
138. Select the incorrect statement w.r.t. slime moulds
(1) Sporangiospore (2) Conidia
(1) Vegetative stage resembles protozoa
(3) Zygospore (4) Zoospore
(2) Have holophytic as well as saprobic mode of
nutrition 146. Select the incorrect match w.r.t. plasmogamy.
(3) All members are holocarpic (1) Spermatization – Puccinia
(4) Spores have cellulosic wall (2) Gametangial copulation – Pythium
139. Anisogamous sexual reproduction with zygotic (3) Gametangial contact – Cystopus
meiosis is characteristic of
(4) Somatogamy – Agaricus
(1) Cellular slime moulds
147. A class of fungi with cellulosic cell wall shows
(2) Acellular slime moulds
(a) Primary mycelium
(3) Archaebacteria
(b) Secondary mycelium
(4) Diatoms and desmids
(c) Coenocytic mycelium
140. Which one of the following structure is formed
chemotactically in slime moulds? (d) Conidiosporangia
(1) Myxamoebae (2) Plasmodium (e) Ascogonium (f) Oogonium
(3) Pseudoplasmodium (4) Macrocyst (1) a, b, d, e (2) b, d, e, f
141. Sporocarp formed in asexual life cycle of cellular (3) c, d, f (4) b, d, f
slime mould, is
148. Great Irish famine was caused by the fungus
(1) Stalked and lacks peridium
(1) Synchytrium endobioticum
(2) Developed from pseudoplasmodium as diploid
structure (2) Albugo candida
(3) Sessile and developed in wet condition (3) Alternaria solani
(4) More than one option is correct (4) Phytophthora infestans
149. The structure which separates the spore bearing 155. The fertile structure of fruiting body in common
part from rest of sporangiophore in Rhizopus is field mushroom is
(1) Sporiferous zone (1) Peridium (2) Annulus
(2) Stoloniferous hyphae (3) Stipe (4) Gill

156. Which one of the following group of fungi
(3) Columella
represents similar sexual spore?
(4) Sporangium wall (1) Puffballs, shelf fungi, Caeser’s mushroom
150. Type of fruiting body in Claviceps is (2) Gill fungi, wood fungi, cup fungi
(1) Cleistothecium (2) Apothecium (3) Yeast, laboratory mould, dung mould
(3) Perithecium (4) Hysterothecium (4) Black mould, water mould, powdery mildew
157. Bengal famine was caused by a fungal member
151. Most advanced and most commonly seen fungi
which belongs to the class
that decompose cellulose and lignin are the
members of (1) Oomycetes (2) Ascomycetes
(1) Phycomycetes (2) Ascomycetes (3) Basidiomycetes (4) Deuteromycetes

158. Bordeaux mixture
(3) Basidiomycetes (4) Deuteromycetes
(1) Is inorganic fungicide
152. Which one of the following is correctly matched
w.r.t. all columns? (2) Is organic fungicide
(3) Was first used to control downy mildew of
Column I Column II Column III
grapevine disease
(1) Smut fungi – Club fungi – Clamp (4) Both (1) & (3)
connection
159. The ultimate branches of conidiophores in
and
Penicillium
dolipore
septa (1) Possess sterigmata
present (2) Are sterigmata
(2) Truffel – Sac fungi – Edible (3) Cut-off conidia in basipetal order
ascocarp (4) Are rami
(3) Fairy rings – Gametangial – Basidiocarp 160. Hartig net as network of intercellular hyphae is
contact present in
(4) Black rust – Heteroecious – Dikaryon (1) All mycorrhiza (2) Ectomycorrhiza
pycnio (3) Endomycorrhiza (4) VAM
spores
161. SO2 pollution indicator is
153. Dolipore septa and dikaryotic nature is found in
(1) Fungi (2) Diatoms
(1) Primary mycelium (3) Lichen (4) Mycorrhiza
(2) Secondary mycelium 162. In most of the lichens, phycobionts are
(3) Coenocytic mycelium (1) Blue green algae (2) Green algae
(4) More than one option is correct (3) Golden algae (4) Brown algae
154. In the life cycle of Agaricus, secondary mycelium 163. In which one of the following members,
develops when basidiocarp send puffs of spores on ripening?
(1) Hyphae of two matting types showing (1) Polyporus (2) Lycoperdon
plasmogamy (3) Amanita (4) Fomes
(2) Primary mycelium shows plasmogamy with 164. Thallus is attached to the substratum with the help
spermatia of rhizines in
(3) Basidiospore germinates (1) Crustose lichens (2) Foliose lichens
(4) Gametangial contact occurs (3) Fruticose lichens (4) Reindeer moss
165. Pinocytic reproduction occurs in 173. A. Oidia can be produced in amino acid rich
medium.
(1) T4 phage (2) phage
B. Dikaryophase is dominant in life cycle of club
(3) Hepatitis B virus (4) T2 phage
fungi
166. Microscopic lichen propagules produced inside
C. Flagellated cells are found in class
pustules as a most efficient means, of asexual
zygomycetes
reproduction are
(1) All are correct
(1) Isidia (2) Soredia
(2) Only A is correct
(3) Cyphellae (4) Cephalodia
(3) Both A and B are correct
167. Septate mycelium and asexual reproduction by
conidia are major features of artificial class of (4) Both A and C are incorrect
fungi known as 174. Find odd one out w.r.t. plasmodial slime moulds
(1) Ascomycetes (2) Basidiomycetes (1) Physarum (2) Fuligo
(3) Oomycetes (4) Deuteromycetes (3) Physarella (4) Dictyostelium
168. Basidiomycetes members commonly form a 175. Gonyaulax catenella and Noctiluca are specific
network of mycelium in the intercellular spaces of examples of ________ respectively.
the cortex of Pinus root, known as
(1) Bioluminescence and mesokaryotic nature
(1) Hyphal traps (2) Haustoria (2) Red sea and bioluminescence
(3) Snares (4) Hartig net (3) Red tide and bioluminescence
169. Hymenium is the fertile layer of gill in Agaricus (4) Red stripe and diatomaceous earth
basidiocarp and includes
176. Photosynthetic protists having soap box like
(1) Paraphyses and subhymenium structure are not related to
(2) Basidium and subhymenium (1) Chlorophyll a and c
(3) Basidiospores and trama (2) Chrysolaminarin as reserve food
(4) Basidium and paraphyses (3) Heterokont flagellation in grooves
170. Match the following (4) Longitudinal binary fission
Column-I Column-II 177. Mark the incorrect option (w.r.t. Mycoplasma)
a. Fly agaric (i) Armillaria (1) Wall-less organism
b. Puff ball (ii) Psilocybe (2) Having ss-DNA and RNA in same cell
c. Honey mushroom (iii) Amanita (3) Producing elementary bodies as major means
of reproduction
d. Sacred mushroom (iv) Lycoperdon
(4) Insensitive against penicillin
(1) a(ii), b(i), c(iii), d(iv) (2) a(iii), b(iv), c(i), d(ii)
178. Read the following statements carefully and select
(3) a(i), b(iv), c(iii), d(ii) (4) a(i), b(ii), c(iii), d(iv) the correct one w.r.t. archaebacteria
171. In Penicillium, bottle like conidia bearing structures a. Presence of histones
are present at the tip of
b. Branched chain lipids in plasma membrane
(1) Rami (2) Metulae
c. Found in extremes of habitats
(3) Sterigmata (4) Phialides
d. Pseudomurein absent in cell wall
172. Cleistothecium is a closed fruiting body
surrounded by a wall called peridium. Such a (1) All except d
fruiting body is found in (2) Only c
(1) Claviceps (2) Neurospora (3) b, c and d
(3) Penicillium (4) Peziza (4) a, b and d
179. Due to the formation of biconcave, mucilage filled, 186. Toad stools, puff balls and morels are similar in
dead cells called necridia in between living cells the presence of
of trichome of BGA, the filament breaks into
(1) Basidiocarp
(1) Akinetes (2) Cyst
(2) Coenocytic mycelium
(3) Heterocyst (4) Hormogonia
(3) Ascocarp
180. Select an incorrect match
(4) Dikaryophase
(1) Tolypothrix – Rice fields
187. Lichens are dual organisms which contain a
(2) Anabaena – Sago palm
permanent association of a mycobiont and a
(3) Microcystis – Anthoceros phycobiont. These organisms
(4) Spirulina – SCP (1) Can tolerate air pollution
181. Which mycelial bacteria can fix N2 symbiotically (2) Are perennial
by root nodule formation in non legume plants?
(3) Show rapid growth
(1) Casuarina (2) Nocardia
(4) Show asexual reproduction only
(3) Frankia (4) Corynebacterium
188. Pathogen of potato spindle tuber disease
182. When Hfr conjugates with an F– bacterium, the
(1) Is infectious RNA with high molecular weight
(1) F – cell will convert to F + but always a
recombinant (2) Is infectious to both plants and animals
(2) F– cell will convert to F+ but is never a (3) Is a tightly folded RNA with low molecular
recombinant weight
(3) F– will remain F– and may or may not be a (4) Has protein coat as well as genetic material
recombinant
189. Choose the correct statement w.r.t.
(4) F– will convert to Hfr without recombinations phycomycetes
183. Mark the odd one (w.r.t. photolithotrophs) (1) Gametes are always similar in morphology
(1) Chloronema, Chloroflexus (2) Mycelium is aseptate and coenocytic
(2) Chlorobium, Thiospirillum (3) Produce non-motile asexual spores, not
(3) Chromatium, Chlorobium zoospores
(4) Thiospirillum, Chromatium (4) Presence of dikaryophase
184. Find the correct set of the given kingdoms 190. Select the incorrect statement w.r.t. eubacteria
proposed by Whittaker which perform
decomposition. (1) Cocci are nonflagellated and Gram positive
(1) Monera, protista and plantae (2) They have crystal violet stainable property
and become bluish purple
(2) Fungi, monera and protista
(3) Pseudomonas is a photoheterotroph
(3) Protista, plantae and animalia
(4) Plantae, monera and fungi (4) Chemolithotrophs play important role in
minerals cycling
185. Some dinoflagellates like Gonyaulax catenella
undergo such rapid multiplication that they make 191. Plasmodial slime moulds differ from cellular slime
the red appearance of sea. Toxins released by moulds in the
such large number (1) Sporic wall chemical nature
(1) May kill shell fishes (2) Mode of nutrition
(2) Cause PSP in fishes (3) Presence of wall-less vegetative stage with
(3) Are poisonous to vertebrates holocarpic nature
(4) Cannot enter in food chain (4) Presence of isogamous type reproduction
192. Choose the correct set of characters for sac fungi 197. Which of the following bacteria is used to remove
from given features bitterness of tobacco leaves?
a. Coenocytic mycelium with chitinous wall (1) Bacillus megatherium
b. Primary mycelium with cellulosic wall (2) Bacillus subtilis
c. Woronin bodies (3) Frankia
d. Exogenously formed meiospore (4) Lactobacillus
e. Exogenously formed asexual spore 198. Some dinoflagellates produce a toxin that causes
f. Ascocarp severe illness in man. This toxin
(1) b, c, d, f (2) c, e, f (1) Causes PSP in mussel
(3) c, d, e, f (4) a, d, e, f (2) Enters in man by consumption of an organism

which is unaffected by the toxin
193. Which one of the following statement is incorrect
for lichens? (3) Is highly poisonous to invertebrates only
(1) Mycobiont is dominant partner (4) Does not interfere with neuromuscular
transmission in humans
(2) Rhizines are associated with fruticose lichens
199. Neurospora, Penicillium, Polyporus, Claviceps and
(3) Sex organs and frutifications are of fungal origin
Agaricus
(4) Isidia are photosynthetic as well as reproductive
(1) Produce predominant dikaryophase in life
vegetative structure
cycle
(2) Possess aseptate mycelium
(1) Frankia – Actinomycetes – Root nodules
(3) Develop fruiting body in sexual life cycle
(2) Mycoplasma – Wall less – Obligate aerobic
(4) Produce exogenous meiospores
(3) Anabaena – BGA – Heterocyst
200. T2 bacteriophage and tobacco mosaic virus
(4) Xanthomonas – Bacteria – Citrus Canker
(1) Lack RNA and DNA respectively
(2) Have capsid around the ds-DNA
Column-I Column-II
(3) Have ss-DNA and ss-RNA respectively
a. Claviceps (i) Smut disease
(4) Lack tail fibres
b. Albugo (ii) Red rot disease
201. Choose the odd one out w.r.t. slime moulds
c. Colletotrichum (iii) Ergot disease
(1) Spores possess true cellulosic walls
d. Ustilago (iv) White rust disease
(2) The body moves along decaying twigs and
(1) a(iii), b(iv), c(ii), d(i) leaves engulfing organic material
(2) a(iii), b(i), c(ii), d(iv) (3) Can grow and spread over several feets
(3) a(ii), b(i), c(iii), d(iv) (4) Spores are dispersed by water currents
(4) a(iv), b(ii), c(iii), d(i) 202. Acellular slime moulds are characterised by
196. Neurospora, Ustilago and Agaricus are similar in (1) Free living multinucleate, haploid, naked
presence of ________ during sexual life cycle somatic body
(1) Endogenous meiospore
(2) Isogamous sexual reproduction
(2) Dikaryophase
(3) Zygotic meiosis
(3) Exogenous meiospore
(4) Formation of single fructification from somatic
(4) Basidiocarp body
203. Plasmogamy in wheat rust fungi occurs by 210. Photosynthetic protists showing movement by
mucilage propulsion are
(1) Gametangial contact
(1) Bioluminescent in nature
(2) Somatogamy
(2) Jewels of the plant kingdom
(3) Spermatization
(3) Ray fungi
(4) Gametangial copulation
(4) Coenocyte with naked protoplasmic body
204. Absence of sex organs, general absence of 211. Plasmid of which bacterium has the quality to
asexual spores and plasmogamy by means of degrade hydrocarbons/oil spills?
somatogamy are features characteristic to
(1) Pseudomonas putida
(1) Ascomycetes (2) Agrobacterium tumefaciens
(2) Deuteromycetes (3) E. coli
(3) Basidiomycetes (4) Acetobacter aerogens
(4) Phycomycetes 212. Rhodopseudomonas and Rhodospirillum are
photosynthetic forms belonging to ____________
205. According to five kingdom classification system,
category.
which of the following kingdom has multicellular/
loose tissue level body organisation? (1) Purple sulphur (2) Purple non-sulphur
(3) Green non-sulphur (4) Green sulphur
(1) Protista (2) Plantae
213. Read the statements carefully
(3) Animalia (4) Fungi
a. Use of ATP and NADPH
206. Trichoderma, bracket fungi, Neurospora,
b. Anoxygenic process
Colletotrichum and Aspergillus are similar in
presence of c. No splitting of water
(1) Dolipore septa in mycelium d. H2O as a source of e– and H+

e. Chlorophyll a as photosynthetic pigment
(2) Cross wall in their hyphae
Find the correct statements for photosynthesis in
(3) Sexual reproduction
eubacteria
(4) Simple septa in mycelium (1) a, b, c & d (2) b & c
207. Beijerinckia, Frankia, Anabaena, Nitrobacter and (3) a, b, c & e (4) a, b & c
Rhizobium
214. The reaction H2S + O H2O + S + Energy ;
(1) Are nitrogen fixers is carried out by
(2) Produce nitrogenase enzyme (1) Ferrobacillus (2) Beggiatoa
(3) Take part in nitrogen metabolism (3) Hydrogenomonas (4) Leptothrix

215. Select the incorrect statement w.r.t. dinoflagellates
(1) Theca is absent in zooxanthellae
208. Oscillatoria, Mycorrhiza and Azospirillum
(2) Ribbon like flagellum is present in the girdle
(1) Increase nitrogen content only
(3) Have condensed chromosomes with histones
(2) Enrich the nutrient quality of soil
(4) Have noncontractile vacuole
(3) Are used in organic farming 216. Binary fission in a bacterial cell
(4) More than one option is correct a. Occurs during most unfavourable conditions
209. Amitotic cell division, absence of 9+2 organisation b. Requires replication of DNA using Cairns
in flagella and peptidoglycan cell wall are features model
related to kingdom c. Is helped by mesosomes
(1) Protista (2) Plantae (1) All are correct (2) Only ‘a’ is incorrect
(3) Monera (4) Fungi (3) Only ‘b’ is incorrect (4) Only ‘c’ is incorrect
217. Which wall layer of endospore contains Ca-DPA 225. a. Flagella are absent throughout the life in BGA
complex working as anticoagulant?
b. Hormogonia are commonly absent in
(1) Exosporium (2) Spore coat Oscillatoria
(3) Cortex (4) Core wall c. Heterocyst are thick walled N2 fixing cells in
Anabaena and Nostoc
218. Resting asexual spore statospore is formed in
(1) Both b & c are correct
(1) Navicula (2) Physarum
(2) Both a & b are incorrect
(3) Melosira (4) Slime moulds
(3) Both b & c are incorrect
219. Select the incorrect match
(4) Only b is incorrect
(1) Photolithotroph – Chlorobium
226. Which of the given characters are not associated
(2) Chemolithotroph – Nitrocystis with BGA?
(3) Photoheterotroph – Pseudomonas a. Anoxygenic photosynthesis
(4) Chemoorganotroph – Methanomonas b. Red sea
220. Astaxanthin pigment is found in ______ of c. Red snow
Euglena
d. Lamellasome
(1) Paraflagellar body e. Mucilage cover
(2) Reservoir f. Algal bloom
(3) Contractile vacuole & plastid (1) a & c (2) a, b & f
(4) Stigma (3) a, b & e (4) a & d
221. What occurs when a F+ bacterium conjugates with 227. Mycoplasma differs from eubacteria in
F– bacterium? (1) Not having 70 S ribosome
(1) F+ F– (2) Having cell wall
(2) F– F+ (3) Having linear dsDNA
(3) F– Hfr (4) Showing penicillin sensitivity
(4) Hfr F– 228. All given are characters of archaebacteria, except
222. Slime moulds with sporic meiosis show (1) Pseudomurein cell wall
(2) Bacteriorhodopsin to perform photosynthesis
(1) Diploid somatic stage
(3) Habitat in extremes of environment
(2) Motile stage in life cycle
(4) Presence of branched chain lipids as
(3) Chemotactic movement monolayer
(4) Sporangia with capillitia 229. Unicelled, flagellate, wall-less protista having
pigments similar to higher plants have/shows
223. The stage of karyogamy in communal slime
moulds is (1) Sexual reproduction by isogamous method
(1) Plasmodium (2) Two stichonematic flagella

(3) Mixotrophic nutrition
(2) Small myxamoebae
(4) Transverse binary fission
(3) Pseudoplasmodium
230. Cellular slime moulds are similar to acellular slime
(4) Large myxamoebae moulds in
224. The mycelial bacterium which can symbiotically fix (1) Having true wall around spores
N2 in non-leguminous plants is (2) Presence of pseudoplasmodium
(1) Bradyrhizobium (2) Frankia (3) Being true multicelled organisms
(3) Nocardia (4) Mycobacterium (4) Lacking wall around sporangium
231. Select the correct match 239. Match the following
(1) Cymbella – Dinoflagellate Column I Column II
(2) Paranema – Euglenoid a. Conidia (i) Saprolegnia
(3) Gymnodinium – Diatom b. Sporangiospore (ii) Rhizopus
(4) Dictyostelium – Acellular mould
c. Budding (iii) Saccharomyces
232. Organisms as sewage pollution indicators, soap
d. Zoospore (iv) Aspergillus
box like structure with chlorophyll a and c are
included in (1) a(iii), b(ii), c(iv), d(i)
(1) Chrysophyta (2) Pyrrophyta (2) a(i), b(ii), c(iii), d(iv)
(3) Euglenophyta (4) Myxomycetes (3) a(i), b(iv), c(iii), d(ii)
233. Bioluminiscence is shown by all, except (4) a(iv), b(ii), c(iii), d(i)
(1) Navicula (2) Pyrodinium
240. Torula stage appears when _____________ form
(3) Pyrocystis (4) Noctiluca continuous buds in sugar rich medium
234. Organism which is responsible for paralytic shell (1) Conidia (2) Zoospore
fish poisoning is associated with
(3) Oidia (4) Sporangiospores
(1) Red sea (2) Red rust
241. The process of plasmogamy where a fertilisation
(3) Red tide (4) Red rot
tube develops to facilitate the migration of male
235. Consider the following statements nucleus into female gametangium, is known as
a. Naked protoplast is called plasmodium (1) Spermatization
b. Spore dispersed by air currents
(2) Gametangial copulation
c. Position in class myxophyceae
(3) Planogametic fusion
d. Mode of reproduction is isogamy and
anisogamy (4) Gametangial contact
Find incorrect w.r.t. slime moulds 242. The set of vegetative hypha in Rhizopus is
represented by
(1) c & d (2) a & b
(1) Rhizoidal and zygospore hypha
(3) b & c (4) Only c
236. Aseptate, multinucleate condition called (2) Stoloniferous and rhizoidal hypha
‘coenocyte’ is characteristically found in (3) Sporangiophore and rhizoidal hypha
(1) Zygomycetes and Ascomycetes (4) Sporangiophore and stoloniferous hypha
(2) Basidiomycetes and Phycomycetes 243. Consider the following statements w.r.t. Rhizopus
(3) Oomycetes and Deuteromycetes
a. Presence of coenogametes
(4) Zygomycetes and Oomycetes
b. Flagellated zoospores
237. Chitinous cell wall is commonly found in fungi but
some members may have cellulosic cell wall like c. Zygospore as sexual spore
(1) Claviceps and Puccinia d. Ascospore formation
(2) Neurospora and Phytophthora (1) All are correct (2) b & c are incorrect
(3) Albugo and Pythium (3) b & d are incorrect (4) a & d are correct
(4) Saccharomyces and Fuligo 244. Absence of motile forms, asexual reproduction
238. Terminal swollen structure in fungi for absorption through conidia and endogenous sexual spore is
of nutrients from host cell is known as a character of class
(1) Snares (2) Appresorium (1) Zygomycetes (2) Ascomycetes
(3) Haustoria (4) Rhizomorph (3) Oomycetes (4) Basidiomycetes
245. Select the incorrect match 251. Deuteromycetes are different from ascomycetes in
(1) Cleistothecium – Penicillium (1) Formation of conidia
(2) Apothecium – Neurospora (2) Having septate mycelium
(3) Perithecium – Claviceps (3) Crozier formation
(4) Ascostroma – Pleospora (4) Absence of sexual reproduction
246. Select a set of edible members of ascomycetes 252. Spawn, fairy rings, pileus and stipe are terms
related to the life cycle of
(1) Morchella and Agaricus
(1) Black rust fungi (2) Gill fungi
(2) Pleurotus and Tuber
(3) Blue mould (4) Smut fungi
(3) Morchella and Tuber 253. Absence of sex organs and asexual spores is a
(4) Agaricus and Pleurotus characteristic of class
247. Which one of the following is incorrectly matched? (1) Ascomycetes (2) Basidiomycetes
(3) Deuteromycetes (4) Oomycetes
(1) Diplontic life cycle – Ceratium
254. Nuclear membrane and nucleolus presists during
(2) Mesokaryon – Pyrocystis division in
(3) Wriggling movement – Euglena (1) Diatoms
(4) Silicified protists – Leucosin (2) Slime moulds
248. All given statements stand true w.r.t. Lichens, (3) Euglenoids
except (4) More than one option is correct
(1) These are indicators of SO 2 pollution, as 255. Bottle like structures at the tip of ultimate branch
shown by there abundance in these areas of Penicillium conidiophore are known as
(2) Breathing pores help in gas exchange, these (1) Rami
are found towards upper surface of thallus
(2) Sterigmata
(3) This association is also termed as helotism
(3) Metulae
(4) Crustose lichens are pioneers of rock (4) More than one option is correct
succession
249. Most efficient structure for asexual reproduction in
lichens is Column I Column II
(1) Isidia (2) Cyphellae a. Honey mushroom (i) Lycoperdon
(3) Cephalodia (4) Soredia b. Puff ball (ii) Amanita

c. Stink horn (iii) Armillaria
250. Mycorrhiza are also called fungal roots, commonly
d. Toad stool (iv) Phallus
a. Ectomycorrhiza are associated with Pinus
(1) a(iv), b(ii), c(iii), d(i) (2) a(iii), b(i), c(iv), d(ii)
b. Endomycorrhizal fungi are members of
zygomycetes (3) a(iii), b(ii), c(iv), d(i) (4) a(ii), b(i), c(iv), d(iii)
c. Basidiomycetes members are found 257. Select the incorrect statement

associated with orchids (1) Conidia are asexual structure in Penicillium
d. These helps to absorb phosphorus (2) Zoospores are formed during favourable
(1) All are correct except c condition
(3) Oospores are diploid asexual spores
(2) a & c are incorrect
(4) In asexual reproduction, a single parent
(3) b & c are incorrect
produces offspring with or without the
(4) c & d are correct formation of gametes
258. Calcium dipicolinic acid (Ca - DPA) is present in 264. Mycorrhizal fungi
________ of bacterial endospore (1) Increase uptake of minerals by plant root
(1) Core wall (2) Spore coat (2) Do not produce growth promoting hormones
(3) Cortex (4) Exosporium (3) Obtain their shelter and nutrients from root of
host plant
259. Curing of leaves in tobacco is brought about by
(1) Clostridium perfringens
265. Haplophase, dikaryophase as well as diplophase
(2) Methylophilus methylotropus are present in the life cycle of following members,
except
(3) Bacillus subtilis
(1) Mucor (2) Ustilago
(4) Bacillus megatherium
(3) Agaricus (4) Puccinia
260. Heterocysts are large sized, pale coloured, 266. Concave circular depressions confined to lower
mucilage free, specialised cells that cortex of a few foliose lichens that help in aeration
(1) Are universally present in all members of in lichen thallus are called
myxophyceae (1) Cyphellae (2) Cephalodia
(2) Have oxidising environment which is ideal for (3) Isidia (4) Soradium
nitrogen fixation 267. Vibrio cholerae, Xanthomonas citri, Lactobacillus,
(3) Do not occur in Oscillatoria Clostridium tetani and Rhizobium
(1) Are pathogens
(4) Lack PS-I as well as PS-II
(2) Are chemo-organoheterotrophs
261. Which of the following statement is wrong about
thermoacidophiles? (3) Play a great role in recycling nutrients
(4) Can survive in some of the most harsh
(1) They have resistant enzymes which can habitats
operate under acidic conditions
268. Euglenoids are Euglena like unicellular flagellates
(2) They are photosynthetic in nature that belong to division euglenophyta. These
(3) They reduce sulphur to H2S under anaerobic organisms
conditions (1) Are usually found in running fresh water
(4) The cell membrane contains branched chain (2) Have pellicle which makes their flagella
lipids flexible
262. Select the incorrect match/statement (3) Have pigments identical to higher plants
(4) Cannot behave like predator
(1) Chrysophytes – Statospores
269. Mark the fungal classes in which plasmogamy is
(2) Plasmodium of acellular slime moulds creeps immediately followed by karyogamy to form diploid
over the substratum by means of cells.
pseudopodia
(1) Oomycetes, Zygomycetes
(3) Pyrrhophyta – Fire algae
(2) Phycomycetes, Ascomycetes
(4) Euglenoids have pellicle in place of cell
(3) Basidiomycetes, Deuteromycetes
membrane
(4) Basidiomycetes, Ascomycetes
263. During the life cycle of communal slime moulds
270. Lichens are symbiotic associations between algae
(1) Meiosis results in haploid and true walled and fungi. These organisms
spores
(1) Can tolerate extreme desiccation and air
(2) Somatic phase is represented by uninucleate pollution
and diploid myxamoebae (2) Have various colouration and slow growth
(3) Capillitium as well as pseudoplasmodium are (3) Commonly have a basidiomycete as
not formed mycobiont
(4) Sporangium is not covered by peridium (4) Can multiply by soredia only
271. Select the character which is specific to members 275. Albugo, morels, Alternaria and Vibrio are
of chrysophyta
(1) Autotrophic organisms
(1) Mostly marine habitat
(2) Heterotrophic organisms
(2) Mixotrophic mode of nutrition
(3) Saprophytic fungi
(3) Indestructible siliceous wall
(4) Parasitic fungi
276. Cell type – Eukaryotic
272. Septate mycelium, fragmentation as common
Cell wall – Present in some
mode of reproduction, with generally absence of
members
asexual spores are features of
(1) Deuteromycetes (2) Basidiomycetes Mode of nutrition – Autotrophic and
heterotrophic
(3) Ascomycetes (4) Phycomycetes
According to five kingdom classification, these
273. Match the following characters belong to kingdom(s)
Column I Column II (1) Monera and Protista
a. Ustilago nuda tritici (i) Brown leaf spot of (2) Monera
rice
(3) Protista
b. Albugo candida (ii) Ergot of rye
(4) Protista and Animalia
c. Claviceps (iii) Loose smut of
wheat 277. Vast majority of bacteria are
d. Helminthosporium (iv) White rust of (1) Photosynthetic autotrophic
crucifers (2) Heterotrophic
(1) a(iii), b(iv), c(ii), d(i) (2) a(iv), b(ii), c(iii), d(i) (3) Chemosynthetic autotrophic
(3) a(iii), b(i), c(ii), d(iv) (4) a(ii), b(i), c(iii), d(iv) (4) Photolithotrophic
274. Examine the figure given below and select the
278. Halophilic and thermoacidophilic archaebacteria
right option giving all the three parts (A, B and C)
are similar in the presence of
correctly identified
(1) Cyclosis
(2) Branched chain lipids in cell wall
"
(3) Linear ssDNA
! (4) Non-cellulosic cell wall
279. Which of the following organisms are helpful in
# making curd form milk, production of streptomycin
(1) A – Dikaryotic mycelium and nitrogen fixation in legumes?
B – Hymenium (1) Mycoplasma (2) Eubacteria
C – Pileus (3) Archaebacteria (4) Cyanobacteria
(2) A – Trama 280. Consider the following statements w.r.t.
B – Stipe Mycoplasma
C – Sub-hymenium a. They lack cell wall.
(3) A – Basidiocarp b. They are the largest living cell.
B – Asci c. They can survive without oxygen
C – Stipe d. They are pathogenic to animals only.

(4) A – Rhizomorph The correct statements are
B – Pileus (1) b & d (2) b & c
C – Stipe (3) a & c (4) a & d
281. Chrysophytes, euglenoids and dinoflagellates are/ 288. Consider the following four statements (a-d) and
have select the right option for two correct statements
w.r.t. Rhizopus
(1) Chemosynthetic in nutrition
(2) Chlorphyll a and b a. Mycelium is aseptate
(3) Single celled eukaryotes b. Aplanospores are motile and exogenous in

origin.
(4) Silicified cell wall
c. Zygospores are formed by fusion of gametes
282. In diatoms the cell walls form two in sexual reproduction.
(1) Thin non-overlapping shells d. It is the parasitic fungi on mustard.
(2) Thin overlapping shells The correct statements are
(3) Thick non-overlapping shells (1) b & c (2) a & c
(4) Suberised overlapping shells (3) a & d (4) c & d
283. Select the wrong statement
289. Which of the following fungi is used extensively in
(1) Dinoflagellates are mostly present in fresh biochemical and genetic work?
water
(1) Claviceps (2) Neurospora
(2) Majority of euglenoids are fresh water
(3) Penicillium (4) Ustilago
organisms
(3) Spores possess true walls in slime moulds 290. Sex organs are absent and plasmogamy is
brought about by fusion of two vegetative or
(4) Spores in slime moulds are dispersed by air somatic cells of different strains or genotypes in
currents
(1) Penicillium (2) Colletotrichum
284. Select the sexual spores w.r.t. fungus
(3) Agaricus (4) Trichoderma
(1) Oospores, conidiospores, basidiospores,
ascospores 291. (A) Only the asexual or vegetative phases of these
fungi are known.
(2) Oospores, basidiospores, ascospores
(B) Large number of members are decomposers
(3) Basidiospores, ascospores, sporangiospores of litter and help in mineral cycling.
(4) Conidia, sporangiospores, zoospores
These statements (A & B) are true for
285. Sexual life cycle of bracket fungi is different from
(1) Deuteromycetes (2) Ascomycetes
Rhizopus in the presence of
(3) Basidiomycetes (4) Phycomycetes
(1) Diplophase (2) Dikaryophase
(3) Meiosis (4) Karyogamy 292. Lichens are mutually useful associations between
286. Which of the following statements for (1) Autotrophic and heterotrophic members
Methanobacterium is true? (2) Two autotrophic partners
(1) Presence of histone proteins and 80S type (3) Two heterotrophic partners
ribosomes
(4) Fungi and roots of higher plants
(2) Absence of membrane bound organelles
293. During unfavourable conditions, the plasmodium
(3) Presence of nuclear membrane of slime moulds differentiates and forms fruiting
(4) Absence of cell wall and RNA bodies bearing
287. Members of which group of fungi can belong to (1) Spores at their tips
aquatic habitats and have coenocytic mycelium? (2) Gametes at their basal part
(1) Ascomycetes (2) Phycomycetes (3) Gametes at their tips
(3) Deuteromycetes (4) Basidiomycetes (4) Spores at their basal part
294. Type of DNA and RNA found in Mycoplasma are 301. Match the following correctly
respectively
Column I Column II
(1) Double stranded and single stranded
a. Saxitoxin (i) Euglena
(2) Single stranded and double stranded
b. Acrasin (ii) Gonyaulax
(3) Linear and circular
c. Kieselguhr (iii) Dictyostelium
(4) Single stranded and circular
d. Astaxanthin (iv) Cymbella
295. Albugo candida and Mucor are similar in having
(1) Hemicellulosic cell wall (1) a(ii), b(iv), c(iii), d(i) (2) a(ii), b(iii), c(iv), d(i)
(2) Peptidoglycan in cell wall (3) a(iv), b(iii), c(i), d(ii) (4) a(iii), b(iv), c(ii), d(i)
(3) Gametangial contact 302. Which of these is not related to organisms which
are characterised by absorptive mode of nutrition
(4) Aseptate and coenocytic mycelium and have loose tissue organisation?
296. Select the correct option w.r.t. Aspergillus (1) Extracellular digestion of food
(1) It is called weed of laboratory and produce (2) Formation of fruit body in some organisms
conidiospores
(3) Karyogamy always immediately after
(2) It is also called bread mould forming trisporic plasmogamy
acid during sexual reproduction
(4) Absence of NAM in cell wall
(3) It is a member of club fungi used to produce
303. Identify the following diagram and choose correct
antibiotics
option
(4) The asci are arranged in fruiting bodies called
basidiocarp
297. Archaebacteria can survive in extreme climatic
conditions due to
(1) Cell wall structure
(2) Presence of peptidoglycan in cell wall
(3) D - Amino acids in cell wall (1) Basidiospores are formed in subhymenium
(4) Presence of introns in DNA (2) Plasmogamy occurs through somatogamy

(3) Haplophase is predominant in life cycle
298. Select the odd one out w.r.t. chrysophytes
(4) Rhizoids are present
(1) Includes diatoms and golden algae
304. Nutritionally, majority of the bacteria are
(2) They are microscopic planktons
(1) Photoautotrophs (2) Chemoautotrophs
(3) Most of them are photosynthetic or predators
(3) Heterotrophs (4) Photoorganotrophs
(4) They are fresh water as well as marine
305. Select the correct match (column-I with column-II)
299. Sexual spores in fungi are Column - I Column - II
(1) Ascospores and conidia a. Indestructible cell wall (i) Physarum
(2) Oospores and zoospores b. Red tide (ii) Euglenoids
(3) Ascospores and oospores c. Pellicle (iii) Gonyaulax
(4) Basidiospores and sporangiospores d. Plasmodium (iv) Chrysophytes
300. Which of these eubacteria is not a (1) a(iv), b(iii), c(ii), d(i)
chemoautotroph? (2) a(i), b(iii), c(iv), d(ii)
(1) Chlorobium (2) Nitrosomonas (3) a(iii), b(iv), c(ii), d(i)
(3) Ferrobacillus (4) Thiobacillus (4) a(ii), b(iii), c(iv), d(i)
306. Chitinous cell wall and endogenously formed 313. Match the column I with column II
sexual spore are common features of Column I Column II
(1) Albugo and Rhizopus (Shapes) (Bacteria)
(2) Aspergillus and Penicillium a. Spherical (i) Bacilli
(3) Claviceps and Colletotrichum b. Rod (ii) Spirillum
(4) Phytophthora and Neurospora c. Comma (iii) Cocci
307. Non-cellular organisms as nucleio-protein d. Spiral (iv) Vibrio
structure do not cause
(1) a(iii), b(i), c(iv), d(ii)
(1) Mumps and small pox
(2) a(i), b(iii), c(iv), d(ii)
(2) Herpes and influenza
(3) a(iv), b(i), c(iii), d(ii)
(3) Dwarfing, stunted growth and mosaic disease
(4) a(ii), b(iii), c(iv), d(i)
(4) Cholera, typhoid and tetanus
314. Which of the following is example of pleomorphic
308. Chrysophytes are characterised by all, except bacteria?
(1) Indestructible cell wall (1) Diplococcus pneumoniae
(2) Reduction in the size of daughter cells in (2) Rhodomicrobium
asexual life cycle
(3) Caulobacter
(3) Diplontic life cycle and gametic meiosis
(4) Rhizobium leguminosarum
(4) Flagellate stage
315. The cell wall of almost all the eubacteria is made
309. Which of the following character is related with up of
kingdom fungi?
(1) Mucopeptide (2) Cellulose
(1) Presence of chemosynthetic autotrophic
nutrition (3) Chitin (4) Pseudomurein
(2) Absence of nuclear membrane 316. Select the correct statement w.r.t. Gram positive
bacteria
(3) Body organisation is multicellular/loose tissue
type (1) Cell wall is not sensitive to penicillin
(4) They prefer to grow in warm and dry places (2) These are mostly capsulated
310. Which of the following statement is incorrect? (3) Teichoic acid is present in cell wall
(1) Cyanobacteria often form blooms in polluted (4) Pili are very common
water bodies 317. The cytoplasm of bacteria appears granular due
(2) Body of slime moulds moves along decaying to the presence of
twigs and leaves engulfing inorganic material (1) 80S ribosomes (2) Chromatophores
(3) RNA of the viroid is of low molecular weight (3) 70S ribosomes (4) Genophore
(4) Lichens do not grow in polluted areas 318. __________ respire anaerobically only and the
311. In which group of fungi, the fusion of two haploid growth of this bacteria will certainly be slower as
cells immediately results in the formation of diploid compare to aerobic bacteria.
cells? (1) Bacillus subtilis
(1) Phycomycetes (2) Chlorobium
(2) Ascomycetes (3) Pseudomonas
(3) Basidiomycetes
(4) Clostridium
(4) Fungi imperfecti and algal fungi
319. Which of the following bacteria use H 2 S as
312. Select the incorrect statement w.r.t. bacteria electron and H+ donor during photosynthesis?
(1) They are the most abundant microorganisms (1) Purple sulphur bacteria
(2) Very simple in structure
(2) Green sulphur bacteria
(3) They as a group show the most extensive
(3) Purple non-sulphur bacteria
metabolic diversity
(4) They are very simple in behaviour (4) Green non-sulphur bacteria
320. Generation time of a bacteria is 20 minutes. 326. Select the correct statement w.r.t. Halophiles
If initially there were 50 cells in the culture (1) They are capable of tolerating high acidity
medium, then what will be the number of cells
(2) They are obligate anaerobes occurring in high
after 2 hours?
salt concentration medium
(1) 2400 (2) 3200 (3) They oxidise sulphuric acid to sulphur under
(3) 3000 (4) 2560 aerobic conditions
321. Anticoagulant Ca-DPA is present in (4) In high light intensity, a reddish pigment
bacteriorhodopsin develop in their membrane
(1) Exosporium of endospore to trap sunlight to produce ATP
(2) Cell wall of Gram negative bacteria 327. The organisms which completely lack a cell wall
and can survive without oxygen are
(3) Cortex of endospore
(1) Mycoplasma (2) Diatoms
(4) Cell membrane of Gram positive bacteria
(3) Cyanobacteria (4) Dinoflagellates
322. Select the correct statement w.r.t. extra
328. Which of the following feature is not concerned
chromosomal DNA of bacteria with chrysophytes?
(1) It is always found as the part of nucleoid (1) They are microscopic and float passively in
water currents
(2) It is always longer than nucleoid DNA
(2) The walls are embedded with pectin and thus
(3) It may provide resistance for antibiotics walls are indestructible
(4) Its genes have vital role in viability and growth (3) They form diatomaceous earth
of bacteria (4) Diatoms are the chief producers in the
323. Genetic recombination in bacteria in which oceans
transfer of genetic material from one bacterium to 329. Dinoflagellates are characterised by all, except
another bacterium occurs with the help of (1) The cell wall has stiff cellulose plates on the
surrounding medium, is known as outer surface
(1) Transduction (2) The cell walls form two thin overlapping
shells, which fit together as in a soap box
(2) Binary fission
(3) Most of them has one longitudinal and other
(3) Transformation transverse flagellum
(4) Conjugation (4) Photosynthetic pigments are chlorophyll a, c
and -carotenes
324. Bacterial blight of rice is caused by
330. Select the incorrect statement w.r.t. Euglenoids
(1) Xanthomonas oryzae (1) They are photosynthetic in sunlight and
(2) Xanthomonas citri behave like heterotrophs in absence of light
(2) The pigments are identical to those present in
(3) Clostridium botulinum
higher plants
(4) Agrobacterium tumefaciens (3) They have protein rich cell wall made up of
325. Which of the following feature of archaebacteria is pellicle
responsible for their survival in extreme (4) The reserve food material is in the form of
conditions? paramylon
(1) Presence of exons in DNA 331. In the life cycle of acellular slime moulds
(1) Spores are walled
(2) Presence of histone proteins and circular
RNA (2) Somatic stage is haploid plasmodium
(3) Spores are dispersed by biotic agents
(3) Presence of 70S ribosomes
(4) Macrocyst represents site of karyogamy and
(4) Different cell wall structure from other bacteria meiosis
332. White spots seen on mustard leaves are due to 338. Which of the following statement is correct for
a parasitic fungus known as deuteromycetes?
(1) Puccinia graminis (1) A large number of them are decomposers of
(2) Phytophthora infestans litter, but do not help in mineral cycling
(3) Albugo candida (2) Mycelium is septate and branched
(4) Mucor mucedo (3) They may have three names, one for
333. In fungi, asexual reproduction takes place by vegetative stage and two for asexual stage
(1) Fission, conidia and ascospores (4) Common asexual spore is oidia
(2) Conidia, hypnospores and zoospores 339. Select odd one w.r.t. Basidiomycetes
(3) Conidia, sporangiospores and zoospores (1) Mushroom (2) Smut
(4) Sporangiospores, conidia and basidiospores
(3) Rust (4) Morels
334. Select the incorrect statement w.r.t. fungi
340. Which of the following fungus is used extensively
(1) Mycelium is consist of long slender thread like in biochemical and genetic work?
structures called hyphae
(1) Aspergillus
(2) Aseptate and multinucleate hyphae is called
coenocytic hyphae (2) Colletotrichum
(3) Dolipore septum is characteristic of class (3) Neurospora
ascomycetes
(4) Claviceps
(4) The cell wall is composed of chitin and
polysaccharides 341. Lichens do not grow in polluted areas and are
335. Which of the following is not form the basis of very good pollution indicator of
classification in fungi? (1) Radioactive pollution
(1) Morphology of mycelium (2) Sewage pollution
(2) Mode of spore formation
(3) SO2 pollution
(3) Mode of nutrition
(4) Soil pollution
(4) Fruiting bodies
342. Mycobiont component of lichen provides
336. Members of Ascomycetes
(1) Water and food materials to phycobiont
(1) Are found in aquatic habitats and on decaying
wood or as obligate parasites on plant (2) Organic food to its partner
(2) Asexually reproduce by zoospores (3) Shelter to algal partner
(3) Sexual reproduction takes place by
planogametic copulation only
343. Choose the correct option for the given below
(4) Represent dikaryophase which is a short
phase of life cycle figures.
337. Select correct match w.r.t. column I and column II

Column I Column II
a. Albugo (i) Basidiomycetes
b. Penicillium (ii) Deuteromycetes
c. Ustilago (iii) Ascomycetes
d. Trichoderma (iv) Oomycetes
(1) Peritrichous bacteria
(1) a(iii), b(ii), c(iv), d(i)
(2) a(iv), b(iii), c(ii), d(i) (2) They do not contain both RNA and DNA
(3) a(iii), b(i), c(iv), d(ii) (3) Presence of non-cellulosic cell wall
(4) a(iv), b(iii), c(i), d(ii) (4) Presence of cyclosis
344. Consider the following statements and select the 351. Photosynthetic protists with indestructible cell wall
correct set of option (w.r.t. bacteria) are
a. They have simple structure and behaviour (1) Pyrophytes (2) Chrysophytes
b. They are simple in structure with complex (3) Euglenophytes (4) Myxomycetes
behaviour
352. Which one of the following pairs is wrongly
c. DNA is circular, single stranded and packaged matched while the remaining three are correct?
with acidic protein into nucleoid
(1) Frankia – Root nodules in
d. ETS enzymes are associated with plasma Alnus
membrane
(2) Soredia – Lichen
e. Characteristic amino acid in cell wall of Gram
positive bacteria is DAPA (3) Proteinaceous – Rinderpest disease
infectious particles
(1) b & d (2) a, c & e
(4) Neurospora – Drosophila of plant
(3) c, d & e (4) a & d
kingdom
345. Slime layer of cell envelope in bacteria is made of
353. Auxospore is found in diatoms as
(1) Peptidoglycan (2) LPS
(3) Murein (4) Polysaccharides (1) Resting haploid sexual spore
346. In motile bacteria, flagellum shows (2) Resting asexual spore
(1) 9 + 0 arrangement of microtubules (3) Diploid sexual spore
(2) Eleven stranded structure of tubulin protein (4) Perennating thick walled haploid spore
(3) Single stranded structure of flagellin protein
354. Euglena resembles with higher plants in
(4) 9 + 2 arrangement of microtubules
(1) Mode of sexual reproduction
347. Nutritionally which group of bacteria are involved
in the recycling of most of the minerals? (2) Reserve food material
(1) Photolithotrophs (2) Photoorganotrophs (3) Types of chlorophyll
(3) Chemolithotrophs (4) Chemoheterotrophs
(4) Nutrition
348. Which one of the following option gives the
correct matching of disease with its causative 355. Select the incorrect statement w.r.t. slime moulds
organism? (1) Plasmodium differentiates into spores
(1) Tetanus - Heliobacter pylori producing structure in favourable condition
(2) Red rot of sugarcane - Pseudomonas (2) Motile stage is present in the life cycle of
rubrilineans acellular slime moulds
(3) Citrus canker - Xanthomonas
(3) Spores have true cellulosic wall
campestris
(4) PSTD - Viroid (4) Pseudoplasmodium stage is chemotactically
formed in cellular slime moulds
349. Select the incorrect statement for archaebacteria
(1) They lack D-amino acid in their cell wall 356. Fungi prefer to grow in
(2) They are similar to eubacteria in having (1) Cool and humid conditions
peptidoglycan in cell wall
(2) Warm and humid places
(3) Their ribosomal proteins are highly acidic
(3) Cool and dry places
(4) Methanogens assist in fermentation of
cellulose (4) Dry and organic rich soil
350. Consumer-decomposer protists and red-tide 357. Causal organism of white rust on crucifers shows
causing protists respectively are
(1) Branched and septate primary mycelium
(1) Diatoms and Euglena
(2) Plasmogamy by gametangial contact
(2) Slime moulds and Dinoflagellates
(3) Slime moulds and Diatoms (3) Chitinous cell wall
(4) Dinoflagellates and Euglena (4) Sexual spore as zygophore
358. Asexual spores formed exogenously during 365. Structures produced in the life cycle of slime
favourable conditions, is a feature of moulds which possess true walls are
(1) Egg fungi (2) Sac fungi (1) Plasmodium (2) Spores
(3) Conjugation fungi (4) Club fungi (3) Gametes (4) Myxamoebae
359. Edible fruiting body stage is present in the sexual 366. The given events in sexual life cycle is correct for
life cycle of
which group of fungi?
(1) Penicillium and Ustilago
& ! sex organs Plasmogamy
(2) Aspergillus and Amanita
Dikaryophase (n + n) Karyogamy Meiosis
(3) Morchella and Agaricus Sexual spore
(4) Puccinia and Aspergillus
(1) Agaricus, puffball, Bracket fungi
360. Most of the members of deuteromycetes are
(2) Rust fungi, smut fungi, bread mould
actually related to
(1) Basidiomycetes (2) Ascomycetes (3) Morels, Truffles, Penicillium
(3) Oomycetes (4) Zygomycetes (4) Puccinia, Aspergillus, Agaricus
361. Select the incorrect statement 367. Which of the following bacteria are most abundant
in nature?
(1) Fungal partner is commonly basidiomycetes
(1) Photosynthetic autotrophic bacteria
in ectomycorrhiza
(2) Chemosynthetic autotrophic bacteria
(2) Orchids seldom occur without mycorrhiza
(3) Heterotrophic bacteria
(3) In ectomycorrhiza fungal hyphae do not occur
in the intercellular spaces of root cortex (4) Parasitic bacteria
(4) Fungal roots lack root cap and root hairs SECTION - B
362. The mycobionts of lichen thallus do not show Assertion - Reason Type Questions
which one of the functions?
(1) Formation of sex organs (A) is followed by a statement of reason (R)
(2) Fruitification (1) If both Assertion & Reason are true and the
(3) Body structure and covering
assertion, then mark (1)
(4) Nitrogen fixation (2) If both Assertion & Reason are true but the
363. Choose the correct option w.r.t. fungi forming reason is not the correct explanation of the
fruiting bodies in which reduction division occurs assertion, then mark (2)
leading to formation of haploid spores. (3) If Assertion is true statement but Reason is
(1) Albugo, Penicillium false, then mark (3)
(2) Saccharomyces, Puccinia
statements, then mark (4)
(3) Agaricus, Mucor 1. A : Nucleoprotein entity which is able to utilize the
(4) Agaricus, Morchella synthetic machinery of a living organism is
obligate parasite.
364. Sole members of the Kingdom Monera
R : It is inert outside the host cell.
(1) Are very simple in behaviour and metabolic
2. A : Viroids are the smallest self replicating
diversity
particles.
(2) Have been grouped under two categories
R : They are infectious ss-RNA particles.
based on their shape
3. A : Loose smut of barley is caused by Ustilago
(3) Occur almost everywhere and characterised hordei.
by a rigid cell wall
R : Infecting spores called chlamydospores are
(4) Have loose tissue type of body organisation exposed while attached to the host.
4. A : Oxyphotobacteria performs photosynthesis by 16. A : Plasmid and bacterial chromosome are
involvement of single pigment system. similar in their double stranded circular nature.
R : PS I is located in vegetative cells only. R : Plasmid is an extra chromosomal circular
DNA found in all organisms.
5. A : Halophiles show ability to convert light energy
into chemical energy by developing 17. A : Endospores can remain unharmed even after
characteristic orange red pigment in cell wall. pasteurisation.
R : They are nutritionally chemoautotrophs. R : Endospores can withstand temperature as

high as 100°C.
6. A : Yeasts are degenerative ascomycetes of
mycota. 18. A : Stigma or eye spot performs photoreceptive
function in Euglena.
R : In these members, asci are naked without
R : It contains a red orange pigment called
ascocarp.
astaxanthin.
7. A : Heterocysts are thick walled nitrogen fixing
19. A : Mycelium is septate and coenocytic in
structures in BGA.
members of oomycetes.
R : These have chlorophyll ‘a’ and thylakoids.
R : Mycelial cells show karyokinesis without
8. A : Five kingdom system is a phylogenetic system. failure of septa formation.
R : Monerans are common ancestor of all 20. A : Bacteriophages are usually double stranded
kingdoms and includes nutritionally one type DNA viruses.
of organisms.
R : They show lytic cycle of reproduction.
9. A : Woese found that the six kingdoms naturally
21. A : Fungi are widespread in distribution.
cluster into three main domains.
R : They have evolved various nutrition methods
R : Progenote is believed to be originated from from autotrophic to heterotrophic.
these domains.
22. A : Methanogens are chemolithotrophs.
10. A : Halophiles are able to trap sunlight for ATP
synthesis. R : They lack NAM and D-amino acids in cell
wall.
R : They develop purple pigment in cell wall to
23. A : Association of mycobiont and phycobiont is
perform cyclic photophosphorylation.
sometimes considered as controlled
11. A : Primordial utricle condition does not exist in parasitism.
diatoms.
R : Fungi performs all required activities of life
R : Sap vacuole is absent. except photosynthesis.
12. A : Sex organs are differentiated in edible 24. A : Viruses are obligate intracellular parasites.
mushroom.
R : Viruses are inert outside host cell.
R : Basidiocarps are formed in favourable
25. A : Some fungi may have different names for
conditions when hyphae of primary mycelium
asexual and sexual stages.
collect at places to produce buttons.
R : Sexual reproduction is not known to occur in
13. A : VAM are endotrophic mycorrhiza.
members of class deuteromycetes.
R : They help in phosphate absorption from soil.
26. A : Slime moulds are also called as imperfect
14. A : AIDS virus are enveloped ribovirus. fungi.
R : They have envelope and two copies of R : These are spore producing protistans without
ssRNA. cell wall.
15. A : Soredia are most efficient means of asexual 27. A : Mycoplasma are smallest living cells known
reproduction in lichens. and can survive without O2.
R : These are composed of central fungal cells, R : Mycoplasma can be pathogenic in both
surrounded by algal cells. animals and plants.
28. A : Protista forms a link with monera. 33. A : Albugo is parasitic fungi on mustard.
R : They shares some common features. R : It belongs to phycomycetes.
29. A : Both diatoms and desmids constitute the
division Chrysophyta. 34. A : Gaidukov’s phenomenon is also called
complementary chromatic adaptation.
R : These groups have common photosynthetic
pigments i.e., Chlorophyll ‘a’ and ‘b’. R : It is shown by BGA.
30. A : Members of Cyanophyceae are strictly 35. A : Vast majority of bacteria are heterotrophs.
unicelled, as considered in five kingdom
system. R : They depend on dead inorganic matter for
R : Monera includes unicelled prokaryotes. food.
31. A : Deuteromycetes is called artificial class of 36. A : Dinoflagellates are mostly photosynthetic.
fungi.
R : Noctiluca is coloured unicellular eukaryote.
R : Members of this class have septate mycelium.
32. A : Lichens are very good pollution indicators. 37. A : Mycoplasma are obligate aerobes.
R : Because they grow in polluted areas which R : They are smallest living cells and cannot
are rich in SO2. survive without oxygen.
!" !" !
Chapter 2
Reproduction in Organisms and
Sexual Reproduction in Plants
SECTION - A
Objective Type Questions 4. In the life span of which group of plants, vegetative,
reproductive and senescent phases are clearly
1. Select the correct statement w.r.t. gemmae
distinct?
a. These are specialised reproductive structures in
members of thallophytes and bryophytes (1) Annual plants
b. These are green, unicellular & asexual buds (2) Biennial plants
c. These are formed in small receptacles located (3) Perennial plants

on thalli (4) More than one option is correct
d. Single gemma forms two new individuals after
5. Select the correct statement w.r.t. phases in
germination
organism’s life
e. These are chlorophyllous and multicellular
(1) Most of the perennial plants are monocarpic
structures
(2) Neelakuranji is perennial, polycarpic plant, native
f. They germinate and make monoecious thallus
to North India
of Marchantia
(1) a, d, e and f (2) b, c, d and f (3) Very few perennial plants bear flowers
throughout the year
(3) c, d and e (4) b, c and f
(4) External fertilization is present in all aquatic
2. Which one of the following is incorrect statement
algae and bryophytes
with respect to life span of organisms?
6. Zoospores differ from zygospores in
(1) Peepal tree has a much longer life span as
compared to a mango tree (1) Presence of thick wall
(2) Life spans of organisms are not necessarily (2) Absence of thick wall and motility
correlated with their size
(3) Ploidy and flagellation
(3) Single celled organism like Amoeba does not
(4) Dispersal and absence of flagella
show natural death
(4) It is correlated with the complexity and habit of 7. What is correct w.r.t. chromosomes number in the
plants sexual reproduction of Ophioglossum?
3. An aquatic plant which is commonly known as (1) Embryo = 1260, Endosperm = 1890, Oosphere =
“Terror of Bengal”, can propagate vegetatively by 630
and it is also called (2) Sporocyte = 1260, VCC = 630, Oosphere = 630
(1) Offsets, Water hyacinth (3) Oospore = 1260, Oosphere = 1260, Leaf cells =
(2) Offsets, Water lettuce 1260
(3) Turions, Water lily (4) Gametes = 630, NCC = 1260, Gametangium =
(4) Bulbils, Potamogeton 1260
144 Reproduction in Organisms and Sexual Reproduction in Plants Last Leap for NEET (Part-I)
8. Endothecium layer of anther wall is also called as 15. Select one of the following group of plants having
fibrous layer due to the presence of common or similar pollinating agent
(1) -cellulosic thickening on inner tangential wall (1) Santalum, Amorphophallus, Ficus, Bauhinia
(2) Non-hygroscopic thickening on outer tangential (2) Yucca, Ricinus, Cannabis, Zostera
wall (3) Coconut, Bamboo, Potamogeton, Myriophyllum,
(3) -cellulose thickening on outer tangential wall Sugarcane
(4) Ligno-suberin on inner tangential and radial wall (4) Anthocephallus, Kigelia, Lemna, Callistemon
9. Most abundant/common type of pollen tetrad is 16. Find out the ploidy of oospore, coleoptile and
and it is formed due to aleurone layer cells developed from the hexaploid
cytokinesis. female and diploid male parents
(1) Tetrahedral, successive (1) 4n, 3n, 3n respectively
(2) Tetrahedral, simultaneous (2) 4n, 4n, 8n respectively
(3) Isobilateral, successive
(3) 3n, 3n, 4n respectively
(4) Isobilateral, simultaneous
(4) 4n, 4n, 7n respectively
10. Double fertilization is different from single fertilization
because of the presence of 17. When the ovule is curved more or less at right
(1) Syngamy angle to funicle and mycropylar end is bend down
slightly the type of ovule is
(2) Seed
(1) Anatropous (2) Campylotropous
(3) Triple fusion
(4) Megaspore and microspore (3) Hemianatropous (4) Circinotropous
11. Allergic pollen grains belong to a group of plant 18. What is incorrect for pollination of the Ophrys?
species which are mostly (1) Pollination is done by Colpa wasp
(1) Entomophilous
(2) It is called pseudocopulation mechanism
(2) Anemophilous
(3) Female wasp lays eggs inside the ovary of
(3) Ornithophilous flower
(4) Hydrophilous
(4) The orchid employs sexual deceit to get
12. The most important pollen characteristics used as pollinated
taxonomic tool in classification is
19. What is not true for the plant given below?
(1) Chemical nature of exine and intine
(2) Shape and size of pollen grain
(3) Ridges, tubercles, spines etc. on the surface
of pollen grains provided by tectum
(4) Sculpturing over the surface of pollen grains
provided by endexine
13. What is true for pollen tube of flowering plants?
(1) It is glandular with secretory function only
(2) Growth occurs by tip activity containing dense
active cytoplasm
(3) Vesicles are absent in its apical cap block (1) It is monoecious
zone
(2) It is protogynous
(4) Its wall is made of sporopollenin and pectin
(3) It performs oogamy
14. Co-operative cells have
(1) Filiform apparatus at the micropylar tip (4) It is a green alga
(2) Filiform apparatus in the entire wall 20. Find odd one out w.r.t. internal fertilisation
(3) Micropylar vacuole and central nucleus (1) Anthoceros (2) Ephedra
(4) Non-vacuolated cytoplasm without cell wall (3) Ulothrix (4) Polygonum
Last Leap for NEET (Part-I) Reproduction in Organisms and Sexual Reproduction in Plants 145
21. Functional megaspore develops into Polygonum 28. Number of chromosomes present in meiocyte of
type of female gametophyte by potato and apple are
(1) One meiotic and two successive mitotic (1) 16, 24 respectively (2) 48, 34 respectively
divisions
(3) 16, 20 respectively (4) 24, 48 respectively
(2) Three successive mitotic divisions
29. In the polycarpic perennial plants which of the
(3) One meiotic and one mitotic divisions following phase is present additionally as compared
(4) Two meiotic and one mitotic divisions to monocarpic perennial ones in the life cycle?
22. Juvenile phase or vegetative phase is related with (1) Senescent phase (2) Reproductive phase
all, except (3) Vegetative phase (4) Interflowering phase
(1) It is pre-reproductive phase in the life cycle of 30. Seeds offer which of the following advantages to
an individual angiosperms?
(2) It is the period of growth (1) Shows better dispersal strategies
(3) It is of different durations in different organisms (2) Dormancy of seed allow it to be utilised as food
(4) It involves appearance of flowers in higher source throughout the year
plants (3) Forms the basis of agriculture
23. Zoospore is (4) Asexual seed development allows hybrid seed
(1) Formed by fusion of two gametes to maintain their superior characters
(2) Flagellated and motile structure 31. Select odd one out w.r.t. organ of vegetative
propagation
(3) The net result of sexual reproduction
(1) Adiantum (2) Bryophyllum
(4) Always diploid
(3) Narcissus (4) Begonia
24. Pollen grain in angiosperms
32. Which of the given is not related to wind
(1) Is derived from a megaspore
pollination?
(2) Remains permanently embedded in the
(1) Flowers are nectarless, odourless and
nucellus
colourless
(3) Is generally shed in 2-celled stage
(2) Versatile stamens in grasses
(4) Is 7-celled and 8 nucleated structure
(3) Dry, unbranched short stigma
25. In anemophilous flowers
(4) Winged pollens in Pinus
(1) Stigmas are usually unbranched and sticky
33. Find the ploidy level of central cell at maturity,
(2) Stigmas are exerted perisperm cell and endosperm cell for sunflower
(3) Pollen grains are heavier and sticky (1) 2n, 2n, 3n (2) n, 2n, 3n
(4) Odour is commonly present (3) 2n, 3n, 3n (4) n, n, 3n
26. Coleorhiza is 34. Ovule as well as embryo sac is curved like horse
(1) Part of embryonal axis in between cotyledonary shoe in
node and radicle (1) Lemna
(2) Part of embryonal axis in between cotyledonary (2) Alisma
node and plumule
(3) Ranunculus
(3) Covering around plumule
(4) Covering around radicle
35. Ploidy of endosperm and zygote would be
27. The micropylar end of Polygonum type of and respectively, if a
embryosac has the following structural cells, octaploid female and tetraploid male plants are
except crossed.
(1) Definitive nucleus (2) Synergid (1) 10n, 6n (2) 6n, 10n
(3) Egg cell (4) Oosphere (3) 3n, 2n (4) 20n, 8n
36. Find the correct match (w.r.t. vegetative 41. What is correct statement for the pollination in
propagation) Zostera plant?
(1) Narcissus – Tuber (1) Pollinated by fresh water
(2) Tamarindus indica – Root (2) Pollen grains are long and ribbon like
cutting (3) Pollen grains are released on to the surface of
(3) Adiantum caudatum – Corm marine water
(4) Female flowers reach the surface of water by
(4) Chrysanthemum cinerarifolium – Rhizome
the long and coiled stalk
37. Find out the correct order (w.r.t. development of
42. At the time of asexual reproduction
male gametophyte)
(1) Most of the divisions are meiotic
(2) Haploid-diploid alternation does not occur
(3) Rate of multiplication is very slow
A. B.
(4) Adaptability and evolutionary advanced
characters are produced
43. During the development of embryo sac, the
coenomegaspore is not produced in
(1) Adoxa (2) Plumbago
C. D. (3) Polygonum (4) Panaea
44. What is the most common shape and size of
pollen grain in angiospermic plants?
(1) D A C B (2) D B A C (1) Spindle shaped, 25-50 m
(3) D C B A (4) A B C D (2) Spherical, 2-5 m
38. In a transverse section, a typical microsporangium (3) Spherical, 25-50 m
of flowering plants is generally surrounded by four (4) Spindle shaped, 2-5 m
wall layers – the epidermis, endothecium, middle
layers and the tapetum. Cells of the tapetum 45. In flowering plants, endosperm
(1) Possess dense cytoplasm and generally have (1) Is pre-fertilizing tissue
more than one nucleus (2) Development rarely involves free nuclear
(2) Nourish the developing microspores as well as divisions
megaspores
(3) Development precedes embryo development
(3) Help in dehiscence of anther
(4) Is triploid tissue always
(4) Perform the function of protection
46. Hydrophilous flowers are similar to anemophilous
39. Egg apparatus consists of flowers in
(1) Central cell + egg cell (1) Presence of nectar
(2) Synergids + polar nuclei + egg cell (2) Absence of odour
(3) Synergids + oosphere (3) Presence of bright colour
(4) Antipodal cells + synergids + egg
(4) Absence of versatile anther
40. A typical angiospermic anther
47. All of the following statements are concerned with
(1) Is monothecous and bisporangiate gemmae, except
(2) Shows the two pollen sacs in an anther lobe (1) Small and green structure
which are separated internally by strip of fertile
tissue (2) Undifferentiated structure and each giving two
(3) Dithecous and tetrasporangiate daughter plants
(4) Is a mass of homogeneous meristematic cells (3) Absent in Funaria

in mature stage (4) Multicellular structure
48. The outer layer of pollen grain in non-archegoniate 54. Select incorrect statement w.r.t. ovule
spermatophytes is made up of sporopollenin. This
(1) Funiculus contains xylem and phloem
chemical
(2) Main body of ovule is parenchymatous
(1) Is one of the most resistant inorganic material
(3) Nucellus is well developed in tenuinucellate
(2) Is temperature and enzyme resistant type
(3) Is resistant for strong acids, not for alkali (4) It is integumented and indehiscent megaspo-
(4) Is resistant for strong alkali, not for acids rangium
49. Water hyacinth is also known as ‘terror of Bengal’ 55. Mark the incorrect match
because it (1) Bitegmic – Solanaceae
(1) Releases saxitoxin (2) Ategmic – Loranthaceae
(2) Drains O2 from the running water (3) Unitegmic – Asteraceae
(3) Leads to death of fishes (4) Tritegmic – Inga dulce

56. Vegetative cell of angiospermic pollen grain is
(4) Is one of the most invasive crop
characterised by
50. What is the possible advantage if hybrids are made
(1) Less amount of food reserve and large size
into apomicts?
(2) Small size and spindle shaped nucleus
(1) Segregation of characters in the hybrid progeny
(3) Haploid ploidy level and less amount of food
(2) Farmers can keep on using the hybrid seeds reserve
to raise new crop in first year only
(4) Abundant food reserve and irregularly shaped
(3) Absence of segregation in the hybrid progeny nucleus
(4) More than one option is correct 57. Find out the ploidy level of structures (a), (b), (c),
51. Mark the incorrect one (d) and (e) in the given diagram
!"#$%&'()
(1) Pollen consumption has been claimed to
increase the performance of athletes and race *$+",#-&'.)
horses
(2) Viability of pollen grain depends upon
temperature, not humidity /++-0&"+1-2$%-+1&',)
(3) Pollen grains of a large number of species can 3$,-##$4&'5)

be stored in liquid nitrogen for years
6%.078&4(,&'-)
(4) Pollen grains of rice and wheat lose viability
within the half an hour
52. The effect of foreign pollen on somatic tissue lying
outside the endosperm
(1) Is known as xenia (1) Diploid = (a), (b), (c), (d) ; haploid = (e)
(2) Has been reported in date-palm (2) Haploid = (a), (b), (c) ; diploid = (d) ;
(3) Has been reported in maize triploid = (e)
(4) Was at first reported by Focke (3) Haploid = (a), (b), (c), (d) ; triploid = (e)
53. The inner wall of the pollen grain in non-
(4) Haploid = (a), (b); diploid = (c), (d); triploid = (e)
archegoniate embryophytes
(1) Has prominent apertures 58. Development of male gametes before pollination is
present in approximately ________ of angiospermic
(2) Exhibits a fascinating array of patterns and
designs plants
(3) Is pectocellulosic continuous layer (1) 60% (2) 80%

(4) Is thin and discontinuous layer (3) 10% (4) 40%
59. Plant having non-motile male as well as female 65. Which of the plant group shows internal fertilization
gamete is by the help of non-motile male gametes?
(1) Polygonum and Polytrichum (1) Moss
(2) Capsella and Cyathaea (2) Liverworts
(3) Funaria and Fucus (3) Conifers
(4) Polygonum and Capsella (4) Ferns
60. Which of the following tissue directs the growth of 66. Type of ovule showing the funiculus becomes coiled
pollen tube? over it, is
(1) Filiform apparatus (1) Hemianatropous
(2) X-bodies (2) Campylotropous
(3) Obturator (3) Amphitropous
(4) More than one option is correct (4) Circinotropous
61. During the development of most common type of 67. What is the incorrect statement for synergids?
endosperm in flowering plants
(1) Special thickening is absent at chalazal tip
(1) PEN divides meiotically without wall formation
(2) Acellular structure
(2) Each karyokinesis is followed by wall formation
(3) Have important role in guiding the pollen tubes
(3) Wall formation begins after achieving a
multinucleate condition (4) Have filiform apparatus
(4) PEN divides mitotically and results into haploid 68. Process involving transfer of pollen grains from the
nuclei anther to the stigma of another flower of the same
plant is
62. The pollenkitt is a layer found on outside of mature
pollen grains of many insect pollinated species. (1) Genetically as well as functionally self
This pollenkitt pollination
(1) Is a sticky layer but not oily (2) Functionally cross-pollination and genetically
self-pollination
(2) Is not contributed by tapetal cytoplasm
(3) Functionally as well as genetically cross
(3) Is a non-sticky and oily layer
pollination
(4) Protects the pollen grain from harmful
(4) Genetically cross-pollination and functionally
radiations
self pollination
63. During the development of typical embryo sac from
69. Which of the following statement is correct for
the functional megaspore
angiospermic endosperms?
(1) Free nuclear division takes place
(1) Cannot be diploid
(2) Cytokinesis is present after each karyokinesis
(2) Always triploid
(3) Nuclear divisions are followed immediately by
(3) Nutritive tissue always
cell wall formation
(4) Cannot be absent
(4) Cell walls are laid down after the 4-nucleated
stage 70. Group of plants having chasmogamous as well as
cleistogamous flowers are
64. In a typical dicotyledonous embryo, the cylindrical
portion below the level of cotyledons is ________ (1) Arachis, Gloriosa, Salvia
that terminates at its lower end in the ________ (2) Calotropis, Nicotiana, Ficus
(1) Epicotyl, plumule (2) Epicotyl, radicle (3) Viola, Oxalis, Commelina
(3) Hypocotyl, radicle (4) Hypocotyl, plumule (4) Vallisneria, Mirabilis, Magnolia
71. Pollination by water is 78. Lower end of the embryonal axis in maize has the
radicle and root cap enclosed in
(1) Limited to about 30 families of dicots
(2) Very common in flowering plants (1) An extension of scutellum
(3) More common in monocots than dicots (2) A structure called coleoptile
(4) More common abiotic method of pollination (3) A differentiated sheath
72. Asexual reproduction is the common method of (4) A structure called corralorhiza
reproduction in organisms that have a relatively
79. In Cucurbita and Casuarina, type of entry of pollen
simple organisation, like algae and fungi and that
they shift to amphimixis tube into ovule is
(1) During favourable conditions (1) Mesogamy and chalazogamy respectively

(2) Just before the onset of adverse conditions (2) Chalazogamy and mesogamy respectively
(3) To produce identical progeny
(3) Porogamy and chalazogamy respectively
(4) To produce the large number of offsprings
(4) Porogamous
73. Wind pollinated flowers often
80. Mark the incorrect statement for zoophily
(1) Have a single ovule in each ovary
(1) Lemurs, arboreal rodents and gecko lizard are
(2) Produces light and sticky pollen grains
pollinators
(3) Have sticky and inserted stigma
(2) Entomophily is not possible in small flowers
(4) Produces heavy and non-sticky pollen grains
(3) Nectar and pollen grains are the usual floral
74. The device to prevent inbreeding in hermaphrodite rewards for insects
flowers is all, except
(4) Moth and Yucca cannot complete their life
(1) Dicliny cycles without each other
(2) Protandry 81. Development of tetrahedral microspore tetrad is
(3) Presence of self-incompatibility different from isobilateral type in
(4) Homogamy (1) Presence of two karyokinesis
75. Mark the odd one (w.r.t. advantage of cross (2) Absence of cytokinesis between the
pollination) karyokinesis of meiotic I and II
(1) Increases resistance to diseases (3) Presence of cytokinesis after each meiotic
division (I and II)
(2) Good characters of a race can be diluted
(4) Absence of karyokinesis
(3) Enhances adaptability of the offspring to change
in the environment 82. Hay fever is allergic reaction to the presence of
pollens in the air. Plants commonly causing hay
(4) Introduces variations due to genetic fever are
recombination
(1) Cynodon dactylon and Prosopis chilensis
76. Protogynous flowers are present in all, except
(2) Ricinus communis and Sorghum vulgare
(1) Magnolia (2) Helianthus
(3) Pisum sativum and Mangifera indica
(3) Aristolochia (4) Ficus
77. Flowers of aquatic plants like water hyacinth and
water lily 83. Ubisch bodies are made by pro-ubisch bodies after
the coating of
(1) Are not pollinated by water
(2) Emerge above the level of water for (1) Pollenkitt
epihydrophilly (2) Pectin and cellulose
(3) Reach the surface of water for hypohydrophilly (3) Sporopollenin
(4) Have exine in their pollen grains (4) Starch and callase
84. There are several records of very old yet viable 91. Plants like ________ and ________ types, show
seeds. The oldest is that of clear cut vegetative, reproductive and senescent
phases
(1) Lupine (2) Date-palm
(3) Maize (4) Rice (1) Annual, biennial
85. Mark the incorrect statement (2) Biennial, perennial
(1) Hybrid seeds have to be produced every year (3) Perennial, annual
(2) Production of hybrid seeds is costly (4) Perennial, polycarpic
(3) If the seeds collected from hybrids are sown, 92. Mark the odd one (w.r.t. zygote)
the progeny do not maintain hybrid characters
(1) Formed in the water or inside the body of the
(4) Cultivation of hybrids has decreased organism
productivity
(2) Develops a thick wall in all organisms
86. Type a pollination present in the flowers of
(3) Vital link between the two generations
Callistemon, Strelitzia and Erythrina is
(1) Ornithophily (2) Malacophily (4) Divides by meiosis in haplontic life cycle
(3) Cheiropterophily (4) Myrmecophily 93. What will be ploidy of endosperm and zygote if the
cross is made between the octaploid male plant
87. Anther wall of Hydrilla is different from Capsella in and decaploid female plant?
(1) Absence of tapetum (1) 9 n, 14 n
(2) Presence of middle layers (2) 10 n, 8 n
(3) Absence of -cellulosic fibrous bands
(3) 14 n, 9 n
(4) Absence of siphonogamy
(4) 8 n, 5 n
88. What is similarity between the amoeboid and
94. Mark the odd one (w.r.t. ploidy level)
glandular tapetum?
(1) Testa (2) Tapetum
(1) Cells undergo breakdown and entire protoplasts
move to nourish microspores (3) Perisperm (4) Pericarp
(2) Cells remain intact throughout the microspore 95. Minimum chromosome number in gamete is
development concerned with organism
(3) Ultimately both types of tapetum degenerates (1) Onion (2) House fly
(4) Both secretory in nature (3) Garden pea (4) Fruit fly
89. All organisms have to reach a certain stage of 96. Development of a new individual from a single
growth and maturity in their life, before they can gamete without fusion with another gamete is
reproduce sexually. That period of growth called
(1) Is called juvenile phase, not vegetative phase (1) Parthenocarpy (2) Sporophytic budding
(2) Is called vegetative phase, not juvenile phase
(3) Parthenogenesis (4) Polyembryony
(3) While ends then marks the beginning of the
97. In most of the aquatic algae syngamy occurs in
reproductive phase
the external medium. In this condition
(4) Is variable in same organisms
(1) Organism shows great synchrony between the
90. Onion seed is sexes
(1) Non-endospermic seed (2) Small number of gametes are produced
(2) Small, black and wrinkled seed (3) Female gamete is not released into water
(3) With soft, thin seed coat
(4) Male gamete should develop before the female
(4) Having embryo with small cotyledon gamete
98. Male, female as well as monoecious plant all 104. Select correct statement w.r.t. ovule
categories are possible in (1) Body and embryosac are curved in
(1) Mango campylotropous ovule
(2) Litchi (2) Funiculus contains a vascular strand for the

supply of nourishment to the ovule
(3) Silene
(3) It is surrounded by two integuments in
(4) More than one option is correct Asphodelus
99. Male and female plants are not separate in case (4) The arrangement of megaspores in a tetrad is
of a commonly tetrahedral in dicots
(1) Papaya and date-palm 105. What is the ploidy of endosperm when male
gamete of a tetraploid plant fuses polar nuclei
(2) Mulberry and papaya which is formed aposporously from normal plant?
(3) Date-palm and mulberry (1) 6 n (2) 3 n
(4) Castor and maize (3) 4 n (4) 5 n
100. Strobilanthus kunthiana plant 106. Asexual reproduction in some liverworts occurs by
a green, multicellular, asexual structure formed in
(1) Flowers once in 12 years receptacle is _________which produce_________
(2) Flowers once in 12 months daughter plants.
(1) Tuber, One (2) Gammae, Two
(3) Is also called as 'Neelakuranji'
(3) Gammae, One (4) Protonema, Two
107. The callose layer around microspores tetrad is
101. Select the incorrect match formed by
Organism Life span (1) Middle layer (2) Microspore
(1) Peepal 2000-3000 years (3) Endothecium (4) Tapetum
(2) Macrozamia 10000-12000 years 108. Most of the species of Chara are
(3) Sequoia 200-300 years (1) Monoecious and protandrous

(2) Monoecious and protogynous
(4) Parrot 140 years
(3) Dioecious and protandrous
102. X-bodies are darkly stained DNA containing bodies
found in (4) Dioecious and protogynous
109. The pollen tube was first observed in Portulaca by
(1) Between the embryo sac and ovule wall
(1) G. B. Amici
(2) Both of the synergids
(2) Swingle
(3) Egg cell
(3) Focke
(4) The synergid receiving pollen tube
(4) Maheshwari and Guha
103. Endothecium helps in the rupturing of anther lobe
110. Asexual reproduction by conidia is a common
wall due to the presence of -cellulose fibrous
method in Penicillium, where conidiophores are
thickening on
branched with
(1) Outer wall only (1) Conidia arranged basipetally on rami
(2) Inner wall only (2) Conidia arranged acropetally on sterigmata
(3) Outer and radial walls only (3) Conidia arranged basipetally on metulae
(4) Inner tangential walls (4) Conidia arranged basipetally on phialides
111. How many total meiotic and mitotic divisions are 118. Ultimate branches of rami in biverticillate
required to produce a monosporic Polygonum conidiophores of Penicillium
embryo sac from megaspore mother cell?
(1) Do not bear phialides
(1) 3 divisions (2) 4 divisions
(2) Bear conidia in acropetal order
(3) 2 divisions (4) 5 divisions
(3) Form metulae
112. The point of dehiscence of stamens in plants is
(4) Are unicellular and aseptate
(1) Annulus (2) Endothecium
119. In majority of sac fungi, asexual reproduction
(3) Stomium (4) Diaphragm
occurs commonly through conidia which is
113. Bulbils are multicellular fleshy buds that take part
(1) Thick walled and always uninucleate
in vegetative propagation and
(2) Formed on erect hypha called as
(1) Germinate when separated from mother plant
sporangiophore
only
(2) Borne at the base of fleshy roots in Dioscorea (3) Produced exogenously and thin walled
(3) Can develop on floral axis also (4) Non-motile and dispersed by insects
(4) Formed only in angiospermic plants 120. Interflowering period in a perennial plant
114. Life span of an organism (1) Represents juvenile phase
(1) Does not include phase of senescence (2) Is used for building up resources for next
flowering
(2) Is not necessarily correlated with body size of
organism (3) Can be observed in both monocarpic and
(3) Is very short in unicellular organism like polycarpic plants
Amoeba (4) Can occur twice in one year in henbane
(4) Includes accidental death of organism also 121. Number of chromosomes in gametes of maize,
115. Organisms that reproduce by binary fission are apple, rice and potato are respectively
said to be immortal because (1) 10, 17, 12, 24 (2) 20, 34, 24, 48
(1) Parent continues to live as two daughter (3) 10, 12, 24, 17 (4) 16, 17, 12, 24
individuals
122. Choose the incorrect statement w.r.t. Chara
(2) Mitosis occurs without spindle formation a. Nucule and globule occur on same plant
(3) Only a part of parent body forms the usually
reproductive unit b. Shield cells make jacket of nucule
(4) Daughter individuals formed are clones of c. Nucule has five coronary cells
parent
d. Nucule matures earlier than globule
116. ‘Terror of Bengal’ was introduced in India for its
beautiful flowers and shape of leaves. It can grow (1) b, d (2) a, c
vegetatively at a phenomenal rate through (3) a, d (4) b, c
(1) Offset (2) Stolon 123. The most vital event of sexual reproduction is
(3) Sucker (4) Rhizome (1) Fusion of gametes (2) Gamete formation
117. Which of the following is a disadvantage of (3) Gamete transfer (4) Release of gametes
vegetative propagation? 124. Withering of accessory floral parts, hardening of
(1) Only method of multiplication in seedless ovules and ripening of ovary in fruits occur during
plants (1) Vegetative phase
(2) Genetic uniformity (2) Pre-fertilization events
(3) Can cause overcrowding (3) Post-fertilization events
(4) Rapid multiplication (4) Fertilization stage
125. Majority of sexually reproducing organisms form 131. Vegetative cell in a pollen grain
(1) Homogametes (1) Floats in cytoplasm of generative cell
(2) Motile female gametes (2) Is small and spindle shaped
(3) Heterogametes (3) Is larger than generative cell but lacks reserve
food
(4) Isogametes
(4) Has a large irregularly shaped nucleus
126. Development of zygote into individuals of new
generation 132. Which of the following is the common feature of
anemophilous and hydrophilous plants?
(1) Depends on type of life cycle the organism has
and the environment it is exposed to (1) Produce pollen grains coated with mucilage
(2) Is independent of environment to which the (2) Scentless flowers and abundant nectar
organism is exposed (3) Flowers are not very colourful and do not
(3) Always occurs through embryo formation produce nectar
(4) Never needs a period of rest before its (4) Non-sticky pollen grains and brightly colourful
germination flowers
127. Endosperm of castor, coconut, maize and garden 133. In Polygonum type of embryo sac, polar nuclei
pea plants are similar in (1) Are haploid
(1) Chemical nature (2) Can serve as precursor of PEN
(2) Chromosome number (3) Occur in large central cell
(3) Ploidy level (4) More than one option is correct
(4) Unicellular organisation 134. Select the incorrect statement w.r.t. Oenothera
type of embryo sac
128. Which of these plants show clear cut vegetative,
reproductive and senescent phases in life span? (1) Has monosporic development
(1) China rose, radish, wheat (2) It is four nucleated
(2) Wheat, marigold, rice (3) Derived from chalazal megaspore of tetrad
(3) Mango, neelakuranji, cabbage (4) Egg apparatus has two synergids
135. Total number of nuclei involved in pseudofertilization
(4) Orange, bamboo, guava
is/are
129. Anther wall layer meant for synthesis of
(1) 5 (2) 3
sporopollenin and incompatibility proteins is
(3) 4 (4) 1
(1) Endothecium
136. Ovule with body curved more or less at right angle
(2) Middle layers
to funicle and the micropylar end is bent down
(3) Tapetum slightly in
(4) Tapetum and middle layers (1) Campylotropous (2) Hemianatropous
130. Choose the correct options w.r.t. tapetum (3) Amphitropous (4) Circinotropous
a. Secretory tapetum do not degenerate upon 137. Match the following plants and their respective
maturity pollinators
b. Tapetum cells fuse to form a plasmodium in Column I Column II
invasive type a. Ficus (i) Beetle
c. Cells are polyploid and nutritive b. Yucca (ii) Gall insect
d. Can contribute pollenkitt in anemophilous pollen c. Ravenela (iii) Moth
grains d. Amorphophallus (iv) Lemur
(1) a, b (2) b, c (1) a(ii), b(iii), c(iv), d(i) (2) a(iii), b(ii), c(iv), d(i)
(3) c, d (4) b, d (3) a(ii), b(iv), c(i), d(iii) (4) a(iii), b(i), c(ii), d(iv)
138. Choose the incorrect statement w.r.t. hydrophily 146. Identify the labels A, B and C in the given diagram
(1) Limited to about 30 genera of angiosperms !
(2) The most of the genera belong to monocots "

(3) Pollen grains have mucilage coating
(4) Occurs in all aquatic plants
139. Endosperm with sugary and starchy parts forming #
different colour patches of yellow and white is
called (1) Tuber, Germinating eye bud, Eyes
(1) Mosaic endosperm (2) Bulb, Node, Eyes
(2) Ruminate endosperm (3) Rhizome, Node, Flower
(3) Helobial endosperm (4) Tuber, internode, Adventitious buds
(4) Cellular endosperm 147. Embryo sac that develops after 2 mitosis in
140. Endosperm development precedes embryo megaspore nuclei and is devoid of antipodals is
development because (1) Polygonum type (2) Oenothera type
(1) It is a product of triple fusion (3) Allium type (4) Adoxa type
(2) It provides nutrition to developing embryo 148. Highly vacuolated cytoplasm which is rich in
(3) It is larger than embryo reserve food is present in largest cell of embryo
sac called
(4) Its development mostly occurs by free nuclear
division in PEN (1) Central cell (2) Antipodals
141. Remnants of nucellus in the seed is known as (3) Egg (4) Synergids
perisperm, which is found in
149. Ovule that turns about 360° with a funicular
(1) Black pepper (2) Beet overgrowth is
(3) Castor (4) All of these (1) Orthotropous (2) Amphitropous
142. Viability of seeds
(3) Circinotropous (4) Hemianatropous
(1) May be lost within a few months
150. Formation of asymmetrical spindle fibres can be
(2) Is 1000 years in Lupinus arcticus observed when
(3) Recorded in Phoenix is 10000 years (1) Megaspore nuclei undergoes free nuclear
(4) Can be tested by 1% solution of TTC mitotic divisions
143. Occurrence of more than one embryo in a seed is (2) PEN undergoes free nuclear mitotic divisions
known as polyembryony which may be due to (3) Second mitosis occurs in pollen to produce
(1) Sporophytic budding two male gametes
(2) Polyspermy (4) Pollen grain undergoes first mitosis to produce

generative and vegetative cell
(3) Vegetative fertilization
151. Pollen grains lose viability within 30 minutes of their
(4) More than one option is correct release in the members of family
144. Development of diploid embryo sac directly from a (1) Rosaceae (2) Solanaceae
differentiated megaspore mother cell is called as
(3) Poaceae (4) Leguminoseae
(1) Apospory (2) Diplospory
152. Select the incorrect match w.r.t. vegetative
(3) Aplospory (4) Adventive embryony propagules
145. Ploidy level of endosperm will be _____ if cross is (1) Eyes – Potato
made between tetraploid female and diploid male
plants (2) Rhizome – Ginger
(1) 3 n (2) 5 n (3) Offset – Water hyacinth
(3) 6 n (4) 7 n (4) Bulbil – Bryophyllum
153. The arrangement of nuclei in Polygonum type of 160. All given statements about synergid are correct,
embryo sac is except
(1) 2 + 3 + 3 (2) 3 + 2 + 3 (1) Cellular thickenings at the micropylar end
(3) 2 + 4 + 2 (4) 3 + 3 + 2 (2) Intact synergid provides seat for the entry of
pollen tube
154. Which one of the following group of plants do not
show clear cut distinction of vegetative, reproductive (3) Cytoplasm is vacuolated towards chalazal end
and senescent phases?
(4) Acting as shock absorber for inward growing
(1) Annuals pollen tube
(2) Monocarpic biennials 161. Endosperm persists in the mature seeds of
(3) Perennials
(1) Pea (2) Groundnut
(3) Gram (4) Maize
155. Type of ovules which is common in gamopetalous
plants, is 162. How many meiotic divisions are required to produce
200 male gametes in a typical dicot plant?
(1) Unitegmic and tenuinucellate
(1) 50 (2) 25
(2) Unitegmic and crassinucellate
(3) Bitegmic and crassinucellate (3) 100 (4) 200
(4) Bitegmic, sessile and tenuinucellate 163. Which of the given statement is incorrect for the
following diagram?
156. Total mitotic divisions required for the development
of mature male and female gametophytes
respectively from 20 microspores and 20 ! "
megaspores in an angiosperm is
(1) 40 and 20 (2) 10 and 20
(3) 40 and 40 (4) 40 and 60
157. Most common type of endosperm in flowering
plants is
(1) Cellular type (2) Nuclear type
(3) Helobial type (4) Ruminate endosperm (1) Member of chlorophyceae
158. Common vegetative propagule, capable of giving (2) Cap of 5 coronary cells in each nucule
rise to new individuals in Agave is
(3) A – main axis; B – lateral branch
(1) Leaf bud (2) Bulbil
(4) The nucule matures prior to globule
(3) Rhizome (4) Offset
164. Functional megaspore in Polygonum divides by free
159. Read the following statements carefully and select
nuclear mitotic divisions and develops into
the correct
8 nucleated and 7 celled female gametophyte. The
a. Tapetum cells possess dense cytoplasm and largest cell of this gametophyte is
generally have more than one nucleus
(1) Antipodal cell (2) Central cell
b. Sporopollenin is absent in the areas called
germ pore (3) Synergid cell (4) Egg cell
c. Generative cell is small, spindle shaped with a 165. Transfer of pollen grains from anther of one flower
irregularly shaped nuclei to stigma of another flower of same plant is called
as
d. Spindle of first mitosis in pollen is asymmetric
(1) a, b, c & d (1) Xenogamy
(2) a, b & c (2) Autogamy

(3) a, c & d (3) Geitonogamy
(4) a, b & d (4) Cleistogamy
166. Removal of anther from ________ flower ________ 172. Find correct match w.r.t. asexual / vegetative
maturation of anther is called emasculation reproduction
(1) Unisexual, after (2) Bisexual, before Column-I Column-II
(3) Unisexual, before (4) Bisexual, after a. Terror of Bengal (i) Gootee
b. Bladder wort (ii) Offset
167. Read the following statements carefully
c. Pomegranate (iii) Turion
a. Neelakuranji flowers once in 12 years
d. Marchantia (iv) Gemmae
b. In majority of organisms, male and female
gametes are motile (1) a(ii), b(iii), c(i), d(iv) (2) a(iii), b(ii), c(i), d(iv)
(3) a(i), b(ii), c(iii), d(iv) (4) a(ii), b(iii), c(iv), d(i)
c. During embryogenesis, zygote undergoes
mitosis and cell differentiation 173. Pollen grains are the carriers of male gametes in
(1) All are correct (1) Pinus, Chara

(2) Solanum, Oryza
(2) Only (b) is incorrect
(3) Marchantia, Allium
(3) All are incorrect
(4) Ophioglossum, Fucus
(4) (a) and (b) are correct
174. Find odd one out w.r.t. pollination by biotic agents
168. In over 60 % of angiosperms, pollen grains are
(1) Sugarcane, wheat, papaya
shed at two celled stage. Generative cell of this
stage (2) Ophrys, Salvia, Aristolochia
(1) Has dense cytoplasm (3) Anthocephallus, Kigelia, Adansonia
(2) Floats in the nucleoplasm of the vegetative cell (4) Bombax, Callistemon, Erythrina
(3) Is diploid 175. Find the incorrect statements w.r.t. pollen grain in
angiospermic plants
(4) Is larger than tube cell
a. Germ pores are areas in pollen wall where
169. How many meiosis are required in megasporocyte intine and sporopollenin are absent
to produce 12 Polygonum type of embryo sacs?
b. Vegetative cell is bigger, has abundant food
(1) 3 reserve and a large irregularly shaped nucleus
(2) 6 c. Fascinating array of patterns and designs are
exhibited by exine wall
(3) 11
d. In over 60 percent of angiosperms, pollen
(4) 12 grains are shed at 3-celled stage
170. Sexual reproduction is (1) c and d (2) a and d
(1) Fast and simple process (3) b and d (4) a and c

176. Rhizomes are commonly used in vegetative
(2) Slow and simple process propagation of
(3) Fast and complex process (1) Water hyacinth (2) Bryophyllum
(4) Slow and complex process (3) Ginger (4) Agave
171. Choose the odd one out w.r.t. outer layer present 177. Eichhornia crassipes
in pollen grain (1) Multiplies rapidly wherever there is running
water
(1) Possesses most resistant inorganic material
(2) Propagates vegetatively with the help of
(2) Possesses germ pores suckers
(3) Exhibits fascinating array of patterns and (3) Was introduced in Indian waters because of its
designs beautiful root, stem and leaves
(4) It has enzyme resistant sporopollenin (4) Multiplies rapidly in stagnant water
178. Most of the aquatic and land plants are pollinated 182. Clones cannot be obtained from
by
(1) Rhizome (2) Tuber
(1) Insects or wind
(3) Sucker (4) Zygote
(2) Water and insects respectively 183. Juvenile or vegetative phase
(3) Abiotic factors only (1) Is of variable durations in different organisms
(4) Water and wind respectively (2) Is also called reproductive phase
179. The figure given below shows fertilised embryo sac (3) Is a feature of monocarpic plants only
of the flowering plants. Which one set of two parts
(4) Involves gamete production
out of (a - e) have been correctly identified?
184. How many male gametes will be produced from
!"#
6 microspore mother cells after microsporogenesis
!$# and microgametogenesis in most of the flowering
plants?
!&# (1) 48 (2) 12

!'# (3) 24 (4) 6
185. Mark the correct statement (w.r.t. reproduction)
(1) A biological process to produce new offsprings
!%# (2) Enables the continuity of the species,
generation after generation
(1) (a) – Nucleolus; (3) Incorporates genetic variations and makes

basis of evolution
(c) – Primary endosperm nucleus
(2) (e) – Degenerating antipodal cells and zygote;
186. Match column I with column II and select correct
(d) – Degenerating synergids option
(3) (b) – Zygote; Column I Column II
(a) – Central cell

a. Offset (i)
(4) (c) – Primary endosperm cell;
(e) – Degenerating synergids
180. Which one of the following statement is not true?
(1) Filiform apparatus present at chalazal end of b. Tuber (ii)
the synergids guides the entry of pollen tube
(2) Pollen – pistil interaction is a dynamic process
involving pollen recognition followed by
promotion or inhibition of the pollen
(3) Majority of insect pollinated flowers are large,
c. Rhizome (iii)
colourful, fragrant and rich in nectar
(4) Apomixis is a form of asexual reproduction that
mimics sexual reproduction
181. Members of algae commonly reproduce through
(1) Motile and endogenous spores d. Bulbil (iv)
(2) Exogenous and motile spores
(3) Diploid isogametes (1) a(i), b(iv), c(iii), d(ii) (2) a(i), b(iv), c(ii), d(iii)
(4) Zoospores and conidia (3) a(iv), b(i), c(iii), d(ii) (4) a(i), b(ii), c(iii), d(iv)
187. Consider the following statements (a-d) about 190. Which of the following group (1 – 4) comprises
“terror of Bengal”. both monocarpic and polycarpic plants?
a. An aquatic plant which can propagate (1) Wheat, Rice, Bambusa

vegetatively at a phenomenal rate (2) Mango, Apple, Jackfruit
b. One of the most invasive weeds growing in (3) Wheat, Rice, Mango, Orange
standing water
(4) Grapevine, Orange, Mango
c. It drains oxygen from water which leads to
191. In angiospermic plants, embryogenesis
death of fishes
(1) Refers to the process of development of zygote
d. It was introduced in Bengal because of its from embryo
beautiful flowers and shape of fruits
(2) Involves cell division and cell differentiation
Which of the above statements are correct?
(3) Refers to the process of development of
(1) b & d (2) a & d embryo from zygophore
(3) a & b only (4) a, b & c (4) Involves meiotic as well as mitotic divisions
188. Given below figure represents some structures of a 192. Which of the following structure represents vital link
green alga denoted as a and b. Identify these between two successive generations?
structures. (1) Spore mother cell (2) Zygote
(3) Antheridium (4) Zygophore
193. In which of the following plants male gamete
carrier is pollen grain and transfer of male gametes
! occurs through pollen tube?
(1) Algae (2) Bryophytes
" (3) Pteridophytes (4) Spermatophytes
194. Mark the correct statement w.r.t. conidia
(1) Both ‘a’ and ‘b’ are sex organs where ‘a’ is
(1) Asexual reproductive structure of Penicillium
nucule and ‘b’ is globule
and Chlamydomonas
(2) Both ‘a’ and ‘b’ are sex organs where ‘a’ is
(2) Sexual reproductive structure of Penicillium and
antheridium and ‘b’ is oogonium
Cladophora
(3) Both ‘a’ and ‘b’ are vegetative propagules
(3) Asexual reproductive structure produced by
known as bulbils
Penicillium and Aspergillus
(4) Both ‘a’ and ‘b’ are non-jacketed sex organs
(4) Sexual reproductive structure of Penicillium and
present in Chara
Aspergillus
189. Match column I with column II and choose correct 195. Term ‘vegetative reproduction’ is frequently used in
option
(1) Plants
Column I Column II
(Organisms) (Chromosome numbers (2) Monerans
in their gametes) (3) Animals
a. Apple (i) 12 (4) Both plants and animals
b. Rice (ii) 10 196. Select the odd one w.r.t. asexual reproduction
c. Maize (iii) 630 (1) Need of both male and female parents
d. Ophioglossum (iv) 17 (2) Produces a large number of individuals
(1) a(i), b(ii), c(iii), d(iv) (2) a(ii), b(iii), c(iv), d(i) (3) Rapid method
(3) a(iv), b(i), c(ii), d(iii) (4) a(iv), b(ii), c(i), d(iii) (4) Absence of haploid - diploid alternation
197. Find odd one out w.r.t. ploidy level in a flowering 204. In most of the angiosperms, pollen grains are shed
plant at
(1) Hypocotyl, Epicotyl (1) 3-celled stage (2) 4-celled stage
(2) Embryo, Oospore (3) 2-celled stage (4) 1-celled stage
(3) Scutellum, Zygote 205. In pollen banks, pollens are stored at
(4) Endosperm, Aleurone layer (1) – 196°C of liquid nitrogen
198. In Bryophyllum vegetative propagation is brought (2) + 20°C of liquid nitrogen
about by (3) 0°C of liquid nitrogen
(1) Axillary buds present at the margins of leaves (4) 4°C of liquid nitrogen
(2) Axillary buds present at the tip of leaves and 206. Mark the mis-matched pair
stems
(1) Orchid – Tiny seeds
(3) Adventitious buds present at the margins of
(2) Hydrophily – Common in dicots
leaves
(4) Adventitious buds present at the tip of leaf and (3) Pollen grain – 25 to 50 m in diameter
stem (4) Parthenium – Pollen allergy
199. Most vital event of sexual reproduction is 207. The stalk by which an ovule is attached to the
(1) Embryogenesis placenta is called
(2) Essential for fusion of gametes (1) Funicle (2) Hilum
(3) Pollination (3) Chalaza (4) Micropyle
(4) Development of fruits 208. Match column I with column II and choose correct
option
200. During the most common type of endosperm
development in flowering plants Column I Column II
(1) Cell wall formation is completely absent a. Epiblast (i) Endosperm
(2) PEN undergoes successive nuclear divisions to b. Triple fusion (ii) Insects
give rise to free nuclei c. Entomophily (iii) Grass embryo
(3) Each division of PEN is immediately followed d. TTC (iv) Seed viability
by wall formation (1) a(iii), b(ii), c(i), d(iv) (2) a(ii), b(i), c(iv), d(iii)
(4) Free nuclear divisions are absent (3) a(iii), b(i), c(ii), d(iv) (4) a(i), b(iii), c(ii), d(iv)
201. The innermost layer of anther wall in angiospermic 209. Choose the correct match w.r.t. angiosperm
plants is
(1) Microsporangium – ovule; Megasporangium –
(1) Tapetum and it nourishes the developing pollen female gametophyte
grains
(2) Megasporangium – ovule; Embryo sac – female
(2) Endothecium and it nourishes the developing
gametophyte
pollen grains
(3) Megasporangium – female gametophyte;
(3) Tapetum and its cells possess thin cytoplasm
Embryo sac – ovule
and uninucleate condition
(4) Nucellus – male gametophyte;
(4) Endothecium which protects and nourishes the
Megasporangium – ovule
pollen grains
210. Formation of embryo sac from a single megaspore
202. During microsporogenesis
nuclei is termed as
(1) Microspore tetrad is developed by meiosis in
(1) Bisporic development
sporogenous tissue
(2) Monosporic development
(2) Pollen grains are developed by mitosis in
sporogenous tissue (3) Tetrasporic development
(3) Microspore develops into male gametophyte (4) Polysporic development
(4) Male gametes are produced by pollen grain 211. A typical angiospermic embryo sac is
203. Pollen wall contains sporopollenin which is one of (1) 8 - nucleate, 8 - celled
the most resistant organic material. It is found in (2) 7 - nucleate, 8 - celled
(1) Exine (2) Intine (3) 8 - nucleate, 7 - celled
(3) Both exine and intine (4) Endexine and intine (4) 7 - nucleate, 6 - celled
212. Functionally cross-pollination but genetically similar 219. Persistent nucellus is seen in the seeds of
to autogamy is (1) Arachis hypogea (2) Ricinus communis
(1) Xenogamy (2) Geitonogamy
(3) Pisum sativum (4) Dolichos lablab
(3) Chasmogamy (4) Cleistogamy
220. Examine the figure of microsporangium and select
213. Abiotic agents for pollination are the part correctly matched with its feature or
(1) Wind, animals function.
(2) Water, animals
(3) Wind, water !"#
(4) Wind, water and animals !$#
214. In cereals like rice and wheat, pollen viability is
upto !%#
(1) 30 s
(2) ½ hour
(3) 30 hours !&#
(4) Several months
215. Emasculation is a process of
(1) Removal of female part from flower (1) Part (D): Endothecium – Development of
sporoderm
(2) Removal of male part from flower
(3) Removal of all axillary buds from plant (2) Part (A): Innermost wall layer – Dense
cytoplasm in cells
(4) Removal of both types of sex organs from
flower (3) Part (C): Middle layers – Nutrition to
216. What will be the ploidy of secondary nucleus and megaspores
PEN if the cross is made between 4n plant and (4) Part (B): Tapetum – Sporic meiosis
221. At lower end, the embryonal axis in grasses has
8n plant? the radical and root cap enclosed in/by
(1) 2n, 3n (2) 4n, 6n (1) Coleoptile
(3) 4n, 8n (4) 2n, 6n
(2) Hypocotyl
217. What is true for cotyledon in grass family?
(3) An undifferentiated sheath
(1) Called as scutellum that is situated at the
apex of embryonal axis (4) Epicotyl
(2) Called as scutellum that is situated towards 222. Which of the following statement for vegetative
lateral side of the embryonal axis propagation is correct?
(3) Called as coleoptile that is situated at the apex (1) Rapid process that requires a lot of resources
of embryonal axis
(2) There is no mechanism to introduce good traits
(4) Called as coleoptile that is situated towards or eliminate bad traits
lateral side of the embryonal axis
(3) It can preserve good qualities of a variety, race
218. Choose the correct one
and species with help of reduction division
(1) Apomixis - production of seeds without
(4) There is no crossing over but new linkages are
fertilization; Parthenocarpy - production of seed
with many embryos formed
(2) Apomixis - production of seeds without 223. Select the odd one out w.r.t. angiospermic plants
fertilization; Parthenocarpy - production of fruits (1) Most common embryo sac is Polygonum type
without fertilization
(2) Dichogamy is an adaptation for cross
(3) Apomixis - production of multiple embryo in pollination
seeds; Parthenocarpy - production of seeds
without fertilization (3) In many Citrus and Apple varieties some of the
integument cells start dividing and develop into
(4) Apomixis - production of seeds with multiple
the embryos
embryo; Parthenocarpy - production of fruits
with multiple seeds (4) Diploid endosperm is found in Oenothera
224. Which one of the following is not a characteristic 231. Cleistogamous flowers are characterized by
of entomophilous flowers? (1) Transfer of pollen to other flower
(1) Petals are usually coloured (2) Assured seed set
(2) Sticky exine due to presence of pollenkitt (3) Unisexual condition
(3) Reduction in the number of sepals and petals (4) Bisexual open condition
(4) Stigma are long, rough and sticky 232. Pollination which is restricted to few angiosperms,
mostly monocots is
225. Life cycle of marigold and rice plants is different
from mango and jackfruit in the absence of (1) Hydrophily (2) Anemophily
(3) Entomophily (4) Ornithophily
(1) Juvenile phase
233. Study the diagram shown below and select the
(2) Microgametogenesis
option (1–4) in which all the three parts labelled as
(3) Interflowering period A, B and C are correctly identified.
(4) Megasporogenesis
226. Select incorrect statements w.r.t. sexual !
reproduction in perennials
a. Produce seeds many times in their life span
b. Can reproduce only once in their life span
c. May have long juvenile stage "
d. Interflowering period represents vegetative #
phase
(1) Only d (2) a, d (1) A – Filiform apparatus
(3) b, c (4) c, d B – Vegetative nucleus
227. Structure in female gametophyte which play an C – Secondary nucleus
important role in guiding the pollen tube into (2) A – Synergid
synergid is B – Sperm
(1) Obturator (2) Filiform apparatus C – Nucellus
(3) Egg apparatus (4) Central cell (3) A – Filiform apparatus
228. Which one may not be an adaptation for pollen B – Male gamete
transfer by air?
C – Central cell
(1) Light and non-sticky pollen grains
(4) A – Synergid
(2) Well exposed stamens and feathery stigma
B – Male gamete
(3) Single ovule in each ovary
C – Secondary nucleus
(4) Mucilagenous covering on microspores
234. Which of the following statement is correct?
229. Innermost layer cell of anther wall in flowering
(1) Strobilanthus kunthiana flowers once in 12
plants is
years
(1) Coenocytic with less cytoplasm
(2) Formation of the diploid embryo is universal in
(2) Coenocytic, non-nutritive with single genome all sexually reproducing organisms
(3) Nutritive, coenocytic and archesporial in origin (3) In majority of organisms, both male and female
(4) Coenocytic, haploid and non-archesporial in gametes are stationary
origin (4) Sexual reproduction is an elaborate, complex
230. The ploidy of the nucellus, megaspore mother cell, and rapid process as compared to asexual
female gametophyte and secondary nucleus is reproduction
respectively 235. The most vital event of sexual reproduction is
(1) 2N, 2N, N, 2N (1) Gametes formation
(2) 2N, 2N, N, N (2) Fertilisation
(3) 2N, N, N, 2N (3) Development of embryo sac
(4) N, 2N, N, 2N (4) Embryogenesis
236. Anther wall layer which helps in dehiscence of 239. Find the incorrect statement w.r.t. asexual
anther shows reproduction.
(1) -cellulose fibrous bands on outer tangential (1) Uniparental
wall (2) With or without involvement of gamete
formation
(2) -cellulose fibrous thickening on outer and
(3) Offsprings are exact copy of their parent
radial wall
(4) Alternation of generation is observed
(3) -cellulose bands on outer, radial and inner
tangential wall 240. Match correctly w.r.t. mode of propagation
(1) Adventitious bud – Potato tuber
(4) -cellulose bands on inner tangential wall
(2) Offset – Lotus
237. Non-sticky pollen grains, well-exposed stamens,
(3) Seed – Cereals
nectorless flowers and uniovulate condition are
adaptations in (4) Rhizome – Terror of Bengal
241. Read the following statements
(1) Cheiropterophilous plants
a. Free nuclear division in developing embryo
(2) Anemophilous plants sac.
(3) Ornithophilous plants b. Free nuclear division in PEN.
(4) Entomophilous plants c. Formation of heterogametes in Fucus.
238. Examine the figure given below and select the right d. Chemotactic movement of sperms in
option giving all the four parts (a, b, c and d) Marchantia.
correctly identified. e. Germination of seed within fruit when fruit is
still attached to mother plant.
How many of the above statements represent
post-fertilization development?
!"# (1) Two (2) Three
(3) Four (4) One
!$# !*#
242. Oogamy is associated with formation of
&'()*)+',- (1) Flagellated male gamete always
!%# .))+- (2) Motile zygote always inside the female sex
$/01 organ
(1) (a) Cotyledon (3) Egg as female gamete
(b) Caruncle (4) Zygote outside the female body
(c) Root apical meristem 243. Read the following statements w.r.t. given diagram
(d) Endosperm and select correct set of features
(2) (a) Endosperm
(b) Root apex
(c) Shoot apical meristem
(d) Cotyledon
(3) (a) Cotyledon
(b) Caruncle
a. Dioecious plant mostly
(c) Shoot apical meristem
b. External fertilization
(d) Endosperm
c. Zooidogamy
(4) (a) Endosperm
d. Heterogametes
(b) Shoot apex e. Gametophytic plant body
(c) Root apical meristem (1) b, c & e (2) c, d & e
(d) Cotyledon (3) a, c, d & e (4) b, c, d & e
244. Algae and fungi resort to sexual reproduction 252. A plant breeder employs technique of emasculation
because (1) To cover the flower with a bag
(1) It is more rapid form of propagation (2) To prevent self-pollination
(2) Zygote as with its thick wall make them able (3) To prevent stamen from being contaminated
to withstand unfavourable conditions (4) To produce female plant
(3) Formation of zygote is universal event 253. Find the incorrect one w.r.t. post-fertilization
(4) Every organism begins life as a single cell changes
245. Internal fertilization is absent in (1) Nucellus – Perisperm
(1) Isogamous forms (2) Integument – Seed coat
(3) Pericarp – Ovarian wall
(2) Forms which require water for fertilization
(4) Central cell – Endosperm
(3) Majority of algae
254. Look at the diagram given below and answer
(4) Siphonogamous forms appropriately
246. Male and female flowers are present on same plant
in all of these, except
!
(1) Cucurbits (2) Coconuts
(3) Maize (4) Date palm
"
247. Gametes are haploid. It signifies that
#$%&'()*
(1) They cannot be formed without meiosis +,-&'()*
(2) They always have half the number of
chromosomes than that of main plant body
(3) Bryophytes produce them by mitosis (a) Since ! is associated with fruit, it is
(4) Bryophytes do not show meiosis since plant called as !"# $
body is haploid
(b) Since !"# is present, fruit cannot be
248. Clear cut vegetative, reproductive and senescent
called as !""# $
phases are absent in
(1) A – Pericarp, (i) – True fruits
(1) Pea (2) Bamboo
(2) B – Seed, (ii) – Ex-albuminous
(3) Rice (4) Litchi
(3) A – Thalamus, (i) – True fruit
249. Identify the correct match
(4) B – Seed, (ii) – Parthenocarpic
Column I Column II
255. Identify the correct match
(1) Grasses – Runners
Column I Column II
(2) Potato – Rhizome
(1) Coleorhiza – Dicot family
(3) Crocus – Tuber (2) Non-albuminous seed – Thick and swollen
(4) Agave – Bulb cotyledon
250. Asexual reproduction in Penicillium (3) Residual nucellus – Maize
(1) Involves formation of mitospores (4) Residual endosperm – Pea
(2) Involves exogenously produced spores 256. The early stages of embryo development are similar
in both monocotyledons and dicotyledons uptill
(3) Involves meiospores within sporangia
(1) Octant stage (2) Globular stage
(3) Heart stage (4) Mature embryo
251. Formation of false fruit is due to
257. A typical dicot embryo is characterized with
(1) Persistent calyx in apple (1) Major part of root developed from hypophysis
(2) Thalamus in brinjal (2) Cotyledons formed from entire octant
(3) Persistent and fleshy thalamus in pear proembryo
(4) Involvement of many ovaries in formation of fruit (3) Hypocotyl terminates as radicle
like mango (4) Embryonal axis on either side of cotyledons
258. Double fertilization as unique event in flowering 266. Single large cell containing dense cytoplasm and
plant which prominent nucleus, undergoes meiosis and present
(1) Occurs solely in PEC within ovule is
(2) Occurs partly in central cell (1) Megaspore
(3) Involves formation of diploid nucleus in central (2) Microspore mother cell
cell (3) A nucellar cell
(4) More than one option is correct (4) Perisperm
259. Coconut liquid endosperm is 267. Asexual reproduction mimics sexual reproduction
(1) Free nuclear type when
(2) Cellular type (1) Seed formation occurs without fertilization
(3) Helobial type (2) Thalamus is associated with fruit
(4) Mosaic endospermous condition (3) Pseudocarpic fruits are formed
260. Which one of the following statement is (4) There is no fruit formation
incorrect?
268. Aleurone layer has same ploidy as that of
(1) The generative cell divides during the growth of
pollen tube in the stigma (1) PEN (2) Zygote
(2) In some species floral rewards are in providing (3) Pericarp (4) Scutellum
safe places to lay eggs 269. Male gametophyte in angiosperms is
(3) The embryo development precedes endosperm (1) Highly reduced
development
(2) Can have maximum two cells
(4) Scutellum is lateral to the embryonal axis in
grass family (3) Developed after two asymmetric mitosis
261. Pollen-pistil interaction includes (4) A mitospore haploid structure
(1) Entry of pollen tube into ovule via micropylar 270. Pollination in most angiosperms is
end only (1) At 3-celled stage
(2) Chemotactic movement of pollen tube down the (2) Entomophilous
style
(3) Direct at 2-celled stage
(3) Micropylar end of embryo sac as entry point
into male gametophyte (4) Anemophilous
(4) Rejection reaction in style for certain cases 271. A typical anther shows
262. Egg apparatus, embryo sac and pollen grains most a. Two lobes with two theca each
commonly have _______ cells respectively. b. Each lobe as dithecous
(1) 8, 8 & 3 (2) 3, 8 & 3
c. All cells in a given microsporangium as
(3) 3, 7 & 3 (4) 3, 7 & 2 potential PMC
263. Which one of the following flowers produce d. Thousands of microspores per microsporangium
assured seed-set even in the absence of
pollinators? Out of these statements
(1) Autogamous (2) Homogamous (1) b is incorrect
(3) Cleistogamous (4) Herkogamous (2) a and b are correct
264. Cross pollination is encouraged if (3) c and d are incorrect
(1) Flower is self fertile (4) a, b, c and d are correct
(2) Homogamy is present 272. Find the incorrect statement
(3) Flower is dioecious (1) -cellulose thickening is associated with inner
(4) Flowers are hermaphrodite tangential wall of endothecium
265. Find the incorrect statement w.r.t. Commelina (2) Pollenkitts are associated with anemophilous
(1) Cleistogamous flowers groups
(2) Assured seed set (3) No enzyme can degrade sporopollenin
(3) Abiotic pollinators (4) Advanced pollen tetrad is the product of
(4) No anthesis successive cytokinesis
273. Mark correct match 281. Select incorrect statement w.r.t. life span.
Column I Column II a. It is the period from reproductive phase to the
a. Thick and swollen (i) Castor senescent phase.
cotyledons b. Life spans of organisms are not necessarily
b. Unused endosperm in (ii) Legumes correlated with their sizes.
mature seed
c. No individual is immortal, whether single-celled
c. Unused nucellus in seed (iii) Cashewnut or multi-celled.
d. Thalamus contributes (iv) Beet d. The life span of banana tree is 25 years.
to fruit formation
(1) a & d (2) a & b
(1) a(iii), b(iv), c(ii), d(i) (2) a(i), b(ii), c(iv), d(iii)
(3) a & c (4) c & d
(3) a(ii), b(i), c(iii), d(iv) (4) a(ii), b(i), c(iv), d(iii)
282. Consider the given figure and select correct set of
274. Which of the following structure is not associated
statements.
with megasporangium in angiosperms?
(1) Integuments (2) Funicle
(3) Micropyle (4) Tapetum
275. Which of the following feature is uncommon
!
between entomophilous and ornithophilous groups?
(1) Colourful flowers (2) Copious nectar "
(3) Sticky pollen grains (4) Scented flowers
276. Which of the following statements is wrong?
a. Common asexual reproductive structure in sac
(1) Flies and beetles visit white flowers with sweet fungi.
fragrance
b. The structure labelled by ‘A’ is sterigmata as
(2) Floral rewards are usually pollen and nectar uppermost branching of conidiophore.
(3) Pollen grains are protected from wetting by c. Development of exogenous asexual spores.
mucilage covering in certain groups d. Basipetally arranged sexual spores at the tip
(4) Anemophilous flowers have generally single of labelled structure ‘B’ as basidium.
ovule in ovary (1) a & c (2) b & d
277. Find the odd one w.r.t. chasmo-cleistogamous (3) a & d (4) c & d
flowers
283. Whole plant can be developed vegetatively in Agave
(1) Oxalis (2) Commelina from a propagule like
(3) Pansy (4) Pea (1) Rhizome (2) Corm
278. Female gametophyte is not involved in (3) Bulb (4) Bulbil
(1) Diplospory (2) Aplospory 284. Find odd one w.r.t. monoecious condition.
(3) Adventive embryony (4) Apospory (1) Chara (2) Marchantia
279. Ovules with more than one embryo sacs are (3) Cucurbits (4) Coconuts
involved in
285. The proximal end of the filament in stamen is
(1) Simple polyembryony attached to the
(2) Mixed polyembryony (1) Anther (2) Connective
(3) Sporophytic budding (3) Thalamus or petal (4) Both (1) & (2)
(4) Cleavage polyembryony 286. Which of the following layers of anther wall perform
280. Zygote is dormant for sometime in a fertilized ovule the function of protection and also help in
because dehiscence of anther to release the pollens?
(1) Moisture and oxygen are not adequate (1) Tapetum and middle layer
(2) Nutrition source is not developed (2) Epidermis and tapetum
(3) It has thick, dessication resistant wall (3) Epidermis, endothecium and middle layers
(4) It is a vital link to ensure continuity of species (4) Endothecium and tapetum
287. Pollen grains are well-preserved as fossils because 294. Which one of the following statement is false in
of the presence of respect of flowering plants?
(1) Pollenkitt (1) Parthenocarpy can be induced through the
(2) Sporopollenin application of growth hormones
(2) Integuments encircle the ovule except at the
(3) Pecto-cellulose
tip where a small opening called the germ pore
(4) Ligno-cellulose is organised
288. Megaspore mother cell differentiates from (3) Endosperm development precedes embryo
(1) Nucellus in the micropylar region development
(2) Integument in the chalazal region (4) Apomicts have several advantages in
horticulture and agriculture
(3) Primary parietal cell in chalazal region
295. Fill in the blanks with the appropriate words given
(4) Integument cell in micropylar region
below:
289. Which one of the adaptation is not related with
anemophilous flower? Fertilisation, Gametogenesis, Dioecious,
(1) Compact inflorescence and well-exposed Monoecious, Embryo, Gametes
stamens (i) Progenitor of next generation: !!!!"!!!! .
(2) Pollen grains are minute, light and sticky (ii) Plants with both male and female reproductive
(3) Large often-feathery stigma structures present on same plant is !!!!#!!!! .
(4) Presence of single ovule in each ovary (iii) Most critical event in sexual reproduction
290. Select incorrect statement is !!!!"!!!! .
(1) The central cell becomes primary endosperm (1) A – Gametes
cell (PEC) B – Monoecious
(2) Endosperm persists in mature seed of castor
C – Gametogenesis
(3) Scutellum lies lateral of the embryonal axis in
(2) A – Embryo
grass family
B – Dioecious
(4) Ploidy level of endosperm in maize is haploid
C – Gametogenesis
291. Choose incorrect option w.r.t. form of asexual
reproduction which mimic sexual reproduction (3) A – Gametes
(1) Development of diploid egg cell without B – Dioecious
reduction division C – Fertilisation
(2) Development of nucellar cells into many (4) A – Embryo
embryos as in mango
B – Monoecious
(3) Diploid parthenogenesis
C – Fertilisation
(4) Development of new plants from rhizome as in
turmeric 296. Choose incorrect option w.r.t nucellus
292. Mark the mis-matched pair (1) Possesses abundant reserve food material
(1) Polycarpic plants – Recovery phase (2) Generally differentiate a single megaspore
mother cell
(2) Offset – Water hyacinth
(3) It represents microsporangium
(3) Marchantia – Monoecious plant
(4) It is enclosed within integuments
(4) Bulbil – Agave
297. Which of the following prevents inbreeding
293. “Flowers produce enormous amount of pollen
grains when compared to the number of ovules depression?
available for pollination”. Given statement is true (1) Pollen is released and stigma becomes
for: receptive at the same time
(1) Water hyacinth, water lily (2) Presence of bisexual flowers
(2) Zea mays, Vallisneria (3) Presence of self-incompatibility
(3) Yucca, Amorphophallus (4) Anther and stigma are placed at same
(4) Mango, cucumber positions
298. The form of asexual reproduction that mimics
sexual reproduction
SECTION - B
(1) Is known as apomixis Assertion - Reason Type Questions
(2) Produces seeds without fertilisation In the following questions, a statement of assertion
(3) Occurs in some species of asteraceae and (A) is followed by a statement of reason (R)
grasses (1) If both Assertion & Reason are true and the
(4) More than one option is correct reason is the correct explanation of the
299. Sugarcane is vegetatively propagated into 10 assertion, then mark (1)
daughter plants. How many types of genetically (2) If both Assertion & Reason are true but the
similar plants are produced? reason is not the correct explanation of the
(1) One (2) Ten assertion, then mark (2)
(3) Two (4) Many (3) If Assertion is true statement but Reason is
300. It is difficult to show clear cut distinction between false, then mark (3)
vegetative, reproductive and senescent phases in (4) If both Assertion and Reason are false
(1) Radish (2) Mustard statements, then mark (4)
(3) Carrot (4) China rose 1. A : Self incompatibility promotes allogamy.
301. Which is correct to gametophyte in angiosperm? R : Incompatibility due to the genotype of pollen is
Gametophyte Male Female observed in Brassicaceae.
gametophyte gametophyte 2. A : Development of embryo is endoscopic in
(1) Dioecious 3 nucleated 8 nucleated flowering plants.
(2) Monoecious 3 nucleated 8 nucleated R : Differentiation of embryo occurs at chalaza end.
(3) Trioecious 3 nucleated 8 nucleated 3. A : Male and female plants are separate in Chara
(4) Bisexual 2 nucleated 7 nucleated wallichii.
302. If pollen grain is having 12 chromosome then what R : It is a monoecious plant.
would be the chromosomes number in endosperm 4. A : In Marchantia, the archegonia are borne on
of gymnosperm and angiosperm respectively? special branch called archegoniophore.
(1) 24 and 36 (2) 36 and 36 R : Archegoniphore has rows of archegonia
(3) 12 and 36 (4) 24 and 24 protected by perigonial leaves.
303. In the potato tuber, small plants emerges from 5. A : Vegetative fertilisation provides a stimulus for
(1) Adventitious bud (2) Axillary bud growth and formation of endosperm.
(3) Apical bud (4) Foliarbud R : It is triploid in all flowering plants.
304. Identify the labels A, B, C and D in the figure given 6. A : No enzyme that degrades sporopollenin is so
below far known.
!
R : It is one of the most resistant organic material
$ of megaspore.
7. A : Pollen grains can be stored for years at 196°C
" temperature.
R : Stored pollens can be used as seed banks.
8. A : Central cell of the typical embryo sac is
# initially bikaryotic and haploid.
R : It is the largest cell of embryo sac.
9. A : Pollen grains coming in contact with the stigma
(1) A-endosperm; B-scutellum; C-plumule; D-seed is a chance factor in both wind and water
coat pollination.
(2) A-aleurone; B-endosperm; C-radicle; R : Wind and water pollinated plants produce
D-coleorhiza enormous amount of pollens.
(3) A-epithelium; B-aleurone; C-plumule; D-seed coat 10. A : In Zostera, pollen grains are released inside the
(4) A-endosperm; B-aleurone; C-plumule; D-seed water.
coat and fruit wall R : Female flowers remain submerged in water.
11. A : If the female parent produces bisexual flowers, 22. A : In most aquatic organisms, such as majority of
there is no need for emasculation during algae and fishes as well as amphibians,
hybridization. external fertilization occur.
R : Bisexual flowers are always protogynous. R : In these organisms syngamy occurs outside
12. A : Albuminous seeds are present in castor and their body.
coconut. 23. A : Gametes are haploid though the parent plant
R : Endosperm persists in the mature seed of body from which they arise may be either
these plants. haploid or diploid.
13. A : Development of male gametophyte is R : Haploid organisms produce their gametes by
precocious in angiosperms. meiosis.
R : Pollen germination is in situ. 24. A : A large number of pollen products in the form
14. A : Pollen grains are well preserved as fossils. of tablets and syrups are available in the
R : Exines of pollens give a fascinating array of market.
patterns. R : Pollen grains are rich in nutrients.
15. A : Perennial plants are always polycarpic. 25. A : Anemophilous as well as hydrophilous flowers
R : Vegetative, reproductive and senescent phases produce enormous amount of pollens.
are distinct clearly. R : Pollen grains coming in contact with the stigma
16. A : Water hyacinth spreads very fast in water is a chance factor during these types of
body. pollination.
R : It is an exotic weed. 26. A : Water hyacinth can multiply at a tremendous
17. A : Cleistogamy is advantageous to the plants. rate.
R : It results in the assured seed formation even in R : It has underground stem for vegetative
the absence of pollinators. propagation.
18. A : In sporophytic budding, embryo directly 27. A : Zoospores are most common asexual
develops from a diploid cell other than egg. reproductive structures in algae.
R : Embryo is formed without meiosis and R : Algae and fungi require water for fertilization
syngamy in agamospermy. always.
19. A : An ovule generally has a 7-nucleated and
28. A : Megaspore mother cell forms only one
8-celled embryo sac formed from megaspore
functional megaspore commonly.
through reduction division.
R : Ovules generally differentiate the single
R : Embryo sac is a diploid structure.
megaspore mother cell in nucellus.
20. A : Higher organisms have resorted to sexual
reproduction in spite of its complexity. 29. A : Cleistogamous flowers produce assured seed
set even in the absence of pollinators.
R : Sexual reproduction enables organisms to
survive during unfavourable conditions as it R : Cleistogamous flowers are invariably
brings genetic variations. geitonogamous.
21. A : Cultivation of hybrids has tremendously 30. A : Bulbils are specialised buds which store food
increased productivity. materials.
R : Progeny of hybrids do not maintain hybrid R : They are concerned with vegetative
characters due to segregation. reproduction.
!" !" !
Chapter 3
Molecular Basis of Inheritance

SECTION - A
6. In translation mechanism, formation of 40s-mRNA
– tRNA complex requires
1. Out of the following four ds-DNA samples which
(1) IF2 and GTP (2) eIF2 and ATP
one shows maximum Tm value?
(1) DNA with 76% GC content (3) eIF3 and GTP (4) eIF1 and eIF4
(2) DNA with 40% cytosine 7. Which one of the following is incorrect w.r.t. lac
operon?
(3) DNA with 18% thymine
(4) DNA with 3% adenine (1) It is inducible operon which controls anabolic
pathway
2. During translation mechanism, a tRNA with the
anticodon CUC bonds with amino (2) Glucose or galactose cannot act as inducer
acid. (3) The repressor is synthesised constitutively
(1) Leucine (2) Arginine from the i-gene
(3) Methionine (4) Glutamine (4) Repressor is active which binds to the
3. Find out the base sequence on RNA which is operator region
made from the following DNA molecule. 8. At how many locations, SNPs are present in
human beings?
! "
#$%$&$'$'$%$#$'$&$% (1) 1.4 billion (2) 1.4 million
%$#$'$&$&$#$%$&$'$#
" ! (3) 3 × 109 bp (4) 3 × 104 bp
(1) 5 G C U A A C G A U C 3 9. Which one of the following step comes after
(2) 5 C G A U U G C U A G 3 electrophoresis in DNA finger printing?
(3) 3 C G A U U G C U A G 5 (1) Use of restriction endonuclease
(4) 3 G C U A A C G A U G 5 (2) Isolation of DNA
4. DNA specific RNA polymerase enzyme involved in
(3) Southern blotting
DNA replication mechanism is
(4) DNA – RNA hybridization
(1) Ligase (2) Pyrophosphatase
(3) Ribonuclease-P (4) Primase 10. If the sequence of nucleotides is AUG UUU UGC
UAC, the sequence of amino acids will be Met-
5. Select incorrect statement w.r.t. post-transcription
Phe-Cys-Tyr. Likewise, if the sequence of amino
processing
acids is Met-Tyr-Cys-Phe, then the sequence of
(1) Splicing is ATP dependent process nucleotides will be
(2) Spliceosome is formed between 5 AG and 3 (1) AUG UAC UGC UUU
GU of intron
(2) AUG UAU UGU UUC
(3) Cap is modified GTP
(3) AUG UAC UGU UUU
(4) Modification of nucleotides is most common in
tRNA (4) Any one of the above three
170 Molecular Basis of Inheritance Last Leap for NEET (Part-I)
11. Energetically DNA replication is a very expensive 17. Find the incorrect pair
process. The energy during the polymerisation of
(1) RNAP-III – ScRNA
new strand is provided by
(2) Genomics – Function of genes
(1) GDP
(2) ADP (3) Microsatellite – SSR
(3) Deoxyribonucleoside triphosphates (4) Catabolite gene – Tryptophan operon

activator protein
(4) Ribonucleoside triphosphates
18. In E. coli
12. In HGP, the fragments of DNA were sequenced
using automated DNA sequencers. It worked on (1) Transcription occurs inside nucleus
the principle of a method developed by (2) There is only one RNA polymerase
(1) E.M. Southern (3) Transcription factors are involved in
(2) Frederick Sanger recognition of promoter site
(3) Craig Venter (4) There are nine initiation factors
(4) Wellcome Trust (U.K.) 19. Choose correct option from the given table
13. Which of the following group of RNA is not !"#$%& *"#$%& +"#$%&
synthesised by RNA polymerase-I in eukaryotes? '() '() '()
5.6 ,-./707-8 ,-./01 234-./01 234-./01
(1) 5. 8 S rRNA and 18 S rRNA
5/699!.419:.7%
99:1%9-;%3 AB AC D
(2) 18 S rRNA and 28 S rRNA
5<6 =13>-?9$#9
(3) 5. 8 S rRNA and 5 S rRNA EF9G FH9G EH9G
?107@
(4) 5 S rRNA and Sn RNA (1) a, b & c are correct (2) a & b are correct
14. Which of the following antibiotic inhibits the (3) Only a is correct (4) All are incorrect
translocation reaction of translation in E. coli ?
20. Choose the wrong statement for template strand
(1) Streptomycin in DNA
(2) Erythromycin (1) It is called antisense and coding stand
(3) Tetracycline (2) It has 3 5 polarity
(4) Chloramphenicol (3) It is the strand upon which RNA is transcribed
15. Which of the following is not correct w.r.t. DNA in 5 3 direction
replication?
(4) Terminator region lies at its 5 -end
(1) Eukaryotes have several thousand origins of
21. During DNA proof reading, DNA polymerase I
replication
removes the mismatched nucleotides and
(2) Unwinding is brought about by enzyme synthesises the correct replacement. The newly
helicase, which is ATP dependent formed segment is sealed by
(3) DNA synthesis occurs in ! " direction (1) Topoisomerase (2) DNA ligase
(4) DNA polymerase-I removes RNA primer and (3) Ribonuclease-P (4) Endonuclease
replace it with the nucleotide of DNA and can 22. How many phosphodiester bonds are present in
correct the T = T dimer dsDNA having 10 bp in linear and circular
16. Which of the following is not a codon of glycine? condition respectively?
(1) GGC (2) GCG (1) 18, 20 (2) 16, 18
(3) GGU (4) GGA (3) 16, 16 (4) 20, 20

Last Leap for NEET (Part-I) Molecular Basis of Inheritance 171
23. Select incorrect statement w.r.t. post 30. lac operon will be transcribed at low level if
transcriptional processing (1) Lactose is present in the medium
(1) Capping requires guanyl transferase enzyme (2) CAP binds upstream of promoter
(2) Poly A residues are added at 3 of newly (3) Glucose and lactose are present together
formed hnRNA
(4) Path of RNA polymerase is unblocked due to
(3) Spliceosome formation is ATP independent presence of allolactose
step
31. Subunits of nu-body are synthesised in the cell-
(4) Snurps splice introns at both 5 and 3 ends
cycle during
24. Which of the given is not among the salient
(1) Antephase
features of HGP?
(2) The phase with most variable duration
(1) Human genome contains about 316.7 bp
(3) Invisible phase
(2) Average gene size is 3000 bases
(4) The phase involving mitotic cyclin
(3) Less than 2% of genome codes for proteins
32. Cytoplasmic male sterility in plants may occur due
(4) Chromosome 1 has most genes i.e., 2968
to
25. Sequence of the dsDNA is given below
(1) Non-functional and faulty development of
3 TACC ACTG GTAC GCAT CTAG 5 tapetum
5 ATGG TGAC CATG CGTA GATC 3 (2) Appearance of callose at tetrad stage of
How many amino acids will be coded by the pollen
mRNA formed by this sequence? (3) Release of callase enzyme during pollen
(1) Four (2) Five germination
(3) Six (4) Three (4) Strong callase activity during metaphase-II
26. Select an incorrect statement w.r.t. lac operon 33. The branch of biology which deals with the study
(1) It consists of three structural genes of the structure and function of gene is called as
(2) Every structural gene has its own promoter (1) Molecular genetics
(3) Repressor protein is active (2) Biochemical genetics
(4) -galactosidase catalyses breakdown of (3) Cytogenetics
lactose (4) Both (1) & (2)
27. Find an incorrect match 34. Many new organs and tissues which were
(1) UAA – Ochre originally absent, develop subsequently de novo
(2) UUU – Phenylanine due to mysterious vital force. This idea was of
(3) UGG – Non degenerate codon (1) Theory of epigenesis
(4) GUG – Non ambiguous codon (2) Preformation theory

28. RNA may not be a suitable genetic material in (3) Theory of pangenesis
organisms because of (4) Germplasm theory
(1) Presence of 2 -OH in sugar 35. Select the incorrect match
(2) Chemically less reactive nature (1) × 174 – 5386 bp
(3) Structurally more stable nature (2) phage – 48502 bp
(4) Slow rate of mutation (3) E. coli – 4.6 × 106 bp
29. Lac operon in E. coli (4) Haploid human cell – 3.3 × 109 bp
(1) Is repressible 36. Bond between deoxyribose sugar and purines in
(2) Consists of five structural genes DNA involves which positions respectively?
(3) Can also act in presence of galactose (1) 1 – 9 (2) 1 – 6
(4) Remains switched off in absence of inducer (3) 3 – 9 (4) 3 – 3
37. If a hybrid DNA molecule labelled with N 15 is 46. Cap region of mRNA has nucleotides which are
allowed to replicate four times in culture medium complementary to
having N14, the percentage of hybrid DNA after
(1) 3 end of 18s rRNA (2) 5 end of 18s rRNA
third generation would be
(1) 50% (2) 25% (3) 3 end of 28s rRNA (4) 5 end of 28s rRNA
(3) 12.5% (4) 6.5% 47. Who proposed semiconservative mode of

replication in DNA?
38. What is incorrect for DNA?
(1) Meselson and Stahl
(1) Radius of DNA is 1 nm
(2) Phosphate moiety is at 5 -end of deoxyribose (2) Watson and Crick
sugar (3) Cairn
(3) Nitrogen bases linked to sugar moiety project (4) Taylor
inward
48. Select the enzyme which can break and reseal
(4) Distance between two successive base pair one strand of DNA
strands is 3.4 nm
(1) Primase (2) Endonuclease
39. Which of the following is not present in DNA?
(1) Guanine (2) Cytosine (3) Topoisomerase (4) Exonuclease
(3) Thiamine (4) Adenine 49. Choose the incorrect statement for DNA
polymerase
40. What is present in maximum percentage in
chromosomes composition? (1) It was extracted and purified from E. coli
(1) DNA (2) Histones (2) Can polymerise deoxyribonucleotides from
(3) NHC (4) Acidic proteins 5 to 3 end
41. Histone proteins are rich in which set of amino (3) It can start replication
acids? (4) It has exonuclease activity from 3 to 5
(1) Methionine and cysteine 50. RNA polymerase is a holoenzyme. What is
(2) Lysine and arginine removed from it to convert it into core enzyme?
(3) Tryptophan and tyrosine (1) 2 (2)
(4) Proline and glycine (3) (4)
42. Eleven base pair per turn are generally present in
51. Which of the following initiation factor requires
which type of DNA?
GTP during translation in eukaryotes?
(1) B-DNA (2) C-DNA
(1) IF2 (2) eIF1
(3) D-DNA (4) A-DNA
(3) IF3 (4) eIF3
43. Nitrogen bases present in the introns at 5 in the
beginning and at 3 in the last are 52. Which side of amino acid is joined to t-RNA during
translation?
(1) AG and GU (2) AU and GU
(3) GU and AG (4) GU and AU (1) NH2 - side (2) COOH - side
44. How many types of genes are present in gene (3) H - side (4) R - side
battery model of Britten-Davidson for eukaryotes? 53. Translocase in prokaryotes is
(1) 2 (2) 3 (1) EF - Ts (2) EF - Tu
(3) 4 (4) 5
(3) EF - G (4) IF1
45. Choose the incorrect match
54. P- site during protein synthesis is contributed by
(1) One gene one polypeptide – Yanofsky
(1) Small ribosomal subunit
(2) One gene one enzyme – Beadle and
Tatum (2) Large ribosomal subunit
(3) One gene one character – de Vries (3) mRNA and small subunit of ribosome
(4) One mRNA one polypeptide – Jacob (4) More than one option is correct
55. Termination factor RF2 in prokaryotes recognises 63. How many phosphodiester bonds are present in
which non-sense codons? a DNA molecule if its one strand has 60
(1) UAA only (2) UGA only nucleotides?
(1) 120 (2) 59
(3) UAA and UAG (4) UAA and UGA
(3) 119 (4) 118
56. Which of the following antibiotics inhibit peptide
bond formation in prokaryotes? 64. How many nucleotides are approximately
connected with one nucleosome in DNA?
(1) Tetracycline (2) Puromycin
(1) 50 (2) 100
(3) Chloramphenicol (4) Erythromycin
(3) 150 (4) 200
57. Which of the following amino acid is not coded by
65. During early years of HGP, ________ became the
six codons?
major partner of the project
(1) Serine (2) Arginine
(1) U.S. department of energy
(3) Alanine (4) Lysine
(2) National institute of health
58. Transduction experiment to prove DNA as a (3) Welcome trust, U.K.
genetic material was conducted by Hershey and
(4) NBPGR
Chase with the use of radioactive elements,
namely 66. VNTR belongs to a class of satellite DNA and its
size in a genome varies from 0.1 to ______
(1) S32 and P35 (2) S35 and P32
(1) 20 kb (2) 30 kb
(3) N15 and H3 (4) C14 and H3
(3) 40 kb (4) 50 kb
59. UTRs are required for efficient translation, which
67. During DNA finger printing experiment DNA bands
are present on
of different sizes gives a characteristic pattern for
(1) 3 mRNA an individual, called as
(2) 5 mRNA (1) Dendrograph (2) Autoradiogram
(3) T C region of tRNA (3) Cladogram (4) Phenogram
(4) Both (1) & (2) 68. DNA polymorphism is equivalent to allelic
sequence variation and
60. Find the incorrect statement w.r.t. lac operon
a. These are inheritable
(1) It has a negative control with respect to
repressor b. These can be observed in non coding DNA
c. Satellite DNA is an example for such
(2) It is a inducible operon
variations
(3) It is a group of six genes working in a
(1) All are correct
coordinated manner
(2) Only c is correct
(4) lac-y gene codes for -galactosidase
(3) Both a and c are incorrect
61. A seven base sequence to which RNA polymerase
binds during transcription in eukaryotes is called
69. Select the incorrect statement w.r.t. human DNA
(1) TATA box (2) Homeotic box
sequence
(3) CAAT box (4) Pribnow box (1) 50 percent of genes discovered has unknown
62. The sequence of mRNA is 5 functions
AUGCGCCGCUAU3 . How many amino acids will (2) 99.9 percent of base sequences are similar in
be present in the polypeptide formed from this all humans
mRNA, if overlapping is considered?
(3) Snips are identified at about 1.4 million
(1) 4 (2) 8 locations
(3) 9 (4) 10 (4) About 45% DNA is intronic in humans
70. During HGP, fragments of DNA were sequenced 78. Select the incorrect statement w.r.t. HGP
using (1) Human genome has 3.3 billion nucleotide
(1) Sanger's method base pairs
(2) Hershey and Chase method (2) Largest and smallest gene are autosomal and
heterosomal respectively
(3) Maxam and Gilberts method
(3) "Snips" occur at about 1.4 million locations
(4) H.G. Khorana's method
(4) ESTs serve as landmarks on the physical
71. A model organism of plant category which has map of a genome
also been sequenced along with rice is
79. Theoretically the number of nucleosomes in a
(1) Agropyron (2) Anabaena genome of human cell is
(3) Agrostis (4) Arabidopsis (1) 3.3 × 109 (2) 3.3 × 107
72. HGP methodology based upon identifying all DNA (3) 1.65 × 107 (4) 6.6 × 107
sequences expressed as RNA was referred as 80. Which one of the following is required for the
(1) UTR's (2) ORF's initiation phase of DNA synthesis in bacteria?
(3) EST's (4) SSR's (1) DNA polymerase I (2) DNA polymerase III
(3) DNA ligase (4) Primase
73. What is the length and number of phosphodiester
bonds in a B-DNA with 2 Kbp? 81. RNA synthesis stops as soon as polymerase
reaches the terminator region. Which is required
(1) 2000 Å and 1999 respectively
for this process?
(2) 200 Å and 4000 respectively (1) F-factor (2) Nus-factor
(3) 6800 Å and 1999 respectively (3) Rho factor (4) Sigma factor
(4) 680 nm and 3998 respectively 82. Which one of the following is incorrectly matched
74. If nitrogenous base sequence on mRNA is pair w.r.t. DNA fingerprinting?
CCUCUAGCAGAU then find out the sequence on (1) Size separation – Gel electrophoresis
sense strand (2) VNTRs from Gel to Nylon paper – Blotting
(1) 3 GGAGATCGTCTA5 technique
(2) 3 CCTCTAGCAGAT5 (3) Microsatellites — ESTs
(3) 5 CCTCTAGCAGAT3 (4) RFLP amplification — PCR

83. Prokaryotic mRNA begins translation even during
(4) 5 GGAGATCGTCTA3
its synthesis and its nature is
75. During post transcriptional processing, a complex
(1) Monocistronic (2) Polycistronic
called spliceosome is formed
(3) hnRNA (4) Monogenic
(1) Between 5 end AG and 3 end GU
84. Human genome is said to have approximately
(2) Between 5 end GU and 3 end AG
(1) 2968 genes
(3) And recognised by components of ScRNA
(2) 9 billions nucleotides
(4) And adjacent exons are brought together by (3) 3 × 109 bp
DNA ligase
(4) 30000 – 40000 bp
76. During translation, the codon-anticodon reaction in
85. What will be the percentage of G in a dsDNA if
eukaryotes occurs in the presence of protein
the amount of T is 20%?
factor, namely
(1) 70% (2) 80%
(1) eIF3 (2) eIF1
(3) 30% (4) 50%
(3) eEF1 (4) eEF2
86. Most of the unusual bases found in a cell are
77. Inducible operon is under positive control through associated with _______to help the wobbling.
(1) Lactose (2) Glucose (1) rRNA (2) mRNA
(3) Cga protein (4) Tryptophan (3) tRNA (4) snRNA
87. Replication is an autocatalytic property of DNA 95. In prokaryotic DNA replication
which does not require (1) On each DNA template DNA polymerase-III
(1) DNA polymerase III as major polymerising adds 10 nucleotides in one second
enzyme
(2) Deoxyribonucleoside triphosphates provide
(2) Primase to synthesize a short sequence of energy for forming phosphodiester bond
RNA over 3 end of parental DNA
(3) Only DNA polymerases are required
(3) An ATP dependent ligase enzyme
(4) DNA polymerase I shows removal of primer
(4) An ATP dependent helicase enzyme to through 3 5 exonuclease activity
stabilize the single strandedness in DNA
96. Which of the following is incorrect w.r.t. Nucleic
88. First structural gene to be transcribed in a acid?
inducible operon of E. coli is
(1) DNA is more stable so preferred for storage
(1) Inhibitor gene (2) Structural gene ‘z’
of genetic information
(3) Structural gene ‘y’ (4) Structural gene ‘a’
(2) Fuelgen test is negative for RNA
89. About 1.4 million locations were identified in
(3) DNA is the largest macromolecule
human genome where single base differences
occur, these locations are called (4) Exposed nitrogenous bases and presence of
(1) Scyrps (2) Snurps OH group at 3 position in sugar explains
RNA reactivity
(3) UTR’s (4) Snips
97. For which of the following features the DNA
90. Find the number of phosphodiester bonds and
polymerases and RNA polymerases are similar?
glycosidic linkages associated with E. coli DNA
respectively (1) Can perform the proof reading
(1) 9.2 × 106 – 2, 9.2 × 106 –2 (2) Cannot initiate the nucleotide polymerisation
(2) 4.6 × 106 – 2, 4.6 × 106 – 2 (3) Shows polymerisation in 5 3 direction
(3) 4.6 × 106, 4.6 × 106 (4) More than one option is correct
(4) 9.2 × 106, 9.2 × 106 98. Choose the incorrect option w.r.t. transcription unit
91. Number of nucleotides associated with each (1) Regulatory sequences may be present at
repeating unit present in chromatin are both upstream and downstream of the
(1) 200 (2) 400 promoter region
(3) 250 (4) 500 (2) Promoter is present at the 5 end of the
92. The unequivocal proof that DNA is the genetic structural gene
material came from the experiment which utilised (3) DNA strand which does not code for anything
(1) Streptococcus is called non-coding strand
(2) T2, E. coli (4) Termination sequence is present at 3 end of
the coding strand
(3) E. coli, heavy nitrogen
(4) P32, S35, R-type bacteria 99. How many adenylate residues are added at 3
end during the processing of hn RNA in
93. Protein synthesising machinery has evolved eukaryotes?
around ______ and ______ is best for the
transmission of genetic information. (1) 50-100 (2) 100-150
(1) DNA, RNA (2) RNA, DNA (3) 600-700 (4) 200-300
(3) RNA, RNA (4) DNA, DNA 100. Enzyme utilised for the synthesis of RNA
94. Choose the odd one out w.r.t. Taylor’s experiment copolymers and homopolymers during
deciphering of genetic code is
(1) Used roots of Vicia faba
(1) DNA dependent RNA polymerase
(2) Utilised radioactive thymidine
(2) RNA dependent DNA polymerase
(3) Used heavy nitrogen
(3) DNA independent RNA polymerase
(4) Proved DNA in chromosomes replicate semi-
conservatively (4) DNA dependent DNA polymerase
101. By knowing the sequence of amino acids in 110. Amino acyl synthetase enzyme is recognised by
protein you cannot predict the correct sequence tRNA at its
of nucleotides on mRNA. This predicts which (1) DHU loop
property of genetic code?
(2) T C loop
(1) Non-ambiguity (2) Degeneracy
(3) – CCA 3 OH end
(3) Commaless (4) Polarity
(4) Anticodon loop
102. Which of the following sequence on mRNA is
111. The technique by which DNA band pattern in the
required for efficient translation?
gel is transferred to nylon membrane while
(1) Anti Shine Delgarno (2) Pribnow box performing fingerprinting experiment is
(3) SNP’s (4) UTR’s (1) Northern blotting (2) PCR
103. Choose the odd one out w.r.t. lac operon (3) Southern blotting (4) Western blotting
(1) Polycistronic structural genes have common 112. In living organisms, the regulation of gene
promoter expression could be exerted at various levels and
(2) Lactose is transported in cell by permeases the predominant site for control in prokaryotes is
(3) The i gene shows its expression constitutively (1) mRNA transport level
(4) Switching on of operon by lactose is positive (2) Translation level
control (3) Splicing level
104. In prokaryotes the two charged tRNA’s are (4) Transcription initiation level
brought close together in ribosome then the
113. With reference to protein synthesis, consider the
formation of peptide bond between them is
following events
performed by the catalyst
a. Binding of amino acyl – tRNA complex with
(1) 16S rRNA (2) 23S rRNA
mRNA
(3) 18S rRNA (4) 28S rRNA
b. Activation of amino acid
105. Frederick Sanger has developed an automated
c. Polypeptide formation
DNA sequences that arranged the DNA fragments
on the basis of d. Formation of amino acyl – tRNA complex
(1) Satellite DNA (2) Overlapping regions What is the correct sequence of the above
events in protein synthesis?
(3) Repititive DNA (4) ESTs
(1) b, d, a & c (2) a, b, d & c
106. Number of genes associated with chromosome 1
in human beings is (3) d, b, a & c (4) a, d, b & c
(1) 231 (2) 30000 114. The ________ has the property to cut and join the
DNA to release the strain developed behind
(3) 2968 (4) 3000 replication fork
107. Choose the correct statement w.r.t. satellite DNA (1) Restriction endonuclease
(1) Show high degree of polymorphism (2) Helicase
(2) Form basis of DNA fingerprinting (3) DNA topoisomerase
(3) Part of both coding and non-coding sequences (4) DNA polymerase-II
(4) More than one option is correct 115. Expressed sequence tags (ESTs) and sequence
108. An mRNA synthesized by using 144 nucleotides annotation are the two methodologies used in
is capable of producing a polypeptide chain of (1) DNA fingerprinting (2) PCR
(1) 48 amino acids (2) 47 amino acids (3) DNA sequencing (4) HGP
(3) 282 amino acids (4) 141 amino acids 116. The sequence of coding strand of DNA is as
109. Which of the following antibiotic inhibits peptidyl follows 5 AACCTTGGGTA 3 , then the sequence
transferase activity? of mRNA will be
(1) Tetracycline (2) Streptomycin (1) AACCUUGGGUA (2) TTGGUUCCCUT
(3) Neomycin (4) Chloramphenicol (3) AACCTTGGGTA (4) TTGGTTGGGUC
117. Select the correct statement w.r.t. DNA structure 122. 50 molecules of E. coli DNA with both heavy
(1) Phosphate group lies at 5 end of one strand strands is allowed to replicate twice in 14NH4Cl
while at 3 end of complementary strand medium, the resultant generation will have
(1) 200 molecules, all hybrid
(2) A DNA with 4 percent thymine nucleotides is
(2) 100 molecules having 14 N and other 100
more stable than a DNA with 40 percent
cytosine nucleotides molecules as hybrid
(3) Purine : pyrimidine ratio is constant for a (3) 50 molecules hybrid and 150 molecules with
14NH Cl
species only 4
(4) 200 molecules, all light
(4) Purine nucleosides have 1 -3 glycosidic
linkage 123. Find a set of incorrect statements
118. Match the following a. RNA is labile, easily degradable and reactive
as compared to DNA
Column-I Column-II
b. Presence of thymine at the place of uracil
a. Kornberg enzyme (i) EF-G confers additional stability to DNA
b. DNA gyrase (ii) Primer removal c. Both DNA and RNA are able to mutate,
c. Severo Ochoa (iii) Topoisomerase viruses having DNA genome mutate and
evolve faster
enzyme
d. DNA can easily express the characters
d. Translocase (iv) Polynucleotide directly
phosphorylase (1) b & d (2) c & d
(1) a(ii), b(iii), c(iv), d(i) (3) b & c (4) a & c
(2) a(ii), b(iii), c(i), d(iv) 124. How many amino acids will be coded by the given
(3) a(iii), b(ii), c(iv), d(i) sequence of mRNA if its 15th base is substituted
by A?
(4) a(i), b(iii), c(ii), d(iv)
5 AUG GUG UAG CAG UAC GUA 3
119. Which one of the following statements is incorrect
(1) Four (2) Two
w.r.t. human genomics?
(3) Six (4) Five
(1) Less than 2 percent of the genome codes for
protein 125. Predominant site for the control of gene
expression in prokaryotes is
(2) Both largest and smallest genes are allosomal
(1) Transcriptional level
(3) All human populations are genomically
(2) Processing level
identical except difference in 3 × 104 bases
(3) mRNA transport level
(4) Introns are 24%
(4) Translational level
120. An mRNA with
126. In eubacteria, predominant site for regulation of
5 AUGUUAAUCGUUCCUAAGUGA3 codon gene expression is
sequence will specify how many amino acids in
(1) Transcriptional level
overlapping condition?
(1) 6 (2) 19
(3) Transport of m-RNA from nucleus to
(3) 4 (4) 16 cytoplasm
121. In an inducible operon system, the permeability (4) All of these
for lactose absorption is increased by an enzyme. 127. Which of the following event takes place in the
This enzyme is a product of _________gene. cytoplasm of eukaryotic cells?
(1) lac z (1) Splicing of RNA
(2) lac y (2) Capping of RNA
(3) lac a (3) Formation of peptide bonds
(4) trp b (4) Tailing of RNA
128. If the proportion of 5-methyl uracil in a ds-DNA is (3) A - Inducer ; B - lac z ;

7%, then what will be the total proportion of C - Permease ; D - lac a
monocyclic nitrogen bases in this DNA?
(4) A - Lactose ; B - lac y ;
(1) 50% (2) 43%
C - Permease ; D - lac a
(3) 14% (4) 86%
129. In a eukaryotic cell splicing, capping and tailing 134. Select the correct statement w.r.t. HGP
steps (1) Sequencing of 3.1647 million nucleotide bases
(1) Are template dependent (2) Largest gene is allosomal with 2.4 million
(2) Occur in cytoplasm bases
(3) Occur in nucleus (3) HGP was completed by sequencing of
(4) Are performed by SnRNPs expressed mRNA genes only by sequence
130. trp operon as well as lac operon both annotation technique
(1) Show positive control (4) Protein coding genes are exonic and make
(2) Are inducible systems more than 2 percent part of genome
(3) Are repressible systems 135. Select the correct match
(4) Are present in bacteria (1) Severo Ochoa – DNA polymerase
131. In the given below transcription unit, what does A, (2) Meselson and Stahl – Chromosome
B and C represent respectively? replication in faba
0-.(+1-'2,'%(*+,.-,*+',3 beans
(3) Hershey and Chase – E. coli
/
# $ (4) Griffith – Salmonella
" ! 136. Read the following statements carefully
$ #
"%&'()*+,-.(& a. A very low level of expression of lac operon
(1) Terminator, Non-template, Promoter has to be present in the cell all the time
(2) Promoter, Non-coding, Terminator b. Every operon of a prokaryotic cell can be
(3) Promoter, Template, Structural gene regulated by the same repressor protein
(4) Terminator, Template, Promoter c. The codon in mRNA is read in a contiguous
132. If code is overlapping, then mRNA with fashion
G U G U C A U G A G C C will specify how many d. RNA polymerase-III is responsible for
amino acids? transcription of 5srRNA, 23srRNA, snRNA
(1) Two (2) Four and tRNA
(3) Six (4) Ten (1) Both c and d are correct
133. The figure given below is a diagrammatic
(2) All are correct, except b
representation of lac operon. What does A, B, C
and D represent respectively? (3) All are correct, except d
! " ! # $ % (4) Both a and c are correct
137. A=T, G C pairing is present in DNA. This base
pairing confers very unique property to the
&'!('))#(*+&,- !"#*+&,- polynucleotide chains and they are said to be
complementary to each other. From this we can
6(07)103"#7
deduce all the following, except
./01023#)"40)' 5 3(07)02'3810)'
(1) The quantity of A is equal to the quantity of T
(2) G/C = 1
-
(3) The quantity of A + T is equal to the quantity
(1) A - Inducer ; B - lac y of G + C
C - Permease ; D - lac z
(4) If the sequence of bases in one strand is
(2) A - Repressor ; B - lac z ; known then the sequence in other strand can
C - Lactase ; D - lac a be predicted
138. In eukaryotes, RNA polymerase binds to a region 145. When the codon of mRNA is 5 CCU 3 then the
of DNA which is recognised by anticodon on tRNA will be
(1) -factor (2) -factor (1) 5 GGA 3 (2) 3 GGA 5
(3) Transcription factor (4) Core enzyme (3) 3 AGG 5 (4) 3 GAC 5
139. Transcription as well as translation processes 146. A small DNA sequence is arranged tandemly in
many copy numbers. This copy number varies
(1) Cannot be coupled in bacteria
from chromosome to chromosome in an
(2) Occur in the cytoplasm of eukaryotic cell individual. The number of repeat show
(3) Are energetically very expensive (1) Very high degree of polymerisation and
(4) Result in protein and RNA respectively translation
140. Which of the following for ds-DNA is correct? (2) Very high degree of polymorphism
(1) A/T = 0 (2) A + T = G + C (3) Very low degree of hybridisation and

polymorphism
(3) A + G = C + T (4) C/G = 0.5
(4) Very high degree of translation
141. Choose the correct option w.r.t. sickle cell
147. What is incorrect w.r.t. properties of genetic
anaemia
material?
a. Substitution of amino acid in the globin protein
(1) It should be able to generate its replica
results due to single base substitution at the
sixth codon of the beta globin gene from GAG (2) It should be capable of undergoing slow
to GUG changes
b. Heterozygous individuals exhibit sickle-cell (3) It should be structurally unstable but

chemically stable
trait.
(4) It should be able to express itself in the form
c. HbA peptide has amino acid sequence as
of Mendelian characters
Val-His-Leu-Thr-Pro-Val.
148. Semiconservative mode of replication was proved
d. Mutant haemoglobin molecule shows
by Cairns using radioactive ____ in _____.
polymerisation under low oxygen tension.
(1) Cytosine, bacteriophage
(1) a, c, d (2) a, b, c
(2) Thymidine, E.coli
(3) b, c, d (4) a, b, d
(3) Guanosine, Vicia faba
142. In a double stranded DNA molecule the
(4) Protein, Drosophila
percentage of cytosine is 18, what will be
percentage of bicyclic nitrogen bases? 149. Which of the following catalyse the nucleotide
polymerisation in template independent manner?
(1) 50% (2) 64%
(1) DNA polymerase
(3) 36% (4) 18%
(2) Reverse transcriptase
143. During replication, DNA synthesis occurs
(3) Polynucleotide phosphorylase
discontinuously on one strand because
(4) Peptidyl transferase
(1) DNA molecule uncoils gradually
150. How many phosphodiester bonds are present at
(2) Hydrogen bonds keep the two strands
one strand in genetic material of bacteriophage
together
lambda?
(3) Topoisomerase and helicase can act only on (1) 97002 (2) 48502
one side of DNA molecule
(3) 97004 (4) 48501
(4) DNA polymerase can polymerise the
nucleotides in only one direction
(1) RNA polymerase III – 5.8srRNA, tRNA,
144. Find the incorrect match
snRNA
(1) Coenorhabditis elegans - 97 million bp
(2) RNA polymerase II – hnRNA
(2) Human genome (n) - 3.3×109 bp (3) Splicing – snRNPs
(3) SSR - Microsatellite (4) Termination factor
(4) VNTRs - 1 to 6 bp in transcription – Rho factor
152. Formyl methionine carrying tRNA can bind only 158. Which of the following is not a feature of genetic
with code?
(1) A site on 80S ribosome (1) Degeneracy
(2) P site on 70S ribosome
(2) Ambiguity
(3) A site on 70S ribosome
(3) Specificity
(4) P site on 80S ribosome
(4) Universality
153. Which one of the following group of codons is
called as degenerate codon? 159. DNA fingerprinting involves
(1) UAA, UAG and UGA (1) Identifying differences in some specific
(2) GUA, GUG, GCA, GCG and UGG regions in DNA sequence
(3) UUC, UUG, CCU, CAA and UGA (2) Satellite DNA
(4) UUA, UUG, CUU, CUC and CUG (3) Repetitive DNA
154. In regulation of gene expression in prokaryotes (4) More than one option is correct
(A) Lactose acts as the co-repressor for gene
expression
(B) Tryptophan acts as the inducer for gene 160. !"# !$#
expression
(C) Regulator gene is one that produces the
repressor molecule in Lac operon !%#
(2) B & C are correct
(3) Only C is correct
(4) A & B are correct
155. Which enzyme helps to cut one strand of DNA
a. Part marked as (B) has five types of histone
duplex to release tension of coiling of two
strands? proteins.
(1) DNA ligase b. Part marked as (A) is rich in basic amino acid
residues.
(2) DNA polymerase I
(3) Topoisomerase c. Part marked as (C) is made up of 400
nucleotides.
(4) Helicase
156. Which of the following component would enhance Which of the above given statement(s) is/are
the rate of peptide bond formation during incorrect?
translation in Nostoc? (1) a, c
(1) 16 S rRNA (2) Kornberg enzyme (2) a only
(3) 23 S rRNA (4) Translocase
(3) c only
157. Match the following (column I with column II)
(4) a, b
Column I Column II
161. If hybrid DNA (N 14 N15 ) is allowed to replicate
a. Chromosome 1 of (i) 4000 genes
human thrice in a medium containing N15, then what is
the proportion of pure light, pure heavy and hybrid
b. Human genome (ii) 231 genes
DNA obtained respectively?
c. Genome of E.coli (iii) 2968 genes
(1) 7 : 0 : 1
d. Chromosome Y of (iv) 30000 genes
human (2) 7 : 1 : 0
(1) a(i), b(iv), c(iii), d(ii) (2) a(iii), b(iv), c(i), d(ii) (3) 0 : 7 : 1
(3) a(iii), b(iv), c(ii), d(i) (4) a(i), b(iv), c(ii), d(iii) (4) 2 : 1 : 5
162. Select the correct option with respect to the given 167. What will be the base sequence on DNA template
figure. strand if mRNA possess
5 UACGUACGUACGUAC3 base sequence?
!"#$%&"'()'*$+%)#")+%'),
!"# !%# (1) 5 TACGTACGTACGTAC3
!,/(0#),+%)"#$1
- . (2) 3 ATGCATGCATGCATG5
. -
(3) 5 ATGCATGCATGCATG3
!$# (4) 3 TACGTACGTACGTAC5
168. In elongation process of translation, tryptophan is
(1) Part (B): End of the process of translation brought at A-site of ribosome by which one of the
(2) Part (C): Complementary sequence of mRNA tRNA molecule?
(3) Part (A): DNA sequence that provides binding
!"#"$ !"# !
site for RNA polymerase (1) (2)
(4) Part (C): It has the polarity and the sequence
same as RNA, except uracil at the place of
thymine ## $$
163. Which one does not explain Chargaff's rule?
(1) Applicable only for ds DNA !"# ! $"! !
(2) Molar concentration of A + T and G + C are (3) (4)
equal
! " ## $$
(3) ratio is constant for a species
# $
169. Select the correct statement w.r.t. HGP.
(4) Molar concentration of sugar equals to that of
phosphate (1) Exonic genes are > 2%
164. In lac operon (2) Longest and smallest genes are allosomal
(3) Single base DNA differences exist at 1.4
(1) Lactose induces the operon to switch off
billion locations
(2) Repressor mRNA is synthesised continuously
(4) 9.9% nucleotide bases are same in all people
(3) Only three genes are transcribed 170. RNA being a catalyst is more reactive hence
(4) Control is negative in all conditions unstable because of all, except
165. Process of translation of the mRNA to protein (1) Presence of 2’OH of RNA
begins when (2) Presence of uracil
(1) Small subunit of ribosome encounters the (3) Mutation at faster rate
mRNA (4) Presence of methyl uracil
(2) Aminoacylation of tRNA occurs 171. If E.coli with N15 – N15 DNA is allowed to grow in
(3) Amino acid activation occurs normal culture medium for 80 minutes then what
will be the proportion of hybrid and light density
(4) Charged tRNA sequentially binds to the
DNA molecules?
appropriate codon in mRNA
(1) 2 : 14 (2) 2 : 6
166. Flow of genetic information in Rous Sarcoma
Virus occurs from (3) 2 : 2 (4) 1 : 1
(1) DNA RNA Protein DNA 172. Pseudouridine is present in a type of RNA that
(1) Is working copy
(2) ssRNA DNA Protein
(2) Acts as intermediate between triplet code of
(3) RNA !"# mRNA Protein mRNA and amino acid sequence
(3) Possesses UTR
(4) dsRNA !"# mRNA Protein (4) Is most stable
173. Which of the following statement for eubacteria is 179. During DNA replication, primers are removed by
correct? !!!!!"!!!!! and the gaps are filled by !!!!"!!!!! .
(1) Transcription occurs inside the nucleus
A B
(2) Control of the rate of transcriptional initiation
(1) DNA polymerase-I DNA polymerase-I
is the predominant site for control of gene
expression (2) DNA polymerase-I DNA polymerase-III
(3) mRNA is generally monocistronic (3) Primase DNA polymerase-III
(4) Splicing, capping and polyadenylation are (4) DNA polymerase-I Ligase
required after transcription 180. Consider the following statements w.r.t human
174. The unequivocal proof that DNA is the genetic genome project and select the wrong choice
material came from the experiment with the use (1) Scientists have identified about 1.4 million
of locations where SNPs occur
(1) E.coli, heavy nitrogen
(2) The human genome contains 3164.7 billion
(2) P32, S35, R-type bacteria nucleotide bases
(3) T2, E.coli (3) The total number of genes is estimated at
(4) Diplococcus 30,000
175. Enzyme used for the synthesis of RNA copolymer (4) Less then 2 percent of the genome codes for
and homopolymer sequences during deciphering proteins
of genetic code is 181. Which of the following step is incorrect w.r.t DNA
(1) DNA dependent RNA polymerase fingerprinting?
(2) DNA dependent DNA polymerase (1) Separation of DNA fragments by
electrophoresis
(3) RNA dependent DNA polymerase
(4) DNA independent RNA polymerase (2) Isolation of DNA
176. A new aminoacyl tRNA complex reaches the A- (3) Hybridisation using labelled VNTR probe
site of ribosome and forms complex with the (4) Detection of hybridised DNA fragments by
codon, this requires ______ in prokaryotes. ultracentrifugation
(1) Energy dependent EF-Tu and EF-Ts 182. The lac operon consists of
(2) GTP dependent IF2 (1) One regulatory gene and one structural gene
(3) Energy independent IF3 (2) Two regulatory genes and three structural
(4) Energy dependent eEF1 genes
177. All given represents sites of regulation of gene (3) Three structural genes and one regulator
expression where the predominant site in gene
prokaryotes is (4) One structural gene and three regulatory
(1) Transcriptional level genes
(2) mRNA transport level 183. During translation (protein synthesis), the enzyme
that catalyses peptide bonding is located in the
(4) Translational level (1) Central part of the tRNA
178. Which of the following is not correct w.r.t salient (2) Larger subunit of the ribosome
features of the double helix structure of DNA? (3) Smaller subunit of the ribosome
(1) The plane of one base pair stacks over the (4) 5 end of the mRNA
other
184. Which of the following mutation forms the genetic
(2) The backbone is constituted by sugar- basis of proof that codon is a triplet and it is read
phosphate and the bases project outside in a contagious manner?
(3) The two chains have anti-parallel polarity (1) Frameshift (2) Nonsense
(4) The pitch of the helix is 3.4 nm (3) Transition (4) Transversion
185. Which of the following human genes has the 190. Unwinding of DNA creates tension which is
longest stretch of DNA with 2.4 million bases? released by enzyme
(1) Histone gene (1) Pyrophosphatase (2) Primase
(2) Insuline gene (3) Topoisomerase (4) Helicase
(3) ADA gene 191. Which of the following structures is present in
(4) Dystrophin gene core particle of nucleosome?
186. Consider the following organisms (1) Linker DNA
a. Arabidopsis (2) H1 histone protein
b. Caenorhabditis (3) 80 bp of DNA
c. Drosophila (4) Octamer of histone protein
d. Ophioglossum 192. Severo Ochoa Enzyme is involved in
In which of the above are complete genome (1) Deoxyribonucleotide polymerisation
sequencing was also completed with the
(2) Amino acid synthesis
completion of HGP?
(3) Primer dependent DNA synthesis
(1) a, b & d (2) b, c & d
(4) Template independent RNA synthesis
(3) a, b, & c (4) a, c & d
193. Catalytic property of RNA is shown by all of the
187. Cap region of mRNA has nucleotides which are
complementary to following, except
(1) 3 end of 28S rRNA (2) 5 end of 28S rRNA (1) snRNA (2) hnRNA
(3) 3 end of 18S rRNA (4) 5 end of 18S rRNA (3) Ribonuclease-P (4) Peptidyl transferase
188. Consider the given diagram of tRNA and select 194. What will be the number of N-glycosidic
the right choice w.r.t. amino acid linkage [A], phosphodiester linkage [B] and
phosphate molecules [C] in a DNA molecule of
! " bacteriophage lambda?
"#$%
(1) A – 48502, B – 48501, C – 48502
(2) A – 5386, B – 5385, C – 5385
(3) A – 97004, B – 97002, C – 97004
(4) A – 48502, B – 97002, C – 48502
195. Stability of the DNA helical structure is conferred
% & & %'"()*+*' ! % & %'"()*+*' by
! -- %!- (1) Stacking of one base pair over the other in
&*+*' ,#$%
. / addition to H-bonds
A B (2) N-glycosidic bond between nitrogen base and
(1) Tryp Met sugar
(2) Pro Tyr (3) Presence of 2 – OH group at every
(3) Ser Arg nucleotide
(4) Leu Tyr (4) More than one option is correct

189. Which organism was utilised by Taylor et.al. to 196. After the completion in which mode of replication,
prove semi-conservative replication at each DNA molecule would have one parental and
chromosomal level? one newly synthesised strand?
(1) Ophioglossum (1) Conservative mode
(2) Lathyrus odoratus (2) Disruptive mode
(3) Vicia faba (3) Dispersive mode
(4) E. coli (4) Semi-conservative mode
197. Which one of the statement is incorrect for 202. A. Histones are organised to form a unit of eight
transcription? molecules called _______.
(1) The principle of complementarity governs this B. ______ constitute the repeating unit of a
process structure in nucleus called chromatin.
(2) Adenosine does not form base pair with
C. The chromatin that is more densely packed
thymine
and stains dark is called _______.
(3) Total DNA of an organism is transcribed into
RNA copy Fill-up the blanks with correct answers
(4) The DNA - dependent RNA polymerase A B C

catalyse the polymerisation on the strand that (1) Nucleosome Chromosome Euchromatin
has the polarity 3 5
(2) Histone octamer Nucleosome eterochromatin
198. Select correct match w.r.t. genetic codes.
Column I Column II (3) Histone octamer Nucleoid Euchromatin
a. Codon with dual function (i) GUG (4) Nucleosome Nucleoid eterochromatin
b. Non-degenerate codon (ii) UGG 203. Select the correct statements from the following
c. Ambiguous codon (iii) AUG regarding transcription.
d. Stop codons (iv) UAA A. In transcription only a segments of DNA and

only one of the strands is copied into RNA.
(1) a(iii), b(ii), c(i), d(iv) (2) a(ii), b(iii), c(i), d(iv)
(3) a(i), b(ii), c(iv), d(iii) (4) a(iv), b(i), c(iii), d(ii) B. Terminator is located at upstream of the
structural gene.
199. Which one of the following is incorrectly
matched? C. Intervening sequences do appear in
(1) Ribozyme – 23s rRNA processed RNA.
(2) Lac a – Permease D. In bacteria translation can begin much before

the mRNA is fully transcribed.
(3) ESTs – Exons
(4) Chromosome 1 – 2968 genes (1) A & D (2) B & C
200. Given diagram is the representation of a certain (3) A & C (4) B & D
event or stage of protein synthesis, identify this 204. How many amino acids can be translated from
stage
the given sequence of nucleotides in mRNA if 6th
nucleotide undergoes deletion?
AUG UGC ACU AUA GCG UAA
(1) Two (2) One
(3) Four (4) Three
(1) Termination of translation process in bacteria 205. Which of the following is not a salient feature of
(2) Termination of transcription process in HGP?
eukaryotes
(1) More than two percent of genome codes for
(3) Termination of transcription process in bacteria proteins
(4) Termination of translation process in
(2) The average gene consists of 3000 bases
eukaryotes
201. Negatively charged DNA is wrapped around the (3) Chromosome 1 has most genes i.e., 2968
positively charged histone octamer in (4) 1.4 million locations has SNPs
(1) QB bacteriophage 206. How many phosphodiester bonds are present in
(2) Drosophila plasmid DNA having 1000 bp?
(3) Pneumococcus (1) 1000 (2) 2000
(4) Escherichia coli (3) 999 (4) 1998
207. 3 -ATGCTA-5 ... (A) 213. Percentage amount of non-coding DNA sequence
5 -TACGAT-3 ... (B) is
In a hypothetical sequence of above given dsDNA (1) 24% (2) 20%

if promotor is present at 5 of (A) strand and this (3) 45% (4) 40%
DNA is involved in transcription, then what will be 214. Which of the following vectors have been
the correct sequence of mRNA? exploited extensively in mapping the large
(1) 5 -UACGAU-3 (2) 5 -AUCGUA-3 genomes like Human Genome Project?
(3) 3 -AUCGUA-5 (4) 3 -UAGCAU-5 (1) Phagemid (2) YACs
208. In bacteria, DNA in nucleoid is organised in large (3) BACs (4) Both (2) & (3)
loops held by
(1) Acidic proteins
SECTION - B
(2) Histone proteins Assertion - Reason Type Questions
(3) Positive charged proteins In the following questions, a statement of assertion

(4) Negative charged proteins
209. Mark the mis-matched pair
(1) lac operon – Negative as well as positive assertion, then mark (1).
control
(2) rRNAs – Play structural as well as reason is not the correct explanation of the
catalytic role during translation assertion, then mark (2).
(3) Nucleosome – Feature of all living organisms (3) If Assertion is true statement but Reason is
(4) VNTR – Mini-satellite false, then mark (3).
210. Read the following statements : (4) If both Assertion and Reason are false
(a) Replication does not initiate randomly at any
place in DNA. 1. A : Stop signals UAA and UAG do not specify
any amino acids in all organisms.
(b) DNA polymerase on their own initiate DNA
replication. R : The flexibility with regard to the third base in
a codon causes non-functional nature.
(c) DNA replication if not coordinated with cell
division cycle,it may result in polyploidy. 2. A : DNA probes contain repeated sequences of
bases complementary to those on VNTRs.
(d) Presence of exons is reminiscent of antiquity
and the process of splicing represents the R : DNA probes bind to the repeat sequences of
dominance of RNA-world. VNTRs on nylon membrane.
Find out the option (1-4) with correct statements. 3. A : Tryptophan operon has five structural genes.
(1) (a), (b) & (c) (2) (a) & (c) R : Feed back mechanism explains the role of
tryptophan in regulation.
(3) (b) & (c) (4) (a), (b) & (d)
4. A : Repititive sequences present in introns helps
211. Which of these may not be a characteristic of a
the DNA fingerprinting methodology.
suitable genetic material?
R : Each organism has a specific length,
(1) Chemically and structurally be stable
composition and number of these repeats.
(2) Can express itself in the form of Mendelian
5. A : Priming is essential to initiate the
character
polymerisation of nucleotides on 5 end of
(3) Mutation at faster rate only parent DNA.
(4) Capable of producing its replica R : Primer provides stability to single strand of
212. Largest human gene is located on _________ forked double strand DNA.
chromosome and having _______. 6. A : UGA is an ambiguous codon.
(1) X, 2400 bp (2) Y, 2400 × 103 bp R : UGA is a termination codon but it also codes
(3) X, 2.4 million bases (4) 12, 24 × 105 bp for tryptophan in yeast mitochondria.
7. A : All DNA polymerases do not have the 13. A : One of the two strands of DNA is called sense
property of 5 3 exonuclease. strand and other is called antisense strand.
R : It is the sole property of Kornberg enzyme. R : Coding strand of DNA codes for RNA.
8. A : ‘Genetic code has three nucleotides’ is a very
14. A : In DNA finger printing, hybridization is done
bold proposition given by Gamow.
with molecular probe.
R : This permutation combination will generate
more codons than required for coding amino R : Molecular probe is small DNA segment
acids. synthesized in laboratory with known
9. A : DNA polymerase cannot initiate the process sequence that recognise complementary
of DNA replication. sequence in RNA.
R : DNA replication can initiate randomly on DNA. 15. A : SNP pronounced “snips” are common in
10. A : The i gene associated with lac operon of human genome.
E.coli is monocistronic. R : It is minute variations that occurs at a
R : Polycistronic genes are more common in frequency of one in every 300 bases.
prokaryotes. 16. A : AUG performs dual function in a genetic
11. A : Transcription is immediately followed by code.
translation in prokaryotes.
R : It is an initiation codon and codes for
R : mRNA does not require any elaborate
methionine.
processing to become functional/mature.
17. A : Product of lac z gene is primarily responsible
12. A : A repressor of the lac-operon is synthesized
all the time from the i-gene. for the hydrolysis of a polysaccharide.
R : It is a monomeric protein. R : Gene i constitutively metabolises glucose.
!" !" !
Chapter 4
Anatomy of Flowering Plants
6. Mark the correct one w.r.t. bundle sheath in a

SECTION - A dicot leaf
Objective Type Questions (1) Sclerenchymatous
1. A plant tissue with maximum refractive index
(2) Collenchymatous
(1) Is rigid with lignified wall
(3) Parenchymatous
(2) Is living with pectin deposition in cell wall
(4) Lignified
(3) Possess large intercellular space that helps in
buoyancy 7. The spring wood present in an annual ring
(4) Is fundamental tissue with chlorophyll (1) Is dark coloured
2. Select incorrect statement w.r.t. anatomical
(2) Has high density than autumn wood
features of monocot root.
(1) Pericycle produces lateral roots and part of (3) Has abundant fibres
vascular cambium (4) Has low density than autumn wood
(2) Exodermis is present in older roots 8. Bulliform cells are associated with
(3) Conjunctive parenchyma does not produce
(1) Epidermis of dorsiventral leaves
cambium
(4) Well developed pith is present (2) Adaxial epidermis of isobilateral leaves
3. In the life cycle of a plant, the secondary tissues (3) Abaxial epidermis of monocot leaves
are made by
(4) Mesophylls of dicot leaves
(1) Intercalary meristem and vascular cambium
9. Which of the following is correct w.r.t. vascular
(2) Apical meristem and cork cambium bundles of monocot stem?
(3) Cork-cambium and vascular cambium (1) Presence of collenchymatous or
(4) Primary meristems and interfascicular parenchymatous bundle sheath
cambium
(2) Presence of phloem parenchyma
4. Casparian strips are present in the endodermis of
(3) Vessels are arranged in V-shaped manner
(1) Monocot stem
(4) Schizogenous water cavity is present
(2) Dicot root
10. In monocotyledonous stem
(3) Dicot stem
(1) Hypodermis is parenchymatous
(2) Each vascular bundle is surrounded by
5. Stem of Zea mays plant lacks
collenchymatous bundle sheath
(1) Sieve tube
(3) Peripheral vascular bundles are generally
(2) Phloem parenchyma larger than centrally located ones
(3) Phloem fibres (4) Water containing cavities are present within
(4) Companion cell the vascular bundles
188 Anatomy of Flowering Plants Last Leap for NEET (Part-I)
11. Primary meristem 18. Which of the following is secondary in origin?
(1) Originates from permanent tissue (1) Phellogen
(2) Possess non-vacuolated cells (2) Interfascicular cambium
(3) Develops from secondary permanent tissue (3) Wound meristem
(4) Represents primordial meristem
12. A tree can be killed by removing its bark, as this
19. Meristems are not characterised by
also removes the _______.
(1) Phelloderm only (2) Phellem only (1) High surface area / volume ratio
(3) Primary xylem (4) Secondary phloem (2) Vacuolated cytoplasm

13. Which one is not true w.r.t. phloem? (3) Presence of proplastids
(1) Companion cell and Sieve tube are (4) Cellulosic cell wall
ontogenetically similar in angiosperms
20. Dicot roots do not have cambium in vascular
(2) Included phloem is produced from vascular bundles, but during secondary growth cambium is
cambium derived from
(3) Primary phloem is obliterated during primary (1) Pericycle cells only
growth
(2) Pericycle and conjunctive tissue
(4) Phloem lies always external to xylem
(3) Conjuctive tissue only
14. Which of the following tissue is not related to
shoot apex? (4) Pericycle and cortex
(1) Dermatogen (2) Periblem 21. Which is not a feature of monocot stem?
(3) Plerome (4) Calyptrogen (1) Schizolysigenous water cavity
15. Choose odd w.r.t. collenchyma (2) Endarch xylem
(1) Living mechanical tissue (3) Undifferentiated ground tissue
(2) Intercellular space is absent in angular type
(4) Bulliform cells
(3) Thickening of wall is due to deposition of
lignin 22. During secondary growth in dicot root, first
vascular cambium strip is formed from
(4) Found in hypodermis of dicot stem
(1) Pericycle lying above primary phloem
16. Select incorrect statements from the given below
(2) Pericycle lying above protoxylem
(i) Endodermis with casparian strips are found in
dicot stem (3) Conjunctive tissue lying below primary phloem
(ii) Endodermis is a part of stele (4) Conjunctive tissue lying above primary
(iii) Amphivasal vascular bundles are found in phloem
some monocots 23. Select incorrect statement w.r.t. the anatomy of
(iv) Bulliform cells are found in upper epidermis in monocot stem
isobilateral leaf
(1) Parenchymatous ground tissue is extended
(1) (i) and (ii) from hypodermis to centre
(2) (ii) and (iii) (2) Hypodermis is made of thick walled living
(3) (i), (ii) and (iii) mechanical tissue
(4) Only (iv) (3) Vascular bundles are conjoint, collateral and
17. Periderm includes closed with endarch xylem
(1) Only cork cambium (4) Pith is absent
(2) Cork cambium and cork only 24. Plant tissue as air tight dam is
(3) Cork and secondary cortex (1) Epidermis (2) Hypodermis
(4) Cork, Cork cambium and secondary cortex (3) Endodermis (4) Pericycle
Last Leap for NEET (Part-I) Anatomy of Flowering Plants 189
25. Whole cork cambium originates from 33. The korper - kappe theory was proposed by
(1) Endodermis in dicot stem ______ for ______
(2) Hypodermis in monocot stem (1) Schuepp, root apex organisation
(3) Pericycle in dicot root (2) Clowes, quiescent centre
(4) More than one option is correct (3) Hanstein, histogen region
26. Find the odd one out w.r.t. vesselless families of (4) Hofmeister, shoot apex organisation
angiosperms
34. The conjunctive parenchyma cells are lying
(1) Trapaceae (2) Tetracentraceae
(3) Trochodendraceae (4) Winteraceae (1) Just below each phloem strand
27. Periderm includes (2) Just below each xylem strand
(1) Phellem, phellogen and secondary xylem (3) Between endodermis and pericycle
(2) Cork, bark and vascular cambium (4) Between phelloderm and periderm
(3) Phellogen, cork and secondary cortex 35. The cells of quiescent centre have
(4) Medulla, phellogen and phelloderm
(1) High number of mitochondria and very small
28. Soft wood differs from hard wood in having dictyosomes
(1) High content of tracheids (2) Fewer mitochondria and very small
(2) Low content of vessels dictyosomes
(3) High content of vessels (3) Low RNA and high DNA
(4) Low content of tracheids
(4) High DNA and high RNA
29. Read the following statements
36. Intercalary meristems are intercalated in between
(a) Epidermis is formed from dermatogen the permanent tissues. They may be present
(b) Periblem forms endodermis and pericycle either at the node as in all except
(c) Vascular bundle, pericycle and pith are (1) Grasses (2) Bamboos
formed from plerome
(3) Mints (4) Pinus
Find correct statements for histogen theory
37. In parenchyma, all cells are isodiametric and
(1) All are correct
(2) Only (b) is correct (1) Thin-walled
(3) Both (a) and (c) are correct (2) Thick-walled

(4) Both (b) and (c) are correct (3) Lignified-walled
30. Conjoint, collateral and close vascular bundles are (4) Devoid of intercellular spaces
found in
38. The protoxylem vessels, generally have
(1) Roots of wheat (2) Stem of sunflower
(1) Scalariform and reticulate thickenings
(3) Leaf of gram (4) Stem of mango
31. Vascular bundles in dicot leaves are (2) Annular and spiral thickenings
(1) Conjoint, collateral and open (3) Spiral and pitted thickenings
(2) Radial, exarch and closed (4) No thickening
(3) Conjoint, bicollateral and open 39. The centrifugal xylem is the characteristics of
(4) Conjoint, collateral and closed
(1) Exarch condition (2) Endarch condition
32. Meristematic tissues are characterized by all
except (3) Mesarch condition (4) Polyarch condition
(1) The nucleus is bigger in size 40. The root apex of monocot differs from stem apex
in having
(2) Colourful plastids are present
(3) Ergastic substance is almost absent (1) Dermatogen (2) Calyptrogen
(4) Retention of power of division (3) Periblem (4) Histogen
41. Branch of botany dealing with internal 48. Which of the following is incorrect w.r.t.
organisation of plants is called meristematic tissue?
(1) Plant histology (1) Prominent nucleus with dense cytoplasm
(2) Plant anatomy (2) Isodiametric with intercellular spaces
(3) Plant cytology (3) Metabolically active with high
karyocytoplasmic ratio
(4) Absence of ergastic substances
42. Which one of the following shows heteroxylous
wood? 49. Which type of thickenings are generally present in
the first formed tracheids?
(1) Trochodendron (2) Tetracentron
(1) Spiral and sclariform (2) Annular and pitted
(3) Taxus (4) Shorea
(3) Pitted and reticulate (4) Spiral and annular
43. In which character an isobilateral leaf differs from
the dorsiventral leaf? 50. Anatomically the wood of angiosperms is different
from that of gymnosperms in the
(1) Scattered vascular bundles
(1) Absence of secondary xylem as wood
(2) Undifferentiated mesophylls
(2) Presence of secondary phloem for food
(3) Absence of stomata with guard cells
conduction
(4) Conjoint, collateral and closed vascular
(3) Presence of companion cells controlling
bundle
osmotic balance of ontogenically related cells
44. The large thin walled epidermal cells called motor
(4) Absence of partly primary and partly
cells are present in
secondary origin of cambium
(1) Amphistomatic leaf (2) Hypostomatic leaf
51. Secondary growth in dicot roots is not
(3) Astomatic leaf (4) Epistomatic leaf characterised by
45. The age of trees growing in deciduous forest can (1) Partly primary and partly secondary origin of
be determined with the help of counting annual cambium
rings, this area of science is known as
(2) Purely secondary origin of cambium
(1) Dendrology
(3) Wavy ring of cambium
(2) Dendrochronology
(4) Dedifferentiation of conjuctive parenchyma
(3) Dendrography cells
(4) Plant gerontology 52. A xerophytic plant having multilayered upper
46. Bladder like in-growth in duramen is exhibited by epidermis of leaf and sunken stomata is
(1) Thylosoids (2) Tylosoids (1) Capparis (2) Nerium
(3) Tyloses (4) Callose pad (3) Casuarina (4) Agropyron
47. Which of the following is not the characteristic of 53. Tissue which provides mechanical strength and
cells which are formed as a result of tangential flexibility to young dicot stem is present in
and periclinal divisions of phellogen cells towards (1) Pith (2) Endodermis
the outer face?
(3) Hypodermis (4) Cortex
(1) Thermal insulation quality
54. The ground tissue system is constituted by all of
(2) Light weight and inflammable these, except
(3) Impervious to water (1) Medullary rays (2) Pericycle
(4) Having high amount of suberin (3) Mesophyll (4) Xylem
55. In dicot root, lateral roots and vascular cambium 60. Identify the incorrect match w.r.t. wood
arise from characters given in A, B, C column
(1) Cortex & endodermis respectively ! " #

/()6157-8
(2) Cortex & pericycle respectively !"# '()*+ 34)A76 GA.1
-95:+*()+
,--. ,--. B(FA0A1<
1*1;170<
(3) Cortex & conjunctive tissue respectively
!$# /(01 =1,5:+*()+ EC0C;7 H())-,
,--. 1*1;170< ,--. B(FA0A1<
(4) Pericycle & conjunctive tissue respectively
=A**1.5,A0D
!%# 21()0 >()?5@)-,7 >1(. )1<A7<5(7.5
56. Plant tissue enriched with starch granules in dicot
,--. A75B-*-C) 1*1;170< 6C;<
stem is
I-7.CB0<
!&# 3(45 /A6D05A7 /AFA76
(1) Present outside pericycle ,(01)5(7.
,--. B-*-C) 1*1;170<
;A71)(*<
(2) Collenchymatous
61. Which of the following is not a redifferentiated
(3) Parenchymatous with intercellular spaces structure?
(4) Pecto-cellulosic thick walled (1) Phellogen
57. Conjoint, collateral, closed vascular bundles (2) Duramen

without phloem parenchyma are found in plants (3) Phelloderm
which have (4) More than one option is correct
(1) Differentiated ground tissue in stem 62. In a leaf, oval cells with large intercellular spaces
and radially arranged columnar cells without
(2) Dedifferentiated pericyclic structure in mature intercellular spaces are placed respectively
root towards
(3) Sclerenchymatous hypodermis in stem (1) Adaxial and abaxial epidermis

(2) Abaxial and adaxial epidermis
(4) Developed pith in stem
(3) Abaxial and lower epidermis
58. The tissue belonging to bark but not to periderm is
(4) Lower and abaxial epidermis
(1) Vascular cambium 63. Grittiness of fruits is because of
(2) Secondary phloem (1) Brachysclereids (2) Osteosclereids
(3) Phellem (3) Asterosclereids (4) Macrosclereids

(4) Secondary cortex
Column I Column II
59. Which of the following is correct w.r.t. lenticels?
a. Aerenchyma (i) Pericycle
a. Phellogen forms parenchymatous cells on b. Bordered pits (ii) Sieve tube
outer side
c. Perivascular fibres (iii) Fundamental tissue
b. It is a lens shaped opening d. Callose plug (iv) Tracheids
c. Helps in exchange of gases (1) a(iii), b(iv), c(i), d(ii) (2) a(iii), b(iv), c(ii), d(i)
(3) a(i), b(iv), c(ii), d(iii) (4) a(iv), b(ii), c(iii), d(i)
d. Present mostly in woody trees
65. Select the incorrect statement w.r.t. late wood
(1) a & b correct
(1) It forms a narrow strip in annual rings
(2) c & d correct (2) Has smaller and narrower vessels
(3) b, c & d correct (3) Darker in colour
(4) All are correct (4) Fibres are less
66. Which of the following is not the component of 73. Dimorphic mesophyll cells are not differentiated in
secondary phloem? the leaf of
(1) Protophloem (1) Pea (2) China rose
(2) Bast fibres (3) Sunflower (4) Banana
(3) Companion cells
74. Secondary permanent tissue is produced from
(4) Phloem parenchyma precursor cells or tissues after
67. Monocot root differs from dicot root in (1) Differentiation (2) Dedifferentiation
(1) Having differentiated ground tissue
(3) Redifferentiation (4) Accretion
(2) Presence of centripetal xylem
75. Which one of the following are elongated single-
(3) Pericyclic origin of lateral roots
celled water conducting dead structures with
(4) Presence of large and well developed pith bordered pits?
68. The bark being used as substitute of paper is (1) Tracheids
_______ and obtained from ________
(2) Vessels
(1) Scaly bark, Acacia (2) Ring bark, Psidium
(3) Sclerenchyma fibres
(3) Ring bark, Betula (4) Scaly bark, Betula
69. Protoxylem lies towards periphery and metaxylem (4) Sclereids
lies towards the centre. Such arrangement of 76. Lenticels are present in
________ xylem is present in ________ .
(1) Outer primary protective tissue
(1) Secondary, root
(2) Outer layer of secondary protective tissue
(2) Primary, stem
(3) Secondary, stem (3) Middle layer of secondary protective tissue
(4) Primary, root (4) Inner layer of secondary protective tissue

70. Internal structure of monocot stem is different 77. Cells having cellulose, hemicellulose and pectin
from the dicot stem in the deposits on wall and shows its presence
(1) Absence of conjoint vascular bundles commonly in petiole of leaf and growing green
stems belong to
(2) Presence of collenchymatous hypodermis
(1) Sclerenchyma
(3) Presence of undifferentiated ground tissue
(4) Absence of xylem parenchyma (2) Collenchyma
71. A complete and continuous wavy cambium ring in (3) Aerenchyma

dicot root is formed due to the activity of
(4) Parenchyma
(1) Conjunctive tissue only
78. Select the group of tissues which are formed by
(2) Conjunctive tissue and pericycle de-differentiation in a dicotyledonous plant
(3) Pericycle only
(1) Secondary xylem, cork cambium and root
(4) Pericycle and endodermis cambium
72. Select the incorrect statement w.r.t. monocot root (2) Interfascicular cambium, intrafascicular
(1) The xylem bundles are usually more than six cambium and cork cambium
(2) Pith is very large (3) Root cambium, cork cambium and inter
(3) Secondary growth does not take place fascicular cambium
(4) Endodermis possess thick walled passage (4) Cork cambium, vascular cambium ring of
cells stem and phellem
79. Elongated or tube like cells with thick and lignified 85. The most abundant and common tissue in plants
walls and tapering ends is
(1) Has non-vacuolated cytoplasm
(1) Tracheids (2) Vessel
(2) Is living and has cellulosic wall
(3) Sieve tube (4) Collenchyma
80. As compared to monocot root, the dicot root (3) Stores ergastic substances always
has/shows (4) Cannot take part in photosynthesis
(1) Large and well developed pith 86. Secondary meristems are found in
(2) Primary growth only
(1) All angiosperms
(3) Sclerenchymatous pericycle
(2) Gymnosperms and all monocots
(4) Fewer xylem bundles
81. Which of the following wood is darker and has (3) Dicots and gymnosperms
high density? (4) All spermatophytes
(1) Spring wood 87. Monocot stems do not have
(2) Late wood
(1) Protophloem
(3) Early wood
(2) Phloem parenchyma
(3) Companion cell in phloem
82. Choose the odd one out w.r.t. stem hairs called
trichomes (4) Sieve tube and metaphloem
(1) Can be soft or stiff 88. Which of these is responsible for lateral
(2) Usually multicellular translocation in plants?
(3) May be secretory (1) Medullary rays
(4) Always unbranched
(2) Vessels
83. Stems of Zea mays and sunflower are similar to
each other in having (3) Companion cells
(1) Phloem parenchyma (4) Xylem parenchyma

(2) Endarch primary xylem 89. Choose the correct option w.r.t. sclereids
(3) Conspicuous undifferentiated ground tissue (1) Physiologically active
(4) Ring arrangement of vascular bundles (2) Pits are present
84. Which of the given figure represents internal
(3) Derived from meristems directly
structural details of a monocot root?
(4) Little amount of protoplasm is present
90. Which is not a feature of barley stem?
(1) Presence of collateral, conjoint vascular
bundles
(1) (2)
(2) Schizogenous water cavity is present
(3) Presence of most advanced type of stele
(4) Undifferentiated ground tissue
91. Isobilateral leaf is characterized by all the given
characteristics, except
(1) Vascular bundles are always closed
(3) (4) (2) Xylem is towards adaxial surface of leaf
(3) Mesophyll cells are not differentiated
(4) Parenchymatous extensions of bundle sheath
92. Collenchyma is characterised by 100. Which is not a feature of heart wood?
(1) Absence of protoplast at maturity (1) Central in position
(2) Supporting young stem and leaf petiole (2) Presence of tracheal plugs
(3) Lignocellulosic thickenings on secondary walls (3) Actively conducting
(4) Common presence of intercellular spaces (4) Dead with deposition of extractives
93. Epidermal hairs on stems known as trichomes 101. Cambium ring in dicot root is formed from
(1) May sometimes be secretory in function (1) All cells of pericycle and conjunctive tissue
(2) Have vascular supply (2) Pericycle lying opposite to protoxylem and
(3) May be soft or stiff but unbranched always conjunctive tissue
(4) Are endogenous in origin like lateral roots (3) Cells of medullary parenchyma
94. Steler tissue system in shoot is derived from (4) Cortical cells and conjunctive tissue
(1) Dermatogen (2) Periblem 102. In which of the following tissue the cells are much
(3) Plerome (4) Tunica thickened at the corners due to a deposition of
cellulose, hemicellulose and pectin?
95. Select the incorrect statement w.r.t. bast fibres
(1) Parenchyma (2) Collenchyma
(a) Generally absent in primary phloem
(3) Sclerenchyma (4) Prosenchyma
(b) Elongated, branched with blunt ends
103. Mark the incorrect option w.r.t. internal structure of
(c) Parenchymatous in nature
monocot stem
(d) Becomes dead at maturity
(1) Absence of pith
(1) a & d (2) b & d
(2) Parenchymatous hypodermis
(3) b & c (4) a & b
(3) Endodermis is absent
96. Monocot root is anatomically similar to the dicot
root in (4) Scattered vascular bundles
(1) Possessing radial vascular bundles with 104. Mark a, b, c and d
exarch xylem
(2) Presence of well developed central pith
#
(3) Having diarch to hexarch vascular bundles
(4) Absence of passage cells $
97. Phellogen is a kind of secondary meristem
(1) Cutting phelloderm outside and phellem inside "
(2) Usually developing in the cortex region of

dicot stem
(3) Forming non-suberised cells outside !
(4) Made of narrow, thick walled, suberised cells (1) Metaxylem, protoxylem, cortex, trichome
98. As a tree grows older, thickness of _______ (2) Endodermis, cortex, protoxylem, root hair
increases
(3) Endodermis, cortex, metaxylem, root hair
(1) Duramen (2) Alburnum
(4) Pericycle, cortex, metaxylem, trichome
(3) Sap wood (4) Early wood
105. Which of the following character is concerned with
99. Bark refers to all the tissues the meristematic cells?
(1) External to vascular cambium (1) Few ribosomes
(2) External to cork cambium (2) Small nucleus and dense cytoplasm
(3) Formed earlier in the season (3) High metabolic activity
(4) Impregnated with suberin (4) Loosely arranged cells
106. Sieve tube elements are long, tube-like structures, 112. Stem of barley differs from stem of sunflower in
arranged longitudinally and are associated with presence of
the companion cells. A mature sieve element
(1) Conjoint, collateral bundles
(1) Has a small vacuole
(2) Endarch, eustelic bundles
(2) Lacks nucleus and cytoplasm
(3) Scattered, closed bundles
(3) Possesses a large vacuole and small nucleus
(4) Well differentiated ground tissue
(4) Possesses a peripheral cytoplasm
113. Mark the correct statement (w.r.t. lateral meristem)
107. Which of the following statement is concerned
with the anatomy of dicot root? (1) Secondary meristem producing primary
(1) Presence of small or inconspicuous medulla permanent tissues
(2) Absence of parenchymatous pericycle (2) Intercalary meristem producing secondary

permanent tissues
(3) Absence of suberin at the tangential as well
as radial walls of endodermal cells (3) Cylindrical meristem producing the secondary
(4) Presence of sclerenchymatous conjunctive tissues
tissue (4) Promeristem producing secondary permanent
108. During the secondary growth in dicot stem, the tissues
cambial ring becomes active and begins to cut off 114. Match the column I with column II
new cells both towards the inner and the outer
sides. The cells cut off Column I Column II
(1) Towards pith, mature into secondary phloem a. Xylem parenchyma (i) Absent in most of
(2) Towards periphery, mature into secondary the monocots
xylem b. Sclereids (ii) Long cylindrical
(3) Towards pericycle, mature into secondary tube-like structure
xylem as well as secondary phloem c. Phloem parenchyma (iii) Food and tannins
(4) Mature into secondary vascular tissues d. Vessel (iv) Fruit walls of nuts
109. Phellem as well as phelloderm both
(1) a(i), b(ii), c(iii), d(iv) (2) a(ii), b(iv), c(iii), d(i)
(1) Make up the phellogen
(3) a(iii), b(iv), c(i), d(ii) (4) a(iii), b(ii), c(i), d(iv)
(2) Are secondary permanent tissues
115. Which of the following occurs first during
(3) Are formed during steler secondary growth secondary growth in dicot root?
(4) Are made by vascular cambium (1) Primary meristem becomes active present
110. The part of grass consumed by a grazing animal below phloem
can be regenerated by the activity of
(2) Cambium strips are formed from conjunctive
(1) Lateral primary meristem tissue lying just below each phloem strand
(2) Lateral secondary meristem (3) Cambium strips develop from pericycle
(3) Intercalary meristem opposite to protoxylem
(4) Apical meristem (4) A wavy ring of cambium develops
111. Bark includes a variety of tissue types like 116. a. Annual rings are bands of secondary phloem
(1) Phellem, secondary xylem and secondary and medullary rays.
phloem b. Wood of Cycas has vessels.
(2) Periderm and all kinds of secondary tissues c. Conjoint vascular bundles are found in leaves
of sunflower and maize.
(3) Phellogen, secondary phloem, phellem and
secondary cortex Which of above statement(s) is/are correct?
(4) Phelloderm, secondary phloem and primary (1) a & b are correct (2) b & c are correct
xylem (3) Only a is correct (4) Only c is correct
117. Choose the correct statement 123. Select the odd one out w.r.t. tissues
(1) Annual rings are formed by the activity of cork (1) A group of cells having a common origin
cambium (2) They usually perform a common function
(2) Fibres are abundant in secondary xylem and (3) Complex tissues are made of more than one
protophloem type of cells
(3) Primary xylem does not show distinction into (4) They are not capable of division
protoxylem and metaxylem
124. Which of the following component of phloem is
(4) At certain regions, the cork cambium cuts off mainly responsible for storage of food material
parenchymatous cells on the outer side and other substances like resins, latex and
instead of phellem mucilage?
118. Mechanical support to the growing parts of the (1) Sieve tube
plant such as young stem and petiole of leaf is (2) Companion cell
provided by a living tissue called
(3) Bast fibres
(1) Collenchyma (2) Aerenchyma
(4) Phloem parenchyma
(3) Chlorenchyma (4) Sclerenchyma
125. Complimentary cells are characteristically present
119. Which of the following is correct statement for in
intercalary meristems?
(1) Tyloses (2) Lenticels
(1) They lie at tip of root apex (3) Hydathodes (4) Stomata
(2) They lie at base of stem always 126. Which of these is regarded as reserve meristem?
(3) They are short lived and consumed during (1) Promeristem
primary growth
(2) Quiescent centre
(4) They are long lived and cause increase in
(3) Calyptrogen
length
(4) Primary meristem
120. Girdling experiment cannot be performed in
sugarcane plant because 127. Instead of closed vascular bundles in dicot roots,
secondary growth occurs by the formation of
(1) Its stem is thin cambium ring which develops from
(2) Its vascular bundles are arranged in scattered (1) Conjunctive tissue and pericycle
manner
(2) Passage cell and pericycle
(3) Its stem surface is coated with wax
(3) Pericycle only
(4) Phloem is surrounded on all sides by xylem
(4) Conjunctive tissue and pith
121. Dicot root is different from monocot root in having
128. Find odd one out w.r.t. dedifferentiated meristems
(1) Fewer xylem bundles
(1) Interfascicular cambium in dicot stem
(2) Polyarch condition (2) Cambium ring in dicot root
(3) Large and well developed pith (3) Phellogen in dicot root
(4) Pericycle (4) Procambium in plants
122. During secondary growth in dicot root, first 129. Which one of the following tissues get gradually
vascular cambium strip is formed from crushed due to the continued formation and
(1) Conjunctive tissue lying above primary accumulation of secondary xylem?
phloem (1) Primary xylem
(2) Pericycle lying above protoxylem (2) Primary phloem and secondary xylem
(3) Pericycle lying above primary phloem (3) Pith and primary xylem
(4) Conjunctive tissue lying below primary phloem (4) Primary phloem and secondary phloem
130. Living mechanical tissue with thickening at the 135. When protoxylem lies towards the centre (pith)
cells corners possess deposition of and the metaxylem lies towards the periphery of
(1) Lignin the organ, the primary xylem is called
(2) Cellulose and pectin only (1) Endarch; present in stem
(3) Cellulose, hemicellulose and pectin (2) Endarch; present in roots
(4) Cellulose only (3) Exarch; present in stem
131. Which of the following is absent in monocot root? (4) Exarch; present in roots
(1) Phloem parenchyma 136. Mark the incorrect statement w.r.t. guard cells in
(2) Pith stomata
(3) Sieve tube (1) In grasses these are dumb-bell shaped
(4) Centripetal xylem (2) They possess chloroplasts
132. Which of the following statement for trichomes is (3) Regulate opening and closing of stomata
correct?
(4) Outer walls are thick and inner walls are thin
(1) Usually unicellular in dicots
(2) Epidermal hairs of stems and roots 137. Which of the following pair of characters (A & B)
(3) Always non-secretory is correct for the internal structure of monocot
(4) Help in preventing water loss due to stem?
transpiration (1) A – It has sclerenchymatous hypodermis
133. Which one of the following statement is incorrect? and sclerenchymatous bundle sheath
(1) Xylem fibres have obliterated central lumens B – It has large, conspicuous
(2) Phloem parenchyma is absent in monocot parenchymatous ground tissue
stem (2) A – Radial and tangential walls of the
(3) The first formed secondary phloem consists of endodermis have a deposition of waxy
protophloem material suberin
(4) Adaxially arranged mesophyll cells are B – Pith is large and well developed
elongated and vertically or parallely placed to
(3) A – Conjunctive tissue, lie between xylem
each other in dicots
and phloem
134. Identify the mismatched pair:
B – Vascular bundles are arranged in rings
Tissue Feature
(4) A – Phloem parenchyma is present, and
(1) Thick walled, elongated
water containing cavities are present
and pointed cells
outside the vascular bundles
present in hypodermis
of dicot stem B – Vascular bundles are surrounded by a
(2) Forms the major layer of thin walled bundle sheath cells
component within plant 138. In grasses, certain adaxial epidermal cells along
organs the veins modify themselves into large, empty and
(3) Commonly found in pulp colourless cells, known as
of fruits like guava, pear
(1) Mesophyll
and sapota
(2) Bundle sheath cells
(4) Provide mechanical
support to growing parts (3) Bulliform cells
of plant (4) Casparian strips
139. Arrange the following diagrams in correct order 143. Well developed pith is present in
according to the events occurring during
secondary growth in dicot stem. (1) Dicot stem, monocot root
(2) Monocot stem, dicot root
(3) Dicot root, dicot stem
a. b. (4) Monocot root, monocot stem
144. Which of the following function is performed by
pericycle of dicot root?
(1) Lateral root formation
c. d. (2) Lateral meristem formation

(3) Part of vascular cambium
(1) b, d, c, a (2) b, a, d, c (4) More than one option is correct
(3) d, a, b, c (4) d, b, a, c 145. Heart wood is differentiated from sap wood in
140. All are the features of heart wood, except being
A. Forms greater part of secondary xylem in old (1) Peripheral in position
trees.
(2) Resistant to the attack of microorganisms and
B. Light in colour. insects
C. Constitutes peripheral region of secondary
(3) Lighter in colour and lignified
xylem.
(4) Hard, durable and help in conduction of water
D. It is hard and durable due to deposition of
organic compounds, essential oils etc. 146. Exchange of gases between the outer
E. It is physiologically active and is comprised of atmosphere and the internal tissue of the woody
living elements. stem is possible by
F. Involved in the conduction of water and (1) Hydathodes
minerals from root to leaf.
(2) Lens shaped openings
(1) A, D & F (2) B, C, E & F
(3) Stomata
(3) D, E & F (4) B, D & E
(4) Gas vacuoles
141. During secondary growth in dicot root
(1) Vascular cambium arises completely from 147. The permanent tissue that forms the major
conjunctive parenchyma component within the organs
(2) Growth rings are distinct with spring wood (1) Provides mechanical support to the growing
alternating with autumn wood parts of plant.
(3) Phellogen arises from the epidermis (2) Is thin-walled and performs the function of
(4) Vascular cambium in complete and photosynthesis, storage and secretion
continuous but wavy ring
(3) Is made up of four different kinds of elements.
142. Which of the following are formed through
dedifferentiation? (4) Is usually dead without protoplast and has
thick lignified cell wall.
a. Secondary xylem
148. In leaves, the ground tissue consists of thin-walled
b. Cork cambium
chloroplast containing cells, called
c. Intrafascicular cambium
(1) Trichomes
d. Interfascicular cambium
(2) Conjuctive parenchyma
e. Intercalary meristem
(1) b & d (2) a & c (3) Cortex
(3) d & e (4) c & d (4) Mesophyll
149. Which of the following structures labelled as A, B, where + is present, – is absent, M is monocot, D
C and D represents complete and continuous is Dicot.
wavy ring of vascular cambium? 154. Which of the following statement is correct w.r.t.
lenticels?
! (1) Show exudation of droplets from bark surface

(2) Loss of solution having S as more negative
"
# (3) Presence of closely arranged
$ parenchymatous cells
(4) Restricted to tip of leaves
155. Vascular bundles of leaf are similar to
(1) A (2) B
(1) Vascular bundles of monocot stem
(3) C (4) D
150. Which among the following cannot be a feature of (2) Vascular bundles of dicot stem
given diagram? (3) Vascular bundles of monocot root
(4) Vascular bundles of dicot root
156. Grafting cannot be done in monocots because
(1) Vascular bundles are scattered
(2) Cambium is absent
(3) Parenchyma is least developed
(4) Vascular bundles are arranged in ring
157. Pericycle is related to all the given activities,
except
(1) It is a long cylindrical tube like structure (1) Origin of lateral roots in both dicots and
monocots
(2) Having lignified walls
(3) Having large central cavity (2) Origin of cork cambium in dicot root
(4) Having protoplasm (3) Origin of part of cambium in dicot root
151. Secondary medullary rays are (4) Origin of cork cambium in monocot root
(1) Narrow band of parenchyma 158. Mark the correct statements w.r.t. meristematic
(2) Arranged transversely tissues
(3) Dead and lignified A. The meristem that occurs at the tip of roots
(4) Formed by primary cambium and shoots contributes to the formation of the
primary plant body.
152. An annual ring consists of two kinds of wood that
appear as alternate concentric rings. The two B. The lateral meristems are responsible for
types of wood are formed at _______ time and by producing the secondary tissues.
the activity of _______. C. Some cells ‘left behind’ from lateral meristem,
(1) Same, Vascular cambium constitute the axillary bud.
(2) Different, Cork cambium D. The cells which are structurally and
(3) Same, Cork cambium functionally specialised and lose the ability to
(4) Different, Vascular cambium divide are called meristems.
153. Choose incorrect option. w.r.t simple permanent (1) A & C (2) A & B
tissue (3) B & C (4) C & D
!"##$%& +(*%32<>5( ?,..%32<>5( @2.%*%32<>5( 159. Trichome is related with all, except
'%()$*%
!"# +*,),-.(#) / / 0 (1) Unicellular elongation of epidermis in roots
',,1& 2(3&4%&/ 2(3&4%&/ 0 (2) Epidermal hairs on stem
!$# (##"5".()",3
!%# 622$**%32% 78&9: 7: 98&7 (3) Branched or unbranched and secretory
!&# ;(.. !<"3 !<"2=& !<"2=& (4) Prevent water loss due to transpiration
160. Clowes observed a central cup like region of 3. A : The secondary xylem is derived from
passive cells in the root tip of Zea mays which lies procambium during secondary growth.
in between R : The amount of secondary xylem is almost
(1) Root cap and active root meristem equal to the amount of secondary phloem.
(2) Protoderm and procambium 4. A : Amount of secondary xylem produced is more
than the secondary phloem in dicot stem.
(3) Cork cambium and quiescent centre
R : Cambium is generally more active on the
(4) Quiescent centre and calyptrogen
inner side than on the outer.
161. In monocot leaf, mesophyll tissue 5. A : Phellogen is secondary meristem that form
(1) Is differentiated into palisade and spongy cork on outer side and secondary cortex on
parenchyma inner side.
(2) Is not differentiated into palisade and spongy R : Phellogen is formed every year from
parenchyma hypodermis and pericycle in dicot root and
dicot stem respectively.
(3) Possesses some bulliform cells
6. A : Phelloderm and phellem are secondary
(4) Is made up of parenchyma cells which lack
permanent tissues.
chloroplasts
R : They are formed through redifferentiation.
SECTION - B 7. A : In dicot stem, the amount of heart wood
Assertion - Reason Type Questions remains constant throughout the life span of
plant.
(A) is followed by a statement of reason (R) R : The activity of cambium ring stops after
certain time.
reason is the correct explanation of the 8. A : Vascular cambium is completely secondary in
assertion, then mark (1) origin in dicot root.
(2) If both Assertion & Reason are true but the R : It is formed by redifferentiation.
assertion, then mark (2) 9. A : Meristematic zone of root has thin cells,
dense cytoplasm and vacuolated condition.
false, then mark (3) R : This zone shows maximum growth.
(4) If both Assertion and Reason are false 10. A : Spring wood is darker in colour and has lower
statements, then mark (4) density.
1. A : Pericycle is always made up of both R : Cambium is less active in spring season.
parenchyma and sclerenchyma. 11. A : Secondary growth is absent in monocots.
R : The pericycle is heterogenous as well as R : Monocots lack vascular cambium.
homogenous in monocot.
12. A : Rolling of leaves in monocots occurs during
2. A : Parenchymatous cushions like structure of summer.
ovary bear ovules.
R : Loss of water occurs from stomata during
R : The whole ovary matures into seeds. summer.
!"!"!
Chapter 5
Morphology of Flowering Plants

6. Solanum tuberosum and Allium cepa are similar
SECTION - A
in presence of
Objective Type Questions (1) Axile placentation
1. Phylloclade is different from phyllode in the (2) Epipetalous condition
presence of
(3) Versatile anther
(1) Axillary bud (2) Photosynthesis (4) Obliquely placed ovary
(3) Nodes and flowers (4) Limited growth 7. Find out the incorrect statement
2. In hypanthodium inflorescence (1) In Ficus, several achenal fruitlets are present
in each syconus fruit
(1) Involucre is cup shaped
(2) In pineapple and strawberry, the fruit is
(2) Three types of bisexual flowers are present formed by fusion of many flowers
(3) Flowers are not exposed (3) The schizocarpic fruits of maple are winged
(4) The receptacle does not become fleshy (4) In pomegranate, the edible part is succulent
testa
3. In pear, cashew-nut and strawberry plants
8. Which of the following set is correct?
(1) Simple dry fruits are present ABC !"#$%&'( @ 4,5,-#*67,(#*, @ !"#$%&''#(
7*28,-/696/&1:*,
(2) True fruits are present
(#*,67*28,-
(3) Aggregate fruits are present ADC !#)&$'*'( @ ;,-(&1#*6<&/,='#* @ 4'17*28,-
7*28,-6#136),-&)%,-#*6
(4) Edible part of fruit is fleshy thalamus #.$&12(2-)%&.
'1&/,='#*67*28,-/
4. Endosperm is not present in the mature seeds of AEC +,-$&.&**#/$,- @ >&.%#/&#*6."(, @ ;'*/&
,13&1:6&1
(1) Bean, gram (212.%#/&#*6."(,
(2) Pea, cucumber AFC 0")#1$%23&'( @ 4,5,-#*6<&/,='#* @ ?#1"#1
7*28,-/6&1/&3,6#
(3) Castor, bean 7*,/%"6-,.,)$#.*,
9. Match column I with column II
Column I Column II
5. Floral formula of mustard plant is
(Plant) (Type of fruit)
(1) ! "!"# #$%&%!&# $!'#%$ %! a. Banana (i) Sorosis
!
b. Almond (ii) Nut
(2) !!"! "#$ #!"$ $!"#
! c. Litchi (iii) Berry
(3) !!"# "!"# #" $!"# d. Jack fruit (iv) Drupe
!
(1) a(iii), b(ii), c(i), d(iv) (2) a(ii), b(i), c(iii), d(iv)
(4) !!"! "!"! #!"# (3) a(iii), b(i), c(ii), d(iv) (4) a(iii), b(iv), c(ii), d(i)
!
202 Morphology of Flowering Plants Last Leap for NEET (Part-I)
10. Find the odd one out w.r.t. inflorescence 18. Below labelled structures (A and B) in the diagram
represent modification of
(1) Atropa (2) Datura
(3) Mimosa (4) Begonia ! "
11. Didynamous and tetradynamous conditions are
respectively present in
(1) Brinjal, lily (2) Lily, China rose
(3) China rose, pea (4) Salvia and mustard
12. The seeds of Abrus precatorius are used as
weights by jewellers. It belongs to family
(1) Fabaceae (2) Solanaceae (1) A – Stem B – Leaf
(3) Asteraceae (4) Liliaceae (2) A – Bud B – Leaf
13. Find odd one out w.r.t. stilt roots (3) A – Leaf B – Bud
(1) Pandanus (2) Zea (4) A – Leaf B – Leaf
(3) Saccharum (4) Ficus 19. Which one of the statement is correct for
colchicine yielding family?
14. A flower is said to be asymmetric or irregular if it
cannot be divided in two similar halves by any (1) Dichlamydeous flower with epipetalous
vertical plane passing through the centre, as in condition
(1) Canna (2) Datura (2) Superior ovary with basal placentation
(3) Cassia (4) Brassica (3) Epiphyllous condition with axile placentation
15. Match column I with column II (4) Trimerous and epigynous flower
Column I Column II
Column I Column II
a. Siliqua (i) Fleshy testa
a. Conical root (i) Raphanus sativus
b. Pomegranate (ii) Marginal placenta
b. Fusiform root (ii) Mirabilis jalapa
c. Coconut (iii) Endosperm
c. Napiform root (iii) Daucus carota
d. Legume (iv) Parietal placenta
d. Tuberous root (iv) Beta vulgaris
(1) a(ii), b(i), c(iii), d(iv) (2) a(iv), b(i), c(iii), d(ii)
(1) a(i), b(ii), c(iii), d(iv) (2) a(iv), b(i), c(ii), d(iii)
(3) a(iii), b(i), c(ii), d(iv) (4) a(ii), b(iii), c(iv), d(i)
(3) a(iii), b(i), c(iv), d(ii) (4) a(iii), b(iv), c(i), d(ii)
16. In garden pea plant, stamens are united to form
_____. 21. Which is incorrect w.r.t. pneumatophore?
(1) One bundle (2) Two bundles (1) They are found in all aquatic plants
(3) Three bundles (4) Four bundles (2) They are also known as respiratory roots
17. Aestivation in which one margin of floral leaves (3) They bear small pores lenticels
overlaps regularly the margin of an adjacent floral (4) They have corky layer in lower part
leaf is
22. Choose incorrect pair
(1) Imbricate (1) Offset – Eichhornia
(2) Quincuncial (2) Corm – Allium cepa
(3) Contorted (3) Phylloclade – Opuntia
(4) Descending imbricate (4) Cladode – Ruscus aculeatus
Last Leap for NEET (Part-I) Morphology of Flowering Plants 203
23. Large pitcher in Nepenthes is modified 31. Umbel differs from corymb inflorescence in
(1) Stipule of leaf (2) Petiole of leaf (1) Having bisexual pedicellate flowers
(3) Leaf apex (4) Lamina (2) Presence of involucre at the base of flowers
24. Select incorrect statement w.r.t. racemose (3) Having indeterminate branched peduncle
inflorescence
(4) Absence of centripetal arrangement of flowers
(1) Main axis continues to grow
32. Drupes are also called as stone fruits because
(2) Peduncle bears flowers in basipetal /
centrifugal manner (1) The seeds are stone like
(3) Main axis is not terminated into flower (2) Endocarp is always hard and stony
(4) It is an indeterminate inflorescence (3) Pericarp is undifferentiated and sclerified
25. Match the column (4) The mesocarp is edible in most fruits
Column I Column II 33. Aerially modified structure of stem with several
a. Catkin (i) Ficus carica internodes for assimilatory function is
b. Spadix (ii) Morus alba (1) Phyllode (2) Phylloclade

c. Hypanthodium (iii) Ocimum sanctum (3) Cladode (4) Hypsophyll
d. Verticillaster (iv) Colocasia 34. Find correct match
(1) a(ii), b(iv), c(i), d(iii) (2) a(ii), b(iv), c(iii), d(i) Column-I Column-II
(3) a(ii), b(iii), c(i), d(iv) (4) a(ii), b(i), c(iv), d(iii) a. Spikelet (i) Involucre
26. In syngenesious androecium b. Capitulum (ii) Spathe
(1) Anthers are free while filaments are fused c. Hypanthodium (iii) Glume
(2) Anthers as well as filaments both are free d. Spadix (iv) Gall flower
(3) Stamens are fused by anthers while filaments (1) a(iii), b(i), c(iv), d(ii) (2) a(iii), b(i), c(ii), d(iv)
are free
(3) a(iv), b(iii), c(ii), d(i) (4) a(i), b(iii), c(iv), d(ii)
(4) Stamens are fused by both filaments as well
as anther 35. Find correct match with respect to edible parts of
fruit
27. Choose correct pair
Column-I Column-II
Placentation Example
a. Mango (i) Fleshy thalamus
(1) Marginal – Dianthus, Silene
(2) Axile – Pea, Acacia b. Apple (ii) Placental hairs
(3) Parietal – Lemon, Petunia c. Orange (iii) Succulent testa

(4) Basal – Triticum, Sunflower d. Pomegranate (iv) Fleshy mesocarp
28. Position of ovary is superior in (1) a(iv), b(i), c(ii), d(iii) (2) a(iv), b(i), c(iii), d(ii)
(1) Hypogynous flower (2) Perigynous flower (3) a(iii), b(i), c(ii), d(iv) (4) a(iv), b(iii), c(ii), d(i)
(3) Epigynous flower (4) Mesogynous flower 36. Find correct match
29. Which of the following fruit is formed from superior Column-I Column-II
unilocular monocarpellary ovary with marginal
a. Tetradynamous (i) Papilionaceae
placentation?
b. Diadelphous (ii) Brassicaceae
(1) Pod (2) Silicula
c. Syngenesious (iii) Liliaceae
(3) Siliqua (4) Capsule
30. Choose correct w.r.t. type of fruit d. Epiphyllous (iv) Asteraceae
(1) Litchi – Berry (1) a(ii), b(i), c(iv), d(iii)

(2) Mango – Drupe (2) a(i), b(ii), c(iv), d(iii)
(3) Apple – Nut (3) a(iii), b(iv), c(i), d(ii)
(4) Tomato – Hesperidium (4) a(ii), b(i), c(iii), d(iv)
37. In which inflorescence single pistillate and many 45. A short aquatic runner may be called as
staminate flowers arranged in such a way that
(1) Trailers (2) Stolon
complete inflorescence looks like a flower?
(3) Offset (4) Sucker
(1) Capitulum (2) Capitate
(3) Cyathium (4) Coenanthium 46. The modification in which petiole is changed to
leaf like structure and leaves are highly reduced
38. Which type of fruit contains edible juicy succulent is called
testa and placental hairs respectively?
(1) Phylloclade (2) Phyllode
(1) Pome and pepo
(3) Cladode (4) Epipodium
(2) Balausta and hesperidium
(3) Sorosis and syconus 47. The marked portion in the given diagram is
(4) Berry and caryopsis

39. Select an incorrect statement regarding
inflorescence
!
(1) Receptacle is the modified flattened peduncle
on which flowers lies in a specific manner
(2) Members of family Labiatae exhibit cyathium
inflorescence
(1) Plumule (2) Radicle
(3) Hypanthodium in fig is edible inflorescence
(3) Hypocotyl (4) Epicotyl
(4) A whorl of bracts called involucre occurs at
48. Tendrils in Clematis are the modification of
base of umbel, cyathium and head
inflorescence (1) Stipules (2) Petiole
40. The pitcher in pitcher plant is a modification of (3) Complete leaf (4) Upper leaflets
(1) Leaf base (2) Petiole 49. Which placentation is considered as the most
advanced?
(3) Lamina (4) Leaf apex
(1) Marginal (2) Axile
41. Which roots keep the underground organ to its
proper depth? (3) Basal (4) Superficial
(1) Contractile roots (2) Assimilatory roots
50. The floral formula !!"#"! "!"#"! #$"!%
(3) Stilt roots (4) Reproductive roots
42. Cypsela fruit differs from caryopsis in represents
(1) Development from bicarpellary inferior ovary (1) Lily family
(2) Development from monocarpellary superior (2) Potato family
ovary (3) Mustard family
(3) Absence of pappus
(4) Family of order polymoniales
(4) Its origin from bilocular ovary
51. Lateral roots arise from the
43. Choose the incorrect match w.r.t. fleshy part of
fruit (1) Cells inside the endodermis
(1) Orange – Placental hairs (2) Cells inside the pericycle

(2) Custard apple – Mesocarp (3) Cells of phloem
(3) Banana – Epicarp and mesocarp (4) Endodermis outside the protoxylem patches
(4) Coconut – Endosperm 52. Underground modification of stem occurs for
44. Coleoptile and coleorhiza are absent in following special functions, except
(1) Zea mays seed (1) Storage of food
(2) Triticum turgidum seed (2) Vegetative propagation
(3) Gram seed (3) Assimilation
(4) More than one option is correct (4) Perennation
53. Which roots change the position of corm? 63. Select the correct match
(1) Prop roots (2) Clinging roots Plants Stamens Placentations
(3) Contractile roots (4) Haptera (1) Pea Diadelphous Basal
54. Rhizomes are characterised by all, except
(2) China rose Monoadelphous Parietal
(1) Horizontal growth forward under soil surface
(3) Tomato Epipetalous Axile
(2) Distinct nodes and internodes
(3) Absence of well marked apical buds (4) Lemon Polyadelphous Free central
(4) Presence of scaly leaves 64. Angiospermic family with A(5) ! (2) condition is
55. The anthotaxy consisting of unisexual sessile ___________ and shows __________
flowers is placentation
(1) Spike (2) Spike of spikelets (1) Solanaceae, Axile
(3) Amentum (4) Panicle
(2) Asteraceae, Basal
56. Find odd one w.r.t. dichasial cyme with
monochasial branches (3) Umbelliferae, Marginal
(1) Salvia (2) Ocimum (4) Brassicaceae, Parietal
(3) Poinsettia (4) Coleus 65. Match the following
57. The condition which does not represent the Column I Column II
cohesion of stamens is
a. Vexillary corolla (i) Solanaceae
(1) Monoadelphous (2) Adelphous
(3) Gynandrous (4) Syngenesious b. Scutellum (ii) Liliaceae
58. The pigment present in beet root is c. Epiphyllous stamen (iii) Poaceae
(1) Phycoerythrin (2) Phycocyanin d. Swollen placenta (iv) Papilionaceae
(3) Xanthophyll (4) Anthocyanin (1) a(iv), b(iii), c(ii), d(i) (2) a(iii), b(iv), c(i), d(ii)
59. Tendrils in Smilax are the modification of (3) a(iv), b(ii), c(iii), d(i) (4) a(i), b(iii), c(ii), d(iv)
(1) Leaf tip (2) Petiole
66. The hypanthodium inflorescence is characterised
(3) Upper leaflets (4) Stipules by
60. Long raceme with pendulous inflorescence axis, (1) Presence of bisexual flower
which bears sessile and unisexual flowers is
called (2) Presence of unisexual male flowers near
(1) Spike (2) Amentum base
(3) Spadix (4) Panicle (3) Presence of trimorphic flowers
61. In which type of placentation ovary is one (4) Absence of gall flower
chambered and the placenta bearing ovules
67. Which of the given set of characters is related to
develop on the inner wall of the ovary and, the
number of placenta corresponds to the number of the family having vexillary aestivation of corolla?
carpels? (1) Epiphyllous stamen and axile placentation
(1) Marginal (2) Parietal (2) Diadelphous stamen and marginal
(3) Axile (4) Free central placentation
62. Which one of the following combinations of floral (3) Syngenesious stamen and basal placentation
characters is shown by potato family?
(4) Scutellum as cotyledon and basal
(1) Actinomorphic, bicarpellary and axile
placentation
placentation with swollen placenta
(2) Zygomorphic, pentamerous, gamopetalae with 68. Select an incorrect match
endospermous seed (1) Lomentum – Schizocarpic fruit
(3) Actinomorphic, hypogynous and (2) Legume – Dehiscent fruit
monocarpellary
(3) Cypsela – Indehiscent fruit
(4) Zygomorphic, polypetalae and parietal
placentation (4) Syconus – Aggregate fruit
69. A perennial stem, which generally lies horizontally 75. In Euphorbia, there are 10 cyathia inflorescence
below the surface, is an organ for propagation in and each inflorescence contains 20 flowers. One
female flower produces 6 seeds. Calculate the
(1) Ginger (2) Potato total number of seeds produced by 10 cyathia
(3) Colchicum (4) Allium (1) !" ! # (2) !" #" $
70. Photosynthetic organ originates from _________
(3) !" #" #" (4) !" $ $
meristem and arranged in ________ order.
76. Leaflets are present on rachis and terminal leaflet
(1) Lateral, basipetal is absent in
(2) Root apical, acropetal (1) Palmate, unifoliate leaf
(3) Shoot apical, acropetal (2) Palmate, bifoliate leaf
(4) Intercalary, acropetal (3) Imparipinnate type unipinnate leaf
71. Veins of leaf in addition to acting as channels of (4) Paripinnate type unipinnate leaf
transport of water, minerals and food materials 77. Endosperm is fully consumed during embryo
also development in the seed of
(1) Determine extent of incision of lamina (1) Pisum (2) Castor
(2) Provide rigidity to the leaf blade (3) Triticum (4) Orchid
78. Pendulous spike develops in leaf axis and bears
(3) Hold the leaf blade to light
(1) Bisexual flowers (2) Unisexual flowers
(4) Flutter the leaf in wind thus, helping in cooling
of leaf and bringing fresh air (3) Large coloured bract (4) Whorl of bracteoles
79. The most common type and advanced type of
72. Choose the correct option w.r.t. Solanaceae
placentation is found respectively in
a. Alternate, stipulate, cauline leaves (1) Solanaceae and Poaceae
b. Bisexual actinomorphic flowers (2) Leguminosae and Asteraceae
c. Five persistent calyx (3) Brassicaceae and Liliaceae
d. Epipetalous, diadelphous condition (4) Asteraceae and Liliaceae
e. Axile placentation with swollen placenta 80. Scapigerous umbel and corymbose raceme is
found respectively in
$ !! !$#!
f. Floral formula !"""#""$"""%
!$# !"#
(1) Brassica campestris and Allium cepa
(2) Allium cepa and Brassica campestris
(1) a, b, d, e, f (2) a, b, c
(3) Brassica oleracea and Coriander
(3) b, c, e (4) b, c, d, f
(4) Coriander and Brassica oleracea
73. Find the incorrect match w.r.t. placentation 81. The fruit type and edible part in Ficus carica is
(1) Axile – Hibiscus (1) Sorosis, fleshy axis and succulent perianth
(2) Free central – Dianthus (2) Hypanthodium, fleshy thalamus
(3) Parietal – Brassica (3) Syconus, fleshy thalamus
(4) Basal – Pea (4) Hypanthodium, entire fruit
74. Which of the following statements is depicted by 82. Which of the following is not a part of kernel?
(1) Hilum (2) Tigellum
the floral formula – !"""#"""$""" ! ?
"%" &$' $!"%'% !"#
(3) Radicle (4) Epicotyl
(1) Number of calyx is four arranged in single 83. If the number of chromosomes in the aleurone
whorl layer of maize seed is 30, what is the number of
chromosomes in coleoptile, scutellum, endosperm
(2) It represents family Brassicaceae and microspore respectively ?
(3) Adhesion of carpels (1) 10, 30, 20, 20 (2) 20, 20, 30, 10
(4) Clawless crucifer corolla (3) 20, 10, 20, 10 (4) 10, 10, 20, 30
84. Identify the correct features w.r.t. cruciferae 90. Select the incorrect match w.r.t. placentation
a. Tetramerous flower (1) Basal – Marigold
b. Bisexual, perigynous condition (2) Free central – Primrose
c. The most advanced family of dicots (3) Marginal – Pea
d. Bicarpellary, syncarpous with replum (4) Parietal – Brinjal
e. Fruit berry or capsule 91. Select the incorrect statement w.r.t. family
(1) a, b & d (2) b, d & e Liliaceae
(3) b & c (4) a & d (1) Fruit is generally berry
85. A lateral branch with short internodes and each (2) Flower is bisexual and actinomorphic
node bearing a rosette of leaves and a tuft of (3) Seed is endospermous
roots is found in
(4) Ovary is trilocular with many ovules
(1) Eichhornia and Chrysanthemum
92. The edible part of jack fruit is
(2) Potato and Turmeric
(1) Bracts, perianth and seeds
(3) Water hyacinth and Pistia
(2) Mesocarp and seeds
(4) Pistia and Jasminium
(3) Fleshy thalamus
86. In Australian Acacia plant, the
(4) Mesocarp, endocarp and seeds
(1) Leaves are small and long-lived
93. Characters like hypogynous and pentamerous
(2) Petiole carries out the functions of lamina
flower, gamopetalous, superior ovary with axile
(3) Leaves are modified into pitchers placentation and epipetalous condition are shown
(4) Petioles are called as cladophyll after by angiospermic family _______________
modification (1) Fabaceae (2) Solanaceae
87. The type of placentation in plants in which ovary (3) Asteraceae (4) Liliaceae
is unilocular but it becomes two chambered due
to the formation of false septum is 94. The fleshy fruit with persistent calyx and
developing from inferior ovary is
(1) Free central (2) Basal
(1) Cypsela (2) Regma
(3) Parietal (4) Marginal
(3) Pepo (4) Balausta
95. Diagram given for an angiospermic family is
Column I Column II explaining the presence of
(Plant) (Edible part of fruit)
a. Mango (i) Aril
b. Litchi (ii) Endosperm
c. Coconut (iii) Mesocarp
d. Banana (iv) Mesocarp and endocarp
(1) a(iv), b(i), c(ii), d(iii) (2) a(iii), b(i), c(ii), d(iv)
(3) a(iii), b(i), c(iv), d(ii) (4) a(iii), b(ii), c(iv), d(i)
89. Which of the floral formula is concerned with the (1) Syngenesious stamens
family of tulip, Asparagus and Colchicum?
(2) Axile placentation
(1) !!"#!"""#$$$#"$$$!%# (3) Marginal placentation
(4) Tetradynamous stamens
(2) & !!"#"#$%&%!&#''$!(#%$!%!$')'
96. Half superior-half inferior ovary is found in
(3) !!"#"!""#!"#"!!"$!% perigynous flower of
(1) Peach (2) China rose
(4) !!"!"##$%%$!"$!%&!' (3) Mustard (4) Sunflower
97. Select the correct match 104. Modified aerial stem with branching of unlimited
growth as photosynthetic structure is
(1) Tuber root – Daucus
(1) Flattened in Opuntia and Euphorbia
(2) Stolon – Pineapple
(2) Fleshy and cylindrical in Euphorbia
(3) Sucker – Banana
(3) Cylindrical in Opuntia
(4) Whorled phyllotaxy – Calotropis
(4) Cylindrical in Euphorbia and Opuntia
98. In which plant, petals in a whorl just touch one
105. Swollen leaf base in the leguminous plants is
another at the margin, without overlapping in floral
called as
bud?
(1) Phyllode (2) Pulvinus
(1) Cassia (2) Calotropis
(3) Cladode (4) Phylloclade
(3) China rose (4) Trifolium
106. The lateral branches originate from the basal and
99. Match the Column-I with Column-II underground portion of the main stem, grow
Column-I Column-II horizontally beneath the soil and then come out
obliquely upward from soil to give rise to leafy
a. Marginal placentation (i) Single ovule is shoots, such branches are called
present in
unilocular ovary (1) Sucker (2) Root stock
(3) Stolon (4) Offset
b. Axile placentation (ii) Replum may be
present 107. Respiratory roots found in mangrove plants that
help in gas exchange
c. Parietal placentation (iii) Placenta forms a
ridge along the (1) Have small pores on their upper portions
ventral suture of (2) Do not have cork layer at their bases
ovary
(3) Are positively geotropic
d. Basal placentation (iv) Ovules develop on (4) Have multiple root caps
theouter wall of
ovary 108. Find the correct match
(v) Tomato, Lemon (1) Cladode : Non-photosynthetic with

one internode long runner
(1) a(iii), b(v), c(iv), d(ii) (2) a(ii), b(v), c(iv), d(i)
(2) Phylloclade : Fleshy photosynthetic main
(3) a(iii), b(v), c(ii), d(i) (4) a(iii), b(v), c(iii), d(ii) stem
100. Coir yielding part of coconut is (3) Thorns : Superficial outgrowth
(1) Stem (2) Pericarp (4) Offset : Vertical underground stem
(3) Petiole (4) Seed 109. Choose the incorrect statement w.r.t. buds
101. Ploidy of aleurone layer is similar to (1) May help in perennation and reproduction
(2) Can arise from root and stem
(1) Cotyledons (2) Endosperm
(3) Condensed immature shoot
(3) Integument (4) Secondary nucleus
(4) Can form only vegetative branches
102. !!"#"!"#!"#"!"$$!% . This is the floral formula of 110. Pinnately compound leaves have all the following
family of features except
(1) Leaflets are attached to rachis or its branches
(1) Tulip (2) Petunia
(2) Possess a bud in leaf axil
(3) Wheat (4) Mulathi
(3) Leaflets attached at the tip of petiole
103. In mango and coconut plants, the fruit
(4) Stipules may be present at the base of rachis
(1) Has hard and stony endocarp
111. Few upper leaflets of pinnately compound leaves
(2) Is developed from polycarpellary superior modify into tendrils that coils around the support
ovary and help in climbing is found in
(3) Is developed from apocarpous ovary (1) Lathyrus sativus (2) Lathyrus odoratus
(4) Is multiseeded (3) Gloriosa (4) Smilax
112. Which set of plants contain members of Lily 119. Choose the incorrect statement w.r.t. hesperidium
family?
(1) Derived from polycarpellary, syncarpous,
(1) Asparagus, Indigofera, Trifolium, Lupinus superior and multilocular ovary
(2) Sesbania, Atropa, Nicotiana, Aloe (2) Each chamber is covered by its own papery
(3) Aloe, Asparagus, Sesbania, Tulipa endocarp
(4) Ruscus, Aloe, Asparagus, Colchicum (3) Juicy placental hairs are edible
113. Members of the family represented by floral (4) Found in Aegle marmelos
120. Legume is a kind of simple, dry dehiscent fruit
formula %& !""""#"""
"%" "%"$$! !"# , show the presence
(1) Developing from parietal placenta

of
(2) Developing from monocarpellary, multiovulate
(1) Exstipulate leaves with parallel venation
placenta
(2) Bisexual zygomorphic flowers
(3) That splits in one seeded segments
(3) Trilocular inferior ovary with many ovules
(4) Having pericarp constricted between the
(4) Valvate aestivation and basal placentation seeds
114. Cotton, lady’s finger and china rose show 121. Select the correct match
(1) Imbricate aestivation of petals (1) Lily – Epiphyllous stamen
(2) Contorted aestivation of petals (2) Argemone – Axile placentation
(3) Vexillary aestivation of sepals (3) Tomato – Apocarpous ovary
(4) Twisted aestivation of tepals (4) China rose – Staminode present
115. Perisperm like tissue in chalazal region of seed 122. Which among the following is a characteristic of
that can serve as substitute of __________ is pea and bean?
called ________
(1) Monoadelphous stamens
(1) Endosperm, chalazosperm
(2) Marginal placentation
(2) Nucellus, strophiole
(3) Twisted aestivation
(3) Obturator, perisperm (4) Endospermic seed
(4) Caruncle, chalazosperm 123. How many of the given plants have axile
116. Choose the incorrect statement w.r.t. racemose placentation?
inflorescence
Withania somnifera, Aloe barbadensis,
(1) Acropetally arranged flowers Asparagus, Sesbania, Indigofera, Gloriosa
(2) Growing point or shoot apex is consumed (1) One (2) Three
(3) Centripetal anthesis (3) Five (4) Four
(4) Flowers may be unisexual or bisexual
124. In the embryos of pea and rice, the true
117. Marginal placentation differs from parietal in homologous structures are respectively
(1) Presence of unilocular ovary (1) Hypocotyl and radicle
(2) Being monocarpellary (2) Cotyledons and scutellum
(3) Developing in inferior ovary (3) Coleoptile and scutellum
(4) Having only one ovule in ovary (4) Coleorhiza and coleoptile
118. Inflorescence in banana has 125. Mark the correct statement w.r.t Nepenthes
(1) Coloured, large, boat shaped bract (1) Presence of foliaceous leaf base
(2) Unisexual flowers arranged on peduncle (2) Climber in which petiole is spongy
(3) Flowers arranged acropetally (3) Absence of lid in pitcher
(4) All of these (4) Pitcher is meant for storing water
126. Seeds of maize plant 132. In banana, pineapple and Chrysanthemum, the
lateral branches originate from the basal and
(1) Lack coleoptile and coleorhiza
underground portion of the main stem, grow
(2) Have diploid aleurone layer horizontally beneath the soil and then come out
(3) Have bulky endosperm obliquely upward giving rise to leafy shoots. This
branch is termed as
(4) Are non-endospermic
(1) Stolon (2) Runner
127. Which of the following zone of the root has thin
(3) Sucker (4) Offset
cell wall, dense cytoplasm and large nucleus?
133. Stilt roots present in some plants are
(1) Region of maturation
(1) Originated from the base of stem
(2) Region of elongation
(2) Tap roots
(3) Region of root hair
(3) Hygroscopic roots
(4) Region of meristematic cells
(4) Supporting roots
128. Which of the following type of placentation is
found in Dianthus? 134. If gynoecium is situated in the centre and other
floral parts are located on the rim of the thalamus
almost at the same level, then the flower is said
to be
(1) Perigynous (2) Epigynous
(3) Hypogynous (4) Protogynous
(a) (b) 135. Mark the incorrect match (w.r.t. edible part of
fruit)
(1) Walnut - Succulent testa
(2) Pear - Fleshy thalamus
(3) Orange - Placental glandular hairs
(4) Litchi - Aril
136. Floral formula of Solanum nigrum represents
(c) (d) (1) Epitepalous condition
(2) Polyandrous androecium
(3) Polysepalous calyx
(1) (a) (2) (b) (4) Tricarpellary gynoecium
(3) (c) (4) (d) 137. The placenta developing at the base of ovary with
a single ovule attached to it is found in all, except
129. In which of the following plant edible part of fruit
is pericarp? (1) Sunflower (2) Carrot grass
(1) Date palm (2) Litchi (3) Marigold (4) Carnation
(3) Pomegranate (4) Pear 138. Match the following plants to the respective edible
part of fruit
130. Which of the following type of inflorescence is
found in Ocimum? Column-I Column-II
(1) Hypanthodium (2) Umbel a. Punica granatum (i) Endocarp with mesocarp
b. Litchi (ii) Endosperm
(3) Spadix (4) Verticillaster
c. Cocos (iii) Fleshy testa
131. % K(5) C1+2+(2) A(9)+1 G1 is the floral formula of
d. Musa (iv) Aril
(1) Solanaceae (2) Fabaceae (1) a(iii), b(iv), c(ii), d(i) (2) a(i), b(iv), c(iii), d(ii)
(3) Liliaceae (4) Poaceae (3) a(ii), b(iv), c(iii), d(i) (4) a(ii), b(iv), c(i), d(iii)
139. Which of the given figures represent the 146. Outer covering of endosperm separates the
aestivation of corolla in Gulmohur and Cassia? embryo by aleurone layer, this layer is
(1) n, proteinaceous, seen in dicot seed
(2) 2n, starchy, seen in monocot seed
(1) (2) (3) 3n, proteinaceous, seen in monocot seed
(4) n, oily, seen in dicot seed
147. Scar present on seed coat through which the
developing seeds were attached to fruit is called
(1) Micropyle (2) Hilum
(3) (4) (3) Funicle (4) Stalk

148. Which of the features given below are correct for
coconut fruit?
140. Reduced leaf at the base of pedicel is known as a. Developed from monocarpellary ovary
(1) Stipule (2) Ligule b. Fibrous mesocarp
(3) Bract (4) Bracteole c. Formed from inferior ovary
141. Lateral branch arising from the basal and d. Hard stony endocarp
underground portion of stem, growing horizontally e. Edible mesocarp
beneath soil and then coming out obliquely
upward giving rise to aerial shoot is known as (1) a, c & d (2) c, d & e
(1) Runner (2) Offset (3) b, c & d (4) a, b & d
(3) Stolon (4) Sucker 149. In which of the given plants placenta develops at
the base of ovary and a single ovule is attached
142. The cells proximal to the meristematic zone in
to it?
root tip represents
(1) Tomato, Lemon (2) Mustard, Argemone
(1) Zone of cell elongation
(2) Zone of deacceleration (3) Dianthus, Primrose (4) Sunflower, Marigold
(3) Zone of differentiation 150. Androceium of Citrus and Bombax plants is
(4) Zone of maturation (1) Synandrous (2) Monadelphous
143. Double fertilisation is seen in (3) Polyadelphous (4) Diadelphous
(1) Pinus (2) Cycas 151. Depending on position of calyx, corolla and
androecium w.r.t. the ovary on thalamus the
(3) Lycopodium (4) Wolffia flowers are divided into how many categories?
144. “Lily family” does not show
(1) Two (2) Three
(1) Tepals (3 + 3)
(3) Four (4) Five
(2) Actinomorphic flower
(3) Endospermous seed 152. Flower cannot be divided into two similar halves
by any vertical plane passing through the centre
(4) Inferior gynoecium
in
145. A flower can be said of a member of fabaceae if
(1) Cassia and Canna
(1) It shows epipetalous stamens
(2) It shows twisted petals (2) Canna and Opuntia
(3) It shows standard, keel and wings (3) Cannabis and Sunflower
(4) It shows valvate petals (4) Cocos and Mustard
153. The swollen end of the flower stalk or pedicel 160. Select the odd one out w.r.t. veins
where different kind of whorls are arranged (1) Provide rigidity to the leaf blade
successively is called
(2) Act as channels of transport for water and
(1) Thalamus minerals
(2) Receptacle (3) Veins are filled with parenchyma
(3) Involucre (4) Middle prominent vein is mid-rib
(4) More than one option is correct 161. In a racemose inflorescence the flowers
154. Type of inflorescence where the main axis
(1) Are only pistillate
continues to grow shows
(1) Terminal flower (2) Open centrifugally
(2) Definite growth (3) Are arranged basipetally
(3) Acropetal succession of flowers (4) Are arranged acropetally
(4) Centrifugal flower opening 162. Edible part of ripe mango fruit and coconut fruits
155. Select a correct match are
(1) Staminode – Solanaceae (1) Epicarp & mesocarp respectively
(2) Actinomorphic flower– Cassia, Bean, Gulmohur (2) Mesocarp & endosperm respectively
(3) Zygomorphic flower – Chilli, Tomato
(3) Mesocarp & mesocarp respectively
(4) Inferior ovary – Cucumber, Guava
(4) Pericarp & endosperm respectively
156. Choose the correct identification for given below
plants respectively 163. One internode long branches of stem arising from
nodes which take over photosynthesis and help in
preventing transpiration is
(1) Cladode (2) Phylloclade
(3) Cladophyll (4) Phyllode
164. Leaf tip tendrils that can coil around a support and
help the weak stems mechanically is found in
(1) Smilax (2) Gloriosa
(1) Whorled phyllotaxy, Palmately compound leaf (3) Pisum (4) Nepenthes
(2) Pinnately compound leaf, Whorled phyllotaxy 165. Choose odd one out w.r.t. hypanthodium
(3) Palmately compound leaf, Whorled phyllotaxy inflorescence
(4) Alternate phyllotaxy, Palmately compound leaf (1) Encloses three types of flowers
157. Bud is present in axil of petiole in (2) Exhibits mutualism and coevolution
(1) Compound leaf and leaflet (3) Fleshy receptacle with hollow cavity
(2) Simple and compound leaf
(4) Male flowers are found at the base of
(3) Simple leaf and leaflet receptacle
(4) Leaflet, simple and compound leaf 166. Fruit which develop from monocarpellary superior
158. In Australian Acacia, petiole is modified into leaf ovary and are one seeded with stony endocarp is
like structure called
(1) Drupe (2) Legume
(1) Cladode (2) Phyllode
(3) Nut (4) Berry
(3) Phylloclade (4) Cladophyll
159. Thorn is 167. In guava and cucumber flowers
(1) Modification of leaf (1) Stamen is superior in position

(2) Axillary bud modified (2) Ovary is superior in position
(3) Climbing structure (3) Stamen is inferior in position
(4) Always non woody (4) Ovary is half inferior in position
168. Select correct set of characters for lily family 176. Very fine, delicate, unicellular, thread like
a. Stipulate leaves with reticulate venation structures developed from the zone of root that is
b. Actinomorphic and hypogynous flower proximal to
c. Tricarpellary ovary (1) Region of maturation
d. Basal placentation (2) Region of cell elongation
e. Generally berry fruit with endospermous seed (3) Region of meristematic activity
(1) a, c, e (2) b, c, d (4) Region of cell differentiation
(3) b, c (4) a, d
177. Underground stems of ginger, turmeric and
169. Pneumatophores are modification of zaminkand are modified to/and
(1) Prop root for exchange of gases
(1) Store food and chlorophylls
(2) Tap root for retention of moisture
(2) Act as sex organs
(3) Adventitious root for breathing
(3) Protect the root apex
(4) Tap root for respiration
170. Australian Acacia possesses modified expanded (4) Act as organ of perennation
green photosynthetic structure called 178. Bougainvillea and Citrus plants are protected from
(1) Phyllode (2) Cladode browsing animals as
(3) Phyllome (4) Cataphyll (1) Adventitious buds get modified into thorns
171. First formed flower is basal in which one of the (2) Axillary buds get modified into spines
following inflorescence?
(3) Lateral buds get modified into pointed
(1) Capitulum (2) Spikelet structures
(3) Cyathium (4) Umbel
(4) Apical buds get modified into thorns
172. Find the odd one w.r.t. perigynous flower
179. Mark the odd w.r.t. modified sub-aerial stem for
(1) Guava (2) Plum
vegetative propagation
(3) Rose (4) Peach
(1) Jasmine (2) Pineapple
173. Find correct match w.r.t. gynoecium and
placentation in respective family (3) Chrysanthemum (4) Banana
Column I Column II 180. Most important vegetative organs for photosynthesis
a. G(3), Axile (i) Brassicaceae (1) Are arranged in a basipetal order
b. !!"# , Basal (ii) Liliaceae (2) Originated from shoot apical meristems
(3) Develops at the internode and bears a bud
c. G(2), Parietal (iii) Solanaceae
(4) Are leaves that attached to the stem by
d. G(2), Axile (iv) Asteraceae
pedicel
(1) a(i), b(ii), c(iv), d(iii) (2) a(ii), b(iv), c(i), d(iii)
181. Leaves of Dionaea and Nepenthes are modified
(3) a(ii), b(iv), c(iii), d(i) (4) a(iv), b(ii), c(i), d(iii)
into
174. Which set of plants have fruit developing from
monocarpellary superior ovary and have single (1) Insectivorous pitchers
seed? (2) Phyllodes
(1) Cocos, Mangifera (3) Spines
(2) Mangifera, Tagetes
(4) Insect catching structures
(3) Datura, Pisum
(4) Triticum, Lycopersicon
(1) In Calotropis, a pair of leaves arise at each
175. Roots in some plants change their shape and
node and lie opposite to each other
structure and become modified to perform
functions like (2) A bud is present in the axil of both simple and
(1) Additional support and absorption of water compound leaves
(2) Absorption and conduction of water and (3) Leaves are small and long lived in Australian
minerals Acacia
(3) Storage of food and respiration (4) Veinlets form a network in the leaves of most
(4) Absorption of minerals and storage of food dicotyledonous plants
183. In racemose type of inflorescence (1) Colchicum, Asparagus, makoi
(1) Main axis does not terminate in a flower (2) Brinjal, tulip, Petunia
(2) Flowers are borne in a basipetal order (3) Gloriosa, Aloe, tulip
(3) Main axis shows limited growth (4) Sesbania, Asparagus, gram
(4) Both (1) & (2) 190. Fruit of coconut plant is developed from
184. Mark the mis-matched pair (1) Perigynous flower (2) Superior ovary
(1) Chilli – Actinomorphic flower (3) Epigynous flower (4) Bicarpellary ovary
(2) Thalamus – Swollen end of pedicel 191. In the seeds of maize, the seed coat
(3) Cassia – Bilateral symmetry in flower (1) Is fused with the pericarp
(2) Store aleurone grains
(4) Canna – Zygomorphic flower
(3) Is membranous and triploid
185. In pea and bean flowers, the _____ petal overlaps
the two _____ petals which in turn overlap the two (4) Has an outgrowth, called strophiole
_____ petals. 192. Endosperm persists in the mature seeds of
(1) Largest, anterior, lateral (1) Most dicots (2) Angiosperms only
(2) Posterior, keel, smallest (3) Most monocots (4) All spermatophytes
(3) Posterior, wings, anterior 193. Which of the following is mis-matched pair?
(4) Anterior, lateral, smallest (1) Belladonna – Medicine – Solanaceae
186. Match the following (Column I with Column II) (2) Asparagus – Vegetable – Liliaceae
Column I Column II (3) Trifolium – Ornamental plant – Fabaceae
a. Bilocular ovary with (i) Dianthus (4) Tobacco – Fumigatory – Potato family
false septum 194. In seed of Ricinus communis, there is a specific
b. Free central (ii) Marigold outgrowth
placentation (1) Called coleoptile present over hilum
c. Axile placenta (iii) Mustard (2) Helping in absorption of water
d. Basal placentation (iv) Lemon (3) Called caruncle formed by nucellus

(4) Formed by proliferation of cells of inner
(1) a(i), b(iii), c(iv), d(ii) (2) a(iii), b(iv), c(i), d(ii)
integument and funicle
(3) a(iii), b(i), c(iv), d(ii) (4) a(i), b(ii), c(iv), d(iii)
195. Select the correct option w.r.t. modified structural
187. In epigynous flowers, the ovary is said to be_____ name, modified organ and examples
and found in _____
Modified Modified Example
(1) Semi-superior, plum (2) Inferior, sunflower plant organ structures
(3) Semi-inferior, peach (4) Inferior, radish (1) Tendril Axillary bud Gourds
188. Which of the following statements is true for the (2) Thorn Axillary bud Citrus
fruits of mango and banana? (3) Phylloclade Stem Opuntia
(1) Developed after fertilization of ovary (4) Cladode Leaf Australian Acacia
(2) Endocarp is hard and stony 196. A lateral branch with short internodes and each
(3) Presence of differentiated pericarp bearing rosette of leaves and a tuft of roots is
(4) Pseudocarpic fruits found in
189. Select the correct option (1–4) in which all the (1) Pistia, Eichhornia (2) Mint, Jasmine
plants representing the following floral diagram. (3) Grasses, Strawberry (4) Banana, Pineapple
197. In silk cotton trees
(1) Leaflets are present on rachis
(2) Incision of lamina is absent
(3) Leaflets are attached at tip of petiole
(4) Bud is present in the axil of leaflets
198. Choose correct option w.r.t. given below 203. Which of the following pairs is wrongly matched?
inflorescence
a. Alstonia – Whorled phyllotaxy
b. Monstera – Fibrous roots
c. Euphorbia – Cylindrical phylloclade
d. Citrus – Spines
(1) a & c (2) b & d
(1) Main axis terminates in flower (3) a & d (4) b & c

(2) Acropetal arrangement of flowers 204. Consider the given floral diagrams labelled by
(3) Unlimited growth of main axis a, b and c and select the correct answer w.r.t
(4) More than one option is correct common characteristics of these floral diagrams
representing families
199. Choose correct match
(1) C× 4 – Mustard
(2) C1 + 2 + (2) – Pea
(3) P3 + 3 – Lily a. b. c.
(4) C(5) – Lupin
200. Which one of the following is a correct
statement? (1) a and c has actinomorphic flowers
(1) In cymose type of inflorescence, the main axis (2) a and b has epipetalous stamens
continues to grow (3) b and c has valvate aestivation in petals
(2) Ovary is half inferior in the flowers of
(4) a, b and c has axile placentation
cucumber
205. Short horizontal branch producing a cluster of
(3) In castor, the endosperm is not present in
leaves above and the cluster of roots below at
mature seeds
each node is seen in
(4) Seeds of dicot and monocot plants vary is
(1) Submerged hydrophytes
shape, size and period of viability
(2) Water hyacinth, water chestnut
201. Consider the following statements and select
appropriate option (3) Floating hydrophytes
a. The region of maturation is distal to the (4) Mint and Colocasia
elongation region. 206. Match the following
b. The leaflets are attached at a common point Column I Column II
in silk cotton. a. Jasmine (i) Sucker
c. Chinarose and tomato possess most common b. Pineapple (ii) Rhizome
type of placentation. c. Zaminkand (iii) Stolon
d. The ploidy level of coleoptile is 3N. d. Ginger (iv) Corm
e. C1 + 2 + (2) condition shows vexillary aestivation (1) a(i), b(iii), c(iv), d(ii) (2) a(ii), b(i), c(iv), d(iii)
with equal sized petals. (3) a(iii), b(i), c(ii), d(iv) (4) a(iii), b(i), c(iv), d(ii)
(1) b, c & e are correct 207. Choose odd one out w.r.t. structure of axillary bud
(2) a, b, c & e are correct origin
(3) a, d & e are incorrect (1) Thorn (2) Tendril
(4) a, c & d are incorrect (3) Bulbil (4) Spine
202. Pericarp is thick and differentiated into three 208. Pneumatophore and stilt roots are seen in which
layers in of the following plants respectively?
(1) Coconut, Garden pea (1) Sugarcane, Rhizophora
(2) Wheat, mango (2) Mangroove plants, Grasses
(3) Brinjal, ground nut (3) Ficus, Rhizophora
(4) Mango, coconut (4) Grasses, Mangroove plants
209. Persistent fibrous root system arise from 216. Pneumatophores are helpful in
(1) Radicle (1) Transpiration (2) Assimilation of food
(2) Base of stem (3) Guttation (4) Getting oxygen
(3) Leaf 217. Root zone where differentiated permanent tissue
(4) Stem internode is present, is
210. Pneumatophores are helpful in (1) Also associated with tubular outgrowths from
epidermal cells
(1) Transpiration
(2) Present below root hair zone
(2) Assimilation of food
(3) Shows outgrowth coming from pericycle cells
(3) Guttation
(4) Getting oxygen
211. Short horizontal branch producing a cluster of SECTION - B
leaves above and the cluster of roots below at
each node is seen in
(1) Submerged hydrophytes
(2) Water hyacinth, water chestnut
(3) Floating hydrophytes reason is the correct explanation of the
(4) Mint and Colocasia assertion, then mark (1).
212. Match the following (2) If both Assertion & Reason are true but the
Column I Column II
a. Jasmine (i) Sucker
b. Pineapple (ii) Rhizome false, then mark (3).
c. Zaminkand (iii) Stolon (4) If both Assertion and Reason are false
d. Ginger (iv) Corm statements, then mark (4).
(1) a(i), b(iii), c(iv), d(ii) 1. A : The marketed produce of almond contains
stony endocarp that encloses seed having
(2) a(ii), b(i), c(iv), d(iii)
edible cotyledons.
(3) a(iii), b(i), c(ii), d(iv)
R : The unedible velvetty epicarp and tough
(4) a(iii), b(i), c(iv), d(ii) mesocarp are removed before marketing.
213. Choose odd one out w.r.t. structure of axillary bud 2. A : Corms of Colchicum luteum are used in the
origin treatment of gout and liver diseases.
(1) Thorn (2) Tendril R : The colchicine obtained from it is used for
(3) Bulbil (4) Spine doubling of chromosomes.
214. Pneumatophore and stilt roots are seen in which 3. A : Adventitious roots are present in monocot
of the following plants respectively? plants.
(1) Sugarcane, Rhizophora R : Primary root is not produced in these plants.
(2) Mangroove plants, Grasses 4. A : Storage tap root is present in carrot.
(3) Ficus, Rhizophora R : Carrot possess reduced stem.
(4) Grasses, Mangroove plants 5. A : Some members of fabaceae family are good
215. Persistent fibrous root system arise from source of edible oil.
(1) Radicle R : They yield medicines like belladonna and
(2) Base of stem ashwagandha also.
(3) Leaf 6. A : Fibrous roots originate from the base of stem.
(4) Stem internode R : Primary roots are short lived in monocots.
!" !" !
Chapter 6
Principles of Inheritance and Variation

6. Different blood groups in ‘ABO’ system are
SECTION - A
controlled by the gene located on
Objective Type Questions chromosome and possible number of genotypes for
1. An individual with AaBb genotype is producing four ‘B’ blood group is .
types of gametes as AB, aB, Ab and ab by (1) 9th and 2 (2) 11th and 1
meiosis. If the frequency of these gametes is 25% (3) 9th and 1 (4) 18th and 2
each then, it explains
7. Flower colour is purple in sweet pea due to non-
(1) Incomplete linkage allelic interaction between two dominant genes C
(2) Mutations and P. Plant with CCpp genotype will have which
one of the following correct explanation?
(3) Independent assortment
a. Flower colour is white
(4) Complete linkage
b. No synthesis of chromagen
2. Which one of the following Mendelian trait
controlling unit is expressed in homozygous c. Raw materials are metabolised into chromagen
condition only? d. Chromagen metabolism is further stopped
(1) Axial flower (2) Yellow seed e. Crossing with heterozygous purple flowered
(3) Yellow pod (4) Smooth seed plant will yield equal percentage of purple and
white flowered plants
3. Total number of phenotypic and genotypic classes
possible from selfing of a plant with genotype (1) a, c, d and e
aaBbCCDdEEFf are respectively (2) All are correct except ‘d’
(1) 64, 729 (2) 8, 27 (3) a, b and e
(3) 32, 243 (4) 27, 35 (4) b, c, d and e
4. A pure tall – red flowered plant was crossed with 8. Select incorrect statement w.r.t. polygenic
dwarf – white flowered plant. In F1, all plants were inheritance
tall with pink flowers. What is the percentage
(1) It controls quantitative traits
probability of getting red and pink flowered plants
respectively? (2) Parental population remains constant
irrespective of polygenes number
(1) 25% and 50% (2) 50% and 25%
(3) A single dominant allele expresses only a unit
(3) Zero and 75% (4) Zero and 50%
of the trait
5. Progenies with one phenotype and four genotypes
(4) One of the parental phenotype is expressed in
can be obtained from
F1 individuals
(1) Dihybrid test cross
9. Number of linkage group in rice and pea is
(2) Monohybrid out cross and respectively
(3) Dihybrid out cross (1) 17 and 7 (2) 12 and 14
(4) Trihybrid cross (3) 12 and 7 (4) 10 and 7
218 Principles of Inheritance and Variation Last Leap for NEET (Part-I)
10. Bateson and Punnet observed incomplete linkage 17. What is incorrect for genetic maps?
in sweet pea for which one of the following pair of (1) Alfred Sturtevant prepared it for the first time
characters? using monohybrid test cross
(1) Flower colour and seed shape
(2) It is a measure of the distance between genes
(2) Flower colour and pollen shape present on same chromosome
(3) Flower position and pollen size (3) Stronger the linkage lesser is the distance
(4) Pod colour and flower colour between two genes
11. Sex index of individual with chromosome (4) It was extensively used in the case of Human
constitution AAA + XXY in human and Drosophila Genome Sequencing Project
is respectively
18. Match the column correctly
(1) Male and intersex
Column I Column II
(2) Female and male sex
a. Phenylketonuria (i) Autosomal trisomy
(3) Both are intersexes associated with
(4) Normal female and intersex mongolism
12. Which one of the following traits are controlled by b. Down’s syndrome (ii) Gynaecomastia
genes located on differential part of X-
c. Klinefelter’s syndrome (iii) Autosomal recessive
chromosome?
trait associated with
(1) Porcupine skin and epidermolysis bullosa mental retardation
(2) Beard in man and milk glands in female d. Turner’s syndrome (iv) Sterile females with
(3) Colour blindness and haemophilia rudimentary ovaries
(4) Colour blindness and cystic fibrosis (1) a(iii), b(i), c(iv), d(ii)
13. Find correct match between column I and column II (2) a(ii), b(iii), c(i), d(iv)
Column I Column II (3) a(ii), b(i), c(iii), d(iv)
a. Alkylating agent (i) UV rays (4) a(iii), b(i), c(ii), d(iv)
b. Pyrimidine dimer (ii) EMS
19. Inhibition of glucocerebrosidase enzyme action
c. Tetrasomic (iii) AAA leads to the disorder ________, the genes of which
d. Gigas effect (iv) (N + 1) × (N + 1) are located on chromosome number ________.
(1) a(ii), b(i), c(iv), d(iii) (2) a(ii), b(i), c(iii), d(iv) (1) Tay-sach’s disease, 15
(3) a(iii), b(i), c(iv), d(ii) (4) a(i), b(iv), c(iii), d(ii) (2) Gaucher’s disease, 11
14. If PTC non-taster population is 16 percent, then (3) Tay-sach’s disease, 1
percentage population of heterozygous taster is
(4) Gaucher’s disease, 1
(1) 36% (2) 48%
20. What will be the ratio of yellow, white and green
(3) 84% (4) 56% fruits in Cucurbita pepo in F1 generation, if a cross
15. In pea, the gene that controls starch synthesis is made between a pure breeding white summer
shows all of the following except squash with a pure breeding green summer
(1) Dominance squash?
(2) Incomplete dominance (1) 12 : 3 : 1 (2) 9 : 3 : 4
(3) Multiple allelism (3) 0 : 1 : 0 (4) 1 : 0 : 0
(4) Pleiotropy 21. The genes of characters pod shape and seed
16. If plant AaBBCc is crossed with a plant aaBbCc, shape are located on chromosome number
then what percentage of progenies will have the _______ and _______ respectively in Pisum
genotype AaBBcc? sativum.
(1) 6.25% (2) 12.5% (1) 4 and 7 (2) 7 and 4
(3) 25% (4) 66.6% (3) 4 and 1 (4) 5 and 7
Last Leap for NEET (Part-I) Principles of Inheritance and Variation 219
22. Mark the correct one (w.r.t. lethality) 29. In Mirabilis jalapa dwarf and pink flower plant is
(1) Lysch Nyhan syndrome and colourblindness crossed with heterozygous tall and pink flower
plant, then what proportion of plants are pink in
(2) Haemophilia and sickle cell anaemia progeny?
(3) Colourblindness and haemophilia
! !
(4) Hypertrichosis and colourblindness (1) (2)
" "
23. Suppose a pea plant heterozygous for tallness and
inflated pod is crossed with dwarf pea plant with # #
constricted pod. How many types of offsprings will (3) (4)
$ "
be produced and in what proportion?
30. A pedigree chart is given below
(1) Two types of offspring, in the ratio of 1 : 1
!"
(2) Four types of offspring, in the ratio of 1 : 1 :
1:1
!!"
(3) Four types of offspring, in the ratio of 3 : 1
(4) Sixteen types of offspring in the ratio of 9 : 3 :
!!!"
3:1
Find the possible parental combination for this
24. Interaction of complementary factors give F 2
case
modified ratio of
(1) 9 : 6 : 1 (2) 15 : 1 (1) (Aa) (aa)
(3) 9 : 3 : 4 (4) 9 : 7
(2) (Aa) (Aa)
25. All are X-linked traits, except
(1) Colourblindness (3) (HbAHbA) (HbSHbS)
(2) Haemophilia
(3) Deficiency of glucose-6-phosphate dehydro- (4) (aa) (AA)
genase
31. Find the ratio of comb types if a cross is made
(4) Hypertrichosis between poultry of Rrpp and RRPp genotypes
26. Find out the sex index of Drosophila if (1) 1 : 1 (2) 1 : 1 : 1 : 1
chromosome composition is AAA + XXY (w.r.t
(3) 1 : 3 (4) 3 : 1
genic balance theory)
32. An incompletely linked dihybrid (AaBb) will produce
(1) Super (2) Intersex
! ________ types of gametes
(1) Four (2) Two
(3) (sterile) (4) Normal
!
(3) Six (4) Eight
27. Marriage between the carrier colour-blind woman
and haemophilic man with normal vision produces 33. Select the incorrect statement w.r.t. sex linked
inheritance in humans
(1) 75% normal boys with normal vision
(2) 50% girls are colour blind and haemophilic (1) Males are more susceptible to X-linked
recessive diseases
(3) 50% girls with normal vision
(2) Y-chromosome of males move to male
(4) 100% carrier girls for haemophilic offsprings, the inherited traits are called
28. How many sum total of genotypes and phenotypes holandric
are possible, when selfing of plant having genotype (3) Females can be normal, carrier or diseased for
AaBbCC is performed? X-linked dominant trait
(1) 13 (2) 35 (4) Criss cross inheritance is possible in colour
(3) 34 (4) 16 blindness
34. If a trait is controlled by two polygenes and the 41. How many types of gametes are produced by
plant is test crossed, the total number of AaBbCc genotype, where A and B are linked?
genotypes and phenotypes is (1) 4 (2) 8
(1) 9 (2) 7 (3) 16 (4) 32
(3) 5 (4) 11 42. If maximum average weight in lemon is 60 g and
35. Chemical mutagen that can intercalate between minimum average weight is 30 g. What will be the
nitrogenous bases and interfere with DNA average weight of lemon variety with AabbCc
replication is genotype?
(1) HNO2 (2) Alkylating agents (1) 10 g (2) 30 g
(3) Acridines (4) Base analogue (3) 40 g (4) 50 g
36. Frequency of non-taster population is 16 percent, 43. Gene for pod colour in Pisum is present on which
then calculate the total number of recessive alleles chromosome number?
out of 2000 individuals (1) One (2) Four
(1) 2400 (2) 1600 (3) Five (4) Seven
(3) 1440 (4) 1280 44. What will be the sum total of genotypic classes
37. A trihybrid plant showing partial linkage between and phenotypic classes in a trihybrid polygenic
first two loci is test crossed, then what is cross in F2 generation?
expected in next generation? (1) 16 (2) 35
(1) All progenies are of four phenotypes (3) 34 (4) 9
(2) Progenies with more parental combination of 45. What will be the number of surviving individuals in
eight phenotypic classes a population of 2000, if the frequency of recessive
(3) Progenies with more recombinants lethal allele is 0.1%?
(1) 1620 (2) 1800
(4) All progenies with 12.5% population
(3) 380 (4) 1980
38. Select correct match between Column I and
Column II 46. Find odd one out w.r.t. pleiotropism
Column I Column II (1) Sickle cell anaemia (2) Cystic fibrosis
a. Gaucher’s disease (i) Glucocerebrosidase (3) Marfan’s syndrome (4) Coat colour in rabbit
deficiency 47. Select incorrect match between the organism and
b. Cystic fibrosis (ii) Inherited disease of number of its linkage group
mucus & sweat Organism Linkage group
glands (1) Drosophila 4
c. Achondroplasia (iii) Sex-linked recessive (2) Human male 23
d. DMD (iv) Dwarfism (3) Neurospora 7
(1) a(i), b(ii), c(iv), d(iii) (2) a(i), b(iii), c(ii), d(iv) (4) Pisum 7
(3) a(ii), b(i), c(iii), d(iv) (4) a(iii), b(ii), c(iv), d(i) 48. Mr X is a colour blind and his father was albinic.
39. In which of the following plant, Mendel failed to What proportion of his sperms will have both these
produce same result ? defects?
(1) Duckweed (2) Hawkweed (1) 25% (2) 37.5%
(3) Milkweed (4) Kalmathweed (3) 50% (4) 100%
40. What would be the number of tall and pink plants, 49. A dihybrid test cross produced the following
if tall and pink plants (TtRr) are selfed? Given that offsprings
first character shows complete dominance and AB/ab 960
second character shows incomplete dominance Ab/ab 60
(1) 9/16 (2) 8/16 aB/ab 40
(3) 6/16 (4) 3/16 ab/ab 940
What is the distance between gene A and B? 57. Which of the following abnormality always passed
(1) 5 map units from father to his son only?
(2) 100 map units (1) Colour blindness
(3) 20 map units (2) Haemophilia
(4) 10 map units (3) Porcupine skin
50. Which one of the following scientist is not included (4) Lesch Nyhan's syndrome
in the list of rediscoverer of Mendelism? 58. If we change the position of genes on
(1) Hugo de Vries (2) Kolreuter chromosomes it will be included in
(3) Carl Correns (4) Tschermak (1) Gene mutation
51. Choose the incorrect statement w.r.t. factors (2) Chromosomal mutation
affecting crossing over (3) Polyploidy
(1) Crossing over decreases with age (4) Transversion mutation
(2) Centromere and heterochromatin decreases 59. How many types of gametes are possible in
crossing over Drosophila, if independent assortment of
(3) X-rays and temperature decreases crossing chromosomes occurs during meiosis?
over (1) 4 (2) 8
(4) Male Drosophila shows little crossing over or (3) 16 (4) 32
no crossing over 60. Short index finger in males is a
52. What will be the sex in Dioscorea with odd number (1) Sex differentiated trait
of chromosomes?
(2) Sex linked trait
(1) Female (2) Male
(3) Holandric trait
(3) Intersexes (4) Both (1) & (2)
(4) Sex influenced trait
53. How many drum sticks are present in a human
suffering from Jacob's syndrome? 61. Match the following columns
(1) 3 (2) 2 Column I Column II
(3) 1 (4) Zero a. Father of actinobiology (i) Stadler
54. What is the percentage of incompatible marriages b. Used X-rays to (ii) Muller
if frequency of Rh+ population is 70%? induce mutations in
(1) 7% (2) 10% barley and maize
(3) 4% (4) 21% c. Used UV and -rays (iii) Auerbach and
55. Genes which are present very close to each other as mutagens Robson
produce related phenotypes and can be
d. Used mustard gas as (iv) Altenberg
distinguished through rare crossing over are called
as first chemical mutagen
(1) Isoallele (1) a(ii), b(i), c(iii), d(iv)
(2) Multiple allele (2) a(ii), b(i), c(iv), d(iii)
(3) Pseudoallele (3) a(i), b(ii), c(iii), d(iv)
(4) Allelomorphs (4) a(iv), b(iii), c(ii), d(i)

56. 5-bromouracil replaces _______ of DNA and pairs 62. What will be the sex of Drosophila if its genetic
with _______ make up is AA + XXY?
(1) Thymine, adenine (2) Thymine, guanine (1) Male (2) Meta male
(3) Guanine, adenine (4) Guanine, thymine (3) Female (4) Meta female
63. Which of the following is always sterile? 69. What will be the genotype of proposita in the family
if following pedigree chart is given?
a. Triploid
b. Amphidiploid
c. Autotetrapolyploid
d. Allotetrapolyploid
(1) a and d only (2) b and c only
(3) a only (4) d only
(1) AA (2) Aa
64. Following figure represents which type of
chromosomal aberration? (3) XcXc (4) XXc
70. A haemophilic man marries a colour blind woman,
! ! what proportion of their children will have both these
" defects?
# "
$
(1) 100% (2) 50%
# $ (3) 25% (4) Zero
%
% 71. If F2 phenotypic ratio 9 : 3 : 3 : 1 is modified to
& &
9 : 6 : 1 ratio, it is due to which gene interaction?
(1) Deletion (1) Complementary (2) Suplementary
(2) Duplication (3) Epistatic (4) Polymeric
(3) Paracentric inversion 72. What is the F 2 phenotypic ratio in double

recessive epistasis?
(4) Pericentric inversion
(1) 9 : 7 (2) 9 : 3 : 4
65. PTC non-tasters are 45 out of 500 individuals.
(3) 12 : 3 : 1 (4) 13 : 1
Calculate the number of heterozygous taster
individuals in this population 73. Interaction of two genes in which one gene has no
effect when alone but it modifies the effect of
(1) 210 (2) 410
another gene when present in dominant form, is
(3) 90 (4) 290 called ________ interaction
66. What is the percentage of mullatoes in F2 if very (1) Inhibitory gene (2) Dominant epistatic
dark and very light individuals are taken as parents (3) Duplicate (4) Supplementary
for F1, If this character is controlled by three pair
of genes? 74. Who gave the status of laws to some postulates
of Mendel?
(1) 23.4% (2) 31.2%
(1) Hugo de Vries (2) Correns
(3) 9.5% (4) 50%
(3) Blixt (4) Kolreuter
67. How many double homozygous individuals are
75. What is the sequence of genes on chromosome if
produced by the selfing of a dihybrid?
frequency of crossing over between A-B is 20%,
(1) 2 (2) 4 A-C is 15%, B-C is 5%, A-D is 10% and B-D is
30%?
(3) 6 (4) 8
(1) A B C D (2) C B D A
68. In a hospital five children are born on a particular
day. What is the probability of three male children? (3) D A C B (4) D A B C
76. How many chromosomes will be present in a
" " double monosomic individual if its gametic
(1) (2)
! ! chromosome number is 10?
" # (1) 8 (2) 18

(3) (4)
! !" (3) 19 (4) 22
77. A trihybrid cross is made for height, flower colour 82. Select correct statement for Mendelian hybridization
and shape of seed in pea, how many progenies experiment
are expected with first recessive, second (1) F1 hybrids of reciprocal crosses were different
heterozygous dominant and third dominant
character? (2) In F 2 generation of dihybrid cross, parental
types are 62.5%
# ! (3) Both parental alleles with their traits are
(1) (2)
!" !" transmitted to F1
(4) Dihybrid recombinants are 50%
$! "
(3) (4) 83. Both the alleles produce their effect in
!" !"
(1) Heterozygous B blood group
78. What ratio of coloured and white flower can be
obtained by making cross in sweet pea with (2) Sickle cell haemoglobin
genotype Ccpp × CcPp? (3) Snapdragon flower colour
(1) 6 : 10 respectively (2) 2 : 6 respectively (4) Cucurbits fruit colour
(3) 5 : 3 respectively (4) 9 : 7 respectively 84. Out of the following statements for linkage/ linkage
group
79. If size of starch grains in pea is considered as
phenotype, Bb alleles show a. The number of linkage group is equivalent to
number of chromosomes of body cell
(1) Dominance
b. Reduces the incidence of recombination
(2) Codominance
c. Useful for maintaining the good characters of
(3) Incomplete dominance the newly developed variety
(4) Pleiotropism d. Mother passes the alleles of a sex-linked traits
80. In Drosophila, genes of grey body and long wings to both sons and daughters
are dominant over black body and vestigeal wings. e. Females suffer from sex linked disorders more
Body colour and wing length are found on the frequently than males
same chromosome and are completely linked. If (1) All are correct
pure breeding fruitflies for both characters are
crossed then expected F2 phenotypic ratio should (2) Only e is wrong
be (3) b, c and d are correct
(1) 3 : 1 (2) 9 : 3 : 3 : 1 (4) a, d, e are wrong
(3) 1 : 1 : 1 : 1 (4) 7 : 1 : 1 : 7 85. How many types of gametes are formed from the
mother cell having AaBbCCDd genotypes?
81. Find the correct match between column I and II
w.r.t. enzyme deficiency (1) 4 (2) 8
Column I Column II (3) 16 (4) 32

86. What is the phenotypic ratio in next generation
(a) Albinism (i) HGPRT
when plant with genotype CcPp is self crossed
(b) PKU (ii) Tyrosinase and gene C and P show complementary
(c) Lesch Nyhan- (iii) Glucocerebrosidase interaction?
syndrome (1) 12 : 3 : 1 (2) 9 : 3 : 4
(d) Gaucher's (iv) Phenylalanine (3) 9 : 6 : 1 (4) 9 : 7
disease hydroxylase 87. Law of segregation can be proved with
(1) a(ii), b(iv), c(iii), d(i) (1) The presence of dominant genotype in F2
(2) a(ii), b(iv), c(i), d(iii) (2) The presence of recessive genotype in F1
(3) a(iv), b(ii), c(i), d(iii) (3) The presence of recessive homozygous in F2
(4) a(iii), b(iv), c(i), d(ii) (4) The presence of heterozygous individual in F2
88. What is the probable ratio of dominant individuals 95. A heterozygous round seeded pea plant is selfed.
in F2, if mulatto individuals are self crossed and the Out of a population of 8000, what proportion of
character is believed to be controlled by two pairs progeny produced will have large starch grain size?
of polygenes (1) 4000 (2) 6000
(1) 1 : 4 : 6 : 4 : 1 (3) 8000 (4) 2000
(2) 15 : 1 96. Mr. X is haemophilic and carrier for PKU. What
(3) 1 : 4 : 6 : 4 percentage of sperms posses defective allele for
both traits?
(4) 1 : 6 : 15 : 20 : 15 : 6 : 1
(1) 25% (2) 50%
89. Select an incorrect match of syndrome / disease
associated to the specific character (3) 75% (4) 0%
(1) Klinefelter – Gynaecomastia 97. In a population, proportion of individuals showing

!
(2) Turner – 44 + XO cystic fibrosis is " then the frequency of
!####
(3) TSD – Hexosaminidase - A carriers is almost
deficiency (1) 6% (2) 2%
(4) Lesch Nyhan – Infantile Amaurotic Idiocy (3) 8% (4) 10%
90. A female carrier for hemophilia is married to a 98. A cross performed in wheat with respect to kernel
colourblind male, which of the given is a correct colour (AaBb × aaBb) yields the phenotypic ratio
expression of expected offspring for this couple? as
(1) 50% males will be normal (1) 1 : 3 : 3 : 1 (2) 1 : 4 : 6 : 4 : 1
(2) 50% males will be colourblind (3) 0 : 1 : 3 : 3 : 0 (4) 15 : 1
(3) 50% females will be hemophiliac 99. Heterozygous yellow mice is crossed with
(4) 50% females will be colourblind homozygous recessive then which of the following
condition is seen?
91. How many pure line varieties were selected finally
by Mendel in Pisum sativum for the hybridisation (1) 100% yellow (2) 75% brown
experiments? (3) 50% yellow (4) 25% brown
(1) Seven (2) Twelve 100. Choose the odd one out w.r.t. incomplete
dominance
(3) Fourteen (4) Thirty two
(1) Flower colour in Antirrhinum
92. Which of the following trait shows expression in
only homozygous condition? (2) Coat colour in Andalusian foul
(1) Yellow seed (2) Inflated pod (3) Flower colour in Mirabilis jalapa
(3) Axial flower (4) Yellow pod (4) Coat colour in short horned cattle
93. How many types of gametes can be produced by 101. Morgan utilised the Drosophila as an experimental
plant having genotype PpQqRrSsttUu? material for his investigations as
(1) 8 (2) 16 (1) Female flies are distinguishable from male flies
due to their small size
(3) 32 (4) 4
(2) It can complete its life cycle in 12 months
94. What is the probability of white flowered plants in
(3) It can be grown in complex nutrient medium only
F2 generation while performing the dihybrid cross
in Pisum sativum? (4) Single mating produce large number of progeny
# # 102. What is the sex of Drosophila having genotype

(1) (2) AAA + XX?
$ "
(1) Sterile male (2) Super male
" !
(3) (4) (3) Fertile female (4) Intersex
! "
103. How many types of gametes will be produced by 108. Choose odd one out w.r.t. chromosomal disorder
genotype AabbCcDd, when last two genes will show (1) Down’s syndrome
complete linkage?
(2) Klinefelter’s syndrome
(1) 2 (2) 4
(3) Turner’s syndrome
(3) 8 (4) 16
(4) Thalassemia
104. Find the probability of gametes having genotype
PqR for the three incompletely linked genes shown 109. Which of the following ascospore arrangement in
in the given below diagram ascus of Neurospora will confirm that crossing over
occurs at 4-strand stage?
! $ (1) 1 : 1 (2) 1 : 2 : 2 : 2 : 1
'()*+
" % (3) 2 : 4 : 2 (4) 4 : 4
,()*+ 110. In which of the following chromosomal abberrations
there is a change in gene number in a cell?
# &
(1) Inversion, Duplication
(2) Duplication, Deletion
(1) 8% (2) 4%
(3) Duplication, Translocation
(3) 60% (4) 30%
(4) Inversion, Translocation
105. The given pedigree shows
111. A heterozygous purple flowered sweet pea plant is
crossed with plant having genotype ccPP. What is
phenotypic ratio obtained?
(1) 1 : 1 (2) 3 : 1
(3) 15 : 1 (4) 9 : 7
(1) Allosomal recessive trait inheritance 112. In turtles ______ regulate(s) the sex determination.
(2) Autosomal recessive trait inheritance (1) Sex chromosome

(3) Allosomal dominant trait inheritance (2) Sex hormones
(4) Autosomal dominant trait inheritance (3) Environmental temperature
106. Choose the correct one w.r.t. effect of UV rays (4) Autosomes
(1) A G (2) T = T dimer 113. Point mutation in which change of nitrogenous
(3) A 2AP (4) G HX base changes the amino acid coded by it, is
called
107. In the given below figure what does (a) and (b)
represent (1) Silent mutation
.0. (2) Mis-sense mutation
$%&'()*&)((+,-!$#+.)/)
&1& (3) Non-sense mutation
(4) Same-sense mutation
45/1 !"# 114. Which of the following chromosome complement in

plant can show gigantism?
(1) PQRS (2) QRR
6"7 ,89 (:; 0<= 2=> !-# .7; (3) PPPP (4) PQQS
? @ A C B D E 115. Which of the following represents Protenor type of

sex determination system found in Dioscorea?
,-$+2)20%3)
(1) GAG, Glutamic acid (2) GUG, Valine (1) XX - XY (2) XX - XO
(3) GAG, Valine (4) GUG, Glutamic acid (3) ZW - ZZ (4) ZO - ZZ
116. Which of the following nitrogenous base is 124. Pattern baldness in human male is
methylated form of uracil? (1) Holandric trait
(1) Guanine (2) Thymine (2) Sex limited trait
(3) Adenine (4) Cytosine (3) Sex linked trait
117. Which set of gametes will be produced by the
(4) Sex influenced trait
genotype AaBbCc, if last two genes are completely
linked? 125. Which of the following disease occurs due to
frame shift or gibberish mutations?
(1) ABC, Abc, aBC, abc
(1) Thalassaemia (2) Alkaptonuria
(2) Abc, aBC only
(3) Tay sach’s disease (4) Haemophilia
(3) ABC, abc only
126. Which of the following is correct w.r.t. sickle cell
(4) ABC, ABc, AbC, Abc, aBC, aBc, abC, abc
anaemia?
118. Morgan worked with the tiny fruit flies - Drosophila
(1) Occurs due to point mutation involving transition
melanogaster, which were suitable for genetical
studies, as (2) In heterozygous condition, shows incomplete
dominance
a. They could be grown on simple medium
(3) An example of mis-sense mutation
b. They complete their life cycle in about two
weeks (4) At 6th position in beta chain, valine is replaced
c. Single mating could produce a large number of by glutamic acid
progeny flies 127. In a genotype AaBbCCDdEEFf if the first two genes
d. No clear cut sexual dimorphism is found are completely linked then how many types of
gametes can be produced?
(1) Only d is incorrect
(1) 24 (2) 22
(2) Both a and d are incorrect
(3) 21 (4) 23
(3) Only b is correct
128. Percentage population of phenotypically parental
(4) Both c and d are incorrect
type offsprings in the F2 generation of trihybrid test
119. Melandrium and Coccinia show which type of sex cross is
determination?
(1) 12.5 (2) 25
(1) XX–XY type (2) XX–XO type
(3) 37.5 (4) 50
(3) ZW–ZZ type (4) ZO–ZZ type
129. What would be the frequency of dominant allele in
120. In Drosophila, the individual with genotype 16 percent albinic human population?
AAA + XXY is considered to be
(1) 0.84 (2) 0.4
(1) Superfemale (2) Normal male
(3) 0.6 (4) 0.2
(3) Normal female (4) Intersex
121. All given disorders are examples of autosomal
dominant category, except Column-I Column-II
(1) Polydactyly (2) Brachydactyly a. Haemophilia (i) Rudimentary ovaries

(3) Cystic fibrosis (4) Huntington’s chorea b. Sickle cell anaemia (ii) X-linked recessive
122. Number of linkage groups in Drosophila is c. Turner’s syndrome (iii) Gynaecomastia
(1) 4 (2) 14 d. Klinefelter’s (iv) Autosomal
recessive syndrome
(3) 7 (4) 8
123. Autotriploid seedless banana can be produced by (1) a(ii), b(iv), c(i), d(iii)
parental cross between (2) a(ii), b(iv), c(iii), d(i)
(1) (AAAA) × (AAAA) (2) (AAA) × (AAA) (3) a(iv), b(ii), c(i), d(iii)
(3) (AA) × (AA) (4) (AA) × (AAAA) (4) a(iv), b(i), c(ii), d(iii)
131. Find the correct genotypes of the parents and other 138. If a cross is made between homozygous tall plant
offsprings, if the child has blood group ‘O’ father with yellow seeds (T T Y Y) and dwarf plant with
has blood group ‘A’ and mother blood group B yellow seeds (t t Yy). What proportions of tall and
Parental genotype Other offsprings yellow seeded offspring could be expected in
resulting generation?
Father Mother
(1) 54% (2) 100%
(1) IA IB IA IB IA IB
(3) 50% (4) 6.25%
(2) IA IO IB IO IB IO, IA IA, IB IB 139. Down’s syndrome and Klinefelter’s syndrome both
(3) IA IA IB IO IA IB, IA IO can be included in
(4) IA IO IB IO IB IO, IA IO, IA IB (1) Autosomal trisomy (2) Monosomy
132. Who noticed that the behaviour of chromosomes is (3) Trisomy (4) Allosomal trisomy
parallel to the behaviour of genes? 140. In human ABO group system _______ different
alleles allow the possibility of _______ different
(1) Temin and Baltimore
types of genotypes in population.
(2) Correns and Tschermak
(1) 3, 4 (2) 2, 4
(3) Beadle and Tatum (3) 3, 6 (4) 6, 3
(4) Sutton and Boveri 141. What is the percentage probability of getting
133. The males have only one X-chromosome besides offsprings with first recessive and rest heterozygous
the autosomes whereas females have a pair of traits from F2 generation of trihybrid test cross?
X-chromosomes in (1) 37.5 (2) 25
(1) Grasshopper (2) Humans (3) 50 (4) 12.5
(3) Birds (4) Drosophila 142. Which one of the following is incorrectly matched?
134. How many possible genotypes can be observed in (1) Patau’s syndrome – Autosomal
a human population for ABO blood group system? aneuploidy
(1) 3 (2) 6 (2) Sickle cell anaemia – Nonsense mutation

(3) Klinefelter’s syndrome – Very low sperm
(3) 10 (4) 4
count
135. Mark the correct option (w.r.t. recessive traits for (4) Cystic fibrosis – Mendelian disorder
garden pea plant)
143. A dihybrid organism (AaBb) is crossed to its pure
(1) Green pod and green seed recessive parent (aabb). What would be the
(2) Yellow pod and yellow seed phenotypic ratio if both loci are linked completely?
(3) Terminal and white flower (1) 1 : 1 : 1 : 1 (2) 3 : 1
(4) Wrinkled seed and inflated pod (3) 1 : 2 : 1 (4) 1 : 1

144. A pedigree analysis is given below
136. Experimental verification of chromosomal theory of
inheritance was given by
(1) Sutton and Boveri
(2) Thomas Hunt Morgan
(3) de Vries
(4) Mendal
Which of given genetic disorder can be explained
137. In a random mating population of 400 individuals,
using this presentation?
64% individuals are PTC tasters. Find out the
number of homozygous dominant individuals in the (1) Haemophilia
given population for this trait (2) Myotonic dystrophy
(1) 192 (2) 64 (3) Colour blindness
(3) 144 (4) 136 (4) Lesch Nyhan syndrome
145. Which of the type of mutation is represented by 150. Match the genetic phenomenon with their
the following diagram? respective ratios
Column I Column II
!"#"$"%"&"' !"#"$"%"&"'","-
(Genetic interaction) (Dihybrid
(")"*"+","- (")"*"+ phenotypic
ratio in F2
(1) Duplication generation)
(2) Translocation a. Inhibitory genes (i) 9 : 3 : 4
(3) Inversion b. Complementary genes (ii) 15 : 1
(4) Deletion c. Recessive epistasis (iii) 12 : 3 : 1
146. In given pedigree chart the genotype of diseased d. Duplicate genes (iv) 13 : 3
male will be e. Dominant epistasis (v) 9 : 7
(1) a(v), b(iv), c(iii), d(ii), e(i)
(2) a(iv), b(v), c(i), d(ii), e(iii)
(3) a(i), b(ii), c(iv), d(iii), e(v)
(4) a(ii), b(i), c(iv), d(v), e(iii)
151. The map distance between genes A and B is 3
units, B and C is 10 units, and C and A is 7 units.
The order of the genes in a linkage map
(1) Aa (2) aa constructed on the above data will be
(3) X CY (4) XY C (1) A, B, C (2) A, C, B
147. If three loci are completely linked, what would be (3) B, C, A (4) B, A, C
the phenotypic ratio in F2 generation of a trihybrid 152. Select a correct match
test cross?
Organism Linkage group
(1) 1 : 1 : 1 : 1 : 1 : 1 : 1 : 1 (1) Drosophila 8
(2) 3 : 1 (2) Neurospora 7
(3) 1 : 1 (3) Pisum sativum 14
(4) 1 : 2 : 1 (4) Oryza sativa 24
148. If two genes a and b are linked and shows 20% 153. In pedigree analysis symbol for heterozygous
recombination. The proportion of gametes produced autosomal recessive is
in F1 by a dihybrid ++/ab derived from a cross (1) (2)
between ++/++ and ab/ab would be
(3) (4)
(1) ++ 80% : ab 20%
154. If gene frequency for fused ear lobe is 0.6, then
(2) ++ 50% : ab 50% what will be the number of heterozygous fused ear
(3) ++ 40% : ab 40% : + a 10% : +b 10% lobe individuals in a population of 2000?
(1) 1180 (2) 1120
(4) ++ 20% : ab 20% : + a 20% : + b 20%
(3) 960 (4) 1440
149. If the sequence of bases of a DNA strand is
changed from ATT, GGC, CCC, TAT, to ATT, GGG, 155. Which of the following sets of gametes may be
CCC, TAT, it represents formed if genes present in F 1 hybrid having
genotype AaBb shows independent assortment?
(1) Silent mutation
(1) ab = 25%, AB = 75%
(2) Mis-sense mutation
(2) Aa = 50%, Bb = 50%
(3) Non-sense mutation (3) AB = 25%, aB = 25%, Ab = 25%, ab = 25%
(4) Frame shift mutation (4) AB = 50%, ab = 50%
156. Consider the cross PpQQRrSs × PpqqRRSs. Find 162. What is probability of homozygous individuals for
out the proportion of progeny with genotype both characters in F2 generation of a dihybrid
ppQqRRss in the resulting population. cross?
$ ! (1) 1/2
(1) (2)
!" "#
! ! (2) 3/4
(3) (4)
!" !"# (3) 1/3
157. The phenotype of an individual may be affected if
the modified allele produces (4) 1/4
A. The normal/less efficient enzyme
B. No enzyme at all 163. "
C. A non-functional enzyme
(2) C & A are correct
(3) Only B is correct !
(4) B & C are correct
158. Ability of a gene to have multiple phenotypic
What is the genotype of organisms a and b in the
effects is known as
pedigree?
(1) Co-dominance
(1) a – Aa, b – aa
(2) Pleiotropy
(3) Multiple allelism (2) a – aa, b – AA
(4) Incomplete dominance
(3) a – Aa, b – AA
159. Morgan and his group observed when the two
genes in a dihybrid cross were situated on the (4) a – aa, b – Aa
same chromosome, the proportion of parental gene
164. Choose correct option w.r.t. given figure for
combinations were much higher than the non-
determination of sex by chromosomal differences.
parental type, this is due to
(1) Independent assortment
(2) Linkage
(3) Crossing over
(4) Competence !" #"
160. Type of sex determination in Melandrium is
(1) XX - XY
(2) XX - XO
(3) ZZ - ZW
(4) ZO - ZZ $" %"
161. Phenylketonuria in humans is caused by the (1) b after spermatogenesis forms only one type of
absence of one liver enzyme required for synthesis gametes
of tyrosine from phenylalanine, this enzyme is
(2) b & c represents same sex
(1) Hexosaminidase B
(2) Phenylalanine tyrosinase (3) a, d are heterogametic
(3) Phenylalanine hydroxylase (4) Sex determination in d is similar to

(4) Tyrosinase grasshopper
165. Study the pedigree chart given below and select 168. Which of the following genetic disorder is caused
the set of correct statements. due to the presence of an additional copy of the
chromosome number 21?
!"#
(1) Patau syndrome
$ %
(2) Edward syndrome
!!"# (3) Cri-du chat syndrome

$ % ' & ( (4) Mongolism
169. If the frequency of an autosomal dominant allele is
!!!"# 0.6. Calculate the number of recessive phenotypic
$ % ' individuals in a population of 10000.
a. It shows inheritance of autosomal disease like (1) 6000 (2) 3600
cystic fibrosis (3) 1600 (4) 4800
b. Genotype of II-3 will be AA 170. Which one of the following statement is incorrect?
c. It shows inheritance of autosomal dominant (1) Sturtevant used the frequency of recombination
disease like polydactyly between gene pairs on the same chromosome
as a measure of the distance between genes
d. Genotype of I-2 will be Aa
(2) Sutton and Boveri argued that the pairing and
Correct statements are : separation of a pair of chromosomes would
(1) a, c (2) b, d lead to the segregation of a pair of factors they
carried
(3) a, d (4) a, b
(3) Y-linked genes are holandric
166. Mark the odd one (w.r.t. monohybrid cross for size
(4) 7 : 1 : 1 : 7 as linkage ratio in case of
of starch grain in Pisum sativum)
dihybrid test cross means that there are 8
(1) Phenotype of hybrid (F1) does not resemble parental and 8 recombinant plants
either of the parent
171. In ZZ-ZW type of sex determination
(2) In F 2 generation, 75% individuals show (1) Male individuals are heterogametic
phenotype of F1 generation
(2) Female individuals have two types of sex
(3) The effect in hybrid is intermediate of the chromosomes
expression of the two alleles
(3) Male individuals produce some gametes
(4) Phenotypic and genotypic ratios are same in without sex chromosomes
F2 generation (4) Male and female individuals both have two
167. Match the column I with column II types of sex chromosomes
Column I Column II 172. F1 progenies resemble both the parents in case of

(1) Dominant – recessive relationship between two
a. X-body (i) Sutton and Boveri
non-allelic genes
b. Linkage (ii) Wilkins and Franklin (2) Incomplete dominance
c. Chromosomal theory (iii) Henking (3) Alleles contributing the trait equally
of inheritance
(4) Traits controlled by more than one gene
d. X-ray diffraction data (iv) Morgan 173. If a cross is made between pure tall and hybrid
of DNA yellow seeded pea plant with hybrid tall and hybrid
(1) a(iv), b(ii), c(iii), d(i) yellow seeded pea plant then number of plants
hybrid for both traits in a population of 320 plants
(2) a(iii), b(iv), c(i), d(ii)
will be
(3) a(ii), b(i), c(iii), d(iv) (1) 40 (2) 80
(4) a(i), b(iv), c(ii), d(iii) (3) 120 (4) 160
174. Drosophila with genotype AA + XXXY will be a 179. Henking first observed sex chromosome in the
(1) Super female form of
(2) Normal female (1) Barr body (2) Y chromosome

(3) Intersex (3) X-body (4) Z chromosome
(4) Normal male 180. CML or Philadelphia syndrome occurs due to
175. In a hybridization experiment with three (1) Translocation (2) Deletion
heterozygous genes for seed shape, seed colour
(3) Pericentric inversion (4) Gene mutation
and pod colour in garden pea plant, the percentage
population obtained with green pod, round seed 181. Select the correct statement
and green cotyledon is (1) Edward’s syndrome is due to trisomy of 13th
(1) 14% chromosome
(2) 25% (2) AA + XXY condition is Jacob’s syndrome
(3) 12.5% (3) HGPRT deficiency leads to Gaucher’s disease
(4) 4.6% (4) In sickle cell anaemia 3 –CTC–5 on DNA
176. The figure below shows the chromosome template strand is mutated to CAC
segregation during germ cells formation with four 182. Mendel’s work on Pisum sativum shows that
stages labelled as (A), (B), (C) and (D). Select the
(1) Alleles show blending inheritance
right option giving all the four stages correctly
identified (2) F1 resembled either of the two parents
$/01-(23 (3) In a dissimilar pair of factors, members of the
pair are codominant
(4) Genotype of F2 tall plant can be determined by
cross with recessive parent
!"# !$#
183. In pedigree analysis, the meaning of symbol
!%# !&# '()*+,(--.
is
(1) (A) Interphase (B) Metaphase-I
(C) Telophase-I (D) Anaphase-II (1) Still birth
(2) (A) G1 (B) G2 (2) Dizygotic twin

(C) Anaphase-I (D) Anaphase-II (3) Mating between relatives
(3) (A) G1 (B) G2 (4) Sex unspecified
(C) Metaphase-I (D) Anaphase-I 184. Find the odd one (w.r.t. dominant traits in garden
(4) (A) G1 (B) G2 pea)
(C) Anaphase-I (D) Metaphase-II (1) Yellow pod colour
177. Males are heterogametic and females are (2) Violet flower colour
homogametic in (3) Yellow seed colour
(1) Human beings and birds (4) Full pod shape
(2) Fruit fly and butter fly
185. What is correct for AB blood group system?
(3) Grasshopper and cockroach
a. The effect of both the allelels of a gene is
(4) Birds and silkworm equally expressed.
178. What is the percentage probability of getting b. Produces intermediate phenotypic effect.
colour blind offsprings from carrier mother and
c. Blending of both alleles occurs.
colour blind father?
d. There is no intermediate phenotypic effect.
(1) 50% and 50% (2) 25% and 75%
(1) a, c, d (2) a, b, c
(3) 100% (4) 100% (3) a, d (4) b, c
186. All white eyed male Drosophila can be obtained 191. What is the percentage of very dark individuals in
from which one of the following cross? F2 if very dark and very light individuals are taken
as parents and this character is controlled by three
(1) Red eyed (homozygous) × white eyed pairs of genes?
(1) 36% (2) 3.56%
(2) Red eyed × white eyed
(3) 50% (4) 1.56%
(3) Red eyed (hetrozygous) × white eyed
192. How many diseases in the list given below are
Mendelian disorders?
(4) Red eyed × carrier
187. Which of the given genetic disorders (1 – 4) can be Thalassaemia, Klinefelter’s Syndrome,
explained using following pedigree chart? Colour-blindness, Down’s Syndrome,
Haemophilia, Cystic fibrosis, Phenylketonuria
(1) Four (2) Five

(3) Six (4) Seven
193. Read the following four statements (A–-D)
(1) Lesch Nyhan syndrome A. The characters never blend in heterozygous
(2) Sickle cell anaemia condition.
B. Change in a single base pair of DNA does not
(3) Muscular dystrophy
cause mutation.
(4) Glucose-6-phosphate dehydrogenase deficiency
C. Cancer cells commonly show chromosomal
188. Match Coloumn I with Column II aberrations.
Column I Column II D. In chicken, sex chromosomes in male are ZW
a. Super male (i) Trisomy of 13th and in females are ZZ.
chromosome How many of the above statements is/are right?
b. Patau’s syndrome (ii) 2n + 1 + 1 (1) Two (2) Three
c. Klinefelter’s syndrome (iii) AA + XYY (3) Four (4) One
d. Double trisomy (iv) 44 + XXY 194. Represented below is the inheritance pattern of a
(1) a(iii), b(i), c(iv), d(ii) certain type of traits in humans, which one of the
following conditions could be an example of this
(2) a(iii), b(iv), c(i), d(ii)
pattern?
(3) a(iv), b(iii), c(i), d(ii)
(4) a(iv), b(i), c(ii), d(iii) '(#$%& !"#$%&
189. In pea plant, the intermediate size of starch grains
is due to +(,-$#%&
)"*
(1) Dominant epistasis
(2) Codominance
(1) Cystic fibrosis (2) Colour-blindness
(3) Incomplete dominance
(3) Thalassaemia (4) Myotonic dystrophy
(4) Recessive epistasis
195. Number of linkage groups
190. Identify the correct number of gametes as well as
genotypes and phenotypes of progenies (1) Is seven for maize
respectively, produced in the self pollination of plant (2) Does not include sex chromosomes
with genotype of TtRRSSQqMM
(3) Is always equal to the number of diploid set of
(1) 4, 8, 4 (2) 3, 8, 3 chromosomes
(3) 4, 9, 4 (4) 4, 6, 4 (4) Is twenty four in human males
196. Drosophila was used by Morgan for his The best possible explanation of trait traced in the
experiments as above chart is
(1) It completes its life cycle in two months (1) Autosomal recessive
(2) Large size male can be easily grown on (2) Autosomal dominant
sucrose medium (3) X-linked dominant
(3) Hereditary variations can be seen with low (4) Y-linked
power microscope
202. If a true breeding white flowered Antirrhinum is
(4) More than one option is correct crossed with true breeding red flowered plant then
197. When the hybrids produced in a cross between what will be the phenotypic ratio of white and red
TTYYSS and ttyyss are selfed, the genotypes flowers in F2 generation of this cross?
TTYYSS, TtYYSS, TtYySS and TtYySs would be (1) 2 : 1 (2) 1 : 1
in a proportion of
(3) 3 : 1 (4) 1 : 2 : 1
(1) 1 : 9 : 6 : 8 (2) 1 : 3 : 4 : 27
203. Find out the sequence of genes on chromosome,
(3) 1 : 2 : 4 : 8 (4) 1 : 2 : 4 : 2 if crossover value between p and q, r and s, p and
198. Mr. Sohan with a genetic disease marries a s, q and r, p and r are 4%, 8%, 10%, 14% and
phenotypically normal woman. They have three 18% respectively
sons and three daughters; all of the daughters have (1) pqsr (2) pqrs
the same disease as their father, but none of the
sons is affected. Select the right choice. The (3) rpqs (4) spqr
disease is caused by 204. Which of the following pair is wrongly matched?
(1) An X-linked recessive allele (1) Factors – Discrete units
(2) An autosomal recessive allele (2) Multiple alleles – ABO blood group
(3) An autosomal dominant allele (3) Female Drosophila – Heterogametic
(4) An X-linked dominant allele (4) Inborn error – Phenylketonuria
199. Choose the correct sequence of location of 205. What is the percentage probability of getting non-
following traits of Pisum on chromosome parental genotypes population in resulting progeny
respectively if a plant with three heterozygous genes is crossed
with recessive traits for all the three genes?
!"#$%&#'(&")%!##*%+,-,./)%!##*%0&12#)
(1) 25 (2) 12.5
3,*%+,-,./
(3) 50 (4) 75
(1) 5, 7, 1, 4 (2) 4, 7, 1, 5
206. Identify the A, B & C in the following diagram w.r.t.
(3) 4, 1, 7, 5 (4) 1, 4, 7, 5 segregation of chromosomes during germ cells
200. Genotype of parent’s blood group which cannot formation.
produce same blood group type in genotype of
their offspring is ! " # $%&'()%**+
(1) IAIA and IAIB (2) IAIB and IBIB
(3) IAIB and IOIO (4) IAIB and IAIO
201. Given below is a pedigree chart showing the
inheritance of a certain trait in humans
(1) A – G2, B – Anaphase I, C – Anaphase II

(2) A – S, B – Metaphase I, C – Anaphase I
(3) A – G1, B – G2, C – Anaphase II
(4) A – G2, B – Metaphase II, C – Anaphase II
207. Morgan observed tight linkage in Drosophila with 212. Morgan coined the term recombination to describe
only 1.3 percent recombination for (1) Physical association of genes on a
(1) White eye and yellow body chromosome
(2) Normal wing and yellow body (2) Generation of new traits by mutation
(3) White eye and miniature wing (3) Linkage of two genes on different
(4) Yellow body and miniature wing chromosomes
208. Females are heterogametic with two sex (4) Generation of non-parental gene combinations
chromosomes in 213. Males are heterogametic with only one sex
(1) Fruitily chromosome besides the autosomes in
(2) Grasshopper (1) Grasshopper
(3) Moths (2) Birds
(4) Birds (3) Human
209. The possibility of a female becoming a haemophilic (4) More than one option is correct
is extremely rare because mother of such a 214. Same degree of polymorphism is obtained if DNA
female has to be at least is isolated from
(1) Carrier and father should be normal (1) Hair-follicle samples of two different organisms
(2) Carrier and father should be haemophilic (2) Blood and skin samples of same individual
(3) Haemophilic and father should be normal (3) Sperm samples of two different organisms
(4) Normal and father should be normal (4) More than one option is correct
215. Which of the following options gives one correct
210. Find correct match
example of dominant and recessive traits or
Column I Column II disorders?
a. Gynaecomastia (i) AA + XO !"#$%&%' ()*)++$,)-
b. Turner’s syndrome (ii) AA + XXY =>? !"##$%&'( )#"./$+,%8,'1#"
c. Down’s syndrome (iii) Autosomal =@? )*+,+--+#./+ 94$7/$:7'$;-%5*'"#+
recessive gene
=A? 0#,,'1%2'(/#(% <"'1$%2'(/#(%
d. Thalassemia (iv) AA + 1 + XX/XY !"#$#%&'() !"#$#%&'()
(1) a(ii), b(i), c(iv), d(iii) =B? 34-54,+"% 36'7'$/5%(6-7"'&*6

(6-7"'&*6
(2) a(ii), b(i), c(iii), d(iv)
216. Which of the following is a non-parental type of
(3) a(i), b(ii), c(iv), d(iii) progeny obtained by Morgan while carrying out
(4) a(iv), b(i), c(ii), d(iii) dihybrid cross?
! !
! "
211. Read the following statement having two blanks (A & B):
“The functioning allele, which represents the original (1)
phenotype is the !!!!"!!!! allele and the modified ! "
allele is generally the !!!!#!!!! allele”. (2)

! "
The one correct option for the two blanks is
! "
(1) A – Dominant B – Co-dominant
(3)
(2) A – Recessive B – Dominant ! "
! "
(3) A – Dominant B – Recessive
(4)
(4) A – Recessive B – Co-dominant
217. Which of the following pedigree chart represents 221. Which of the following is arginine rich histone
inheritance of hypertrichosis? protein?
(1) (1) H2A and H2B
(2) H3 and H4
(3) H3 and H1
(4) H1 and H4
(2)
SECTION - B

(A) is followed by a statement of reason (R).
(3) (1) If both Assertion & Reason are true and the
(4)
false, then mark (3)
218. How many kinds of genotype and phenotype will be statements, then mark (4)
produced respectively in trihybrid test cross?
1. A : Height expression in human beings is a
(1) 8 and 27 (2) 4 and 9 polygenic inheritance.
(3) 8 and 16 (4) 8 and 8 R : Three non-allelic gene pairs affect the same
219. Select incorrect option w.r.t. sickle cell anaemia character in the same way.
(1) It is an example of point mutation 2. A : In humans, minimum number of genes are
(2) It occurs due to base substitution i.e. transition present on holandric chromosome.
(3) Glutamic acid is replaced by valine at sixth R : Largest gene is sex linked gene.
position in polypeptide chain
3. A : Genes are synthesized artificially or may be
(4) Mutant haemoglobin molecule undergoes isolated and mapped while studying forward
polymerization under low oxygen tension genetics
220. By simply looking at the phenotype of a dominant
R : The products of genes are unknown
trait, it is not possible to know the genotypic
composition. To determine the genotypic 4. A : Dominant allele influences the appearance of
composition which of the following cross was phenotype even in presence of an alternative
performed by Mendel? allele.
(1) Selfing in dominant phenotype showing R : The product of dominant allele is said to be
organisms normal or unmodified giving full expression.
(2) Crossing between dominant phenotype 5. A : Gene controlling starch synthesis in pea shows
organism with recessive parent
a small degree of pleiotropy.
(3) Selfing in recessive parent
R : Heterozygous for the gene express large
(4) Crossing between heterozygous and starch grains as dominant but is incompletely
homozygous dominant parent dominant for seed shape.
6. A : One barr body is a characteristic of a Klinefelter 10. A : A reciprocal cross can distinguish between
human. nuclear and cytoplasmic inheritance.
R : Klinefelters are genetically XXY. R : It does not help to distinguish sex linked and
autosomal inheritance.
7. A : Sickle cell anaemia is resulted due to a
transversion. 11. A : In Turner’s syndrome, females lack secondary
sexual characters.
R : A pyrimidine 'T' is substituted by 'A' in DNA
sequence normally coding for glutamic acid. R : They have less number of autosomes than
normal female.
8. A : Human ABO blood group is an example of
12. A : Holandric genes are found on Y chromosome.
multiple alleles and codominance.
R : Inheritance of holandric genes is always from
R : Three alleles produce slightly different forms of
father to son.
the sugar.
13. A : A dihybrid always produces four kinds of
9. A : Non-disjunction of chromosomes at the time of gametes.
gametogenesis results in the gain or loss of a
R : Law of segregation and law of independent
chromosome in gametes.
assortment are always followed during
R : These mutations are called aneuploidy. gametogenesis.
!" !" !
Chapter 7
Cell : The Unit of Life

SECTION - A
Column I Column II
a. Cristae (i) Chromatin
1. Which one of the following cell organelle is not the b. Glycosylation (ii) Mitochondria
part of endomembrane system?
c. Rubisco (iii) Chloroplast
(1) Vacuole (2) Lysosome
d. Histones (iv) Golgi complex
(3) Golgi bodies (4) Peroxisome
(1) a(ii), b(iv), c(iii), d(i) (2) a(i), b(ii), c(iii), d(iv)
2. Choose incorrect statement
(3) a(i), b(iii), c(iv), d(ii) (4) a(iv), b(iii), c(ii), d(i)
(1) Leeuwenhoek first saw and described a living
8. The proteins in the cell membrane responsible for
cell facilitated diffusion
(2) Robert Brown discovered cell (1) Perform both uphill and downhill transport
(3) Electron microscope revealed all the structural (2) Require metabolic energy for their activity
details of cell
(3) Are under hormonal regulation
(4) A large cell has a higher volume : surface ratio
(4) Do not show transport saturation
than a smaller cell
9. Find out the incorrect match
3. The prokaryotic cells are represented by all,
except (1) Lysosome – Intracellular scavenging
(1) Red algae (2) Blue green algae (2) Golgi complex – Metabolism of xenobiotics
(3) Mycoplasma (4) Ray fungi (3) Elaioplast – Oil and fat storage
(4) Glyoxysomes – Gluconeogenesis
4. The ribosome of a polysome translate the mRNA
into 10. According to the universally accepted model of
plasma membrane
(1) ER (2) Protein
(1) More extrinsic proteins are found on the outer
(3) Phospholipids (4) rRNA face of membrane
5. The plasma membrane of human RBC contains (2) Extrinsic proteins show flip-flop movement
(1) 70% phospholipids and 30% sterols (3) Glycocalyx is exclusively present towards
(2) 52% proteins and 40% lipids outer face of membrane
(3) 40% proteins and 52% lipids (4) Certain extrinsic proteins also help in
transport across membrane
(4) 90% water and 10% integral proteins
11. Mark the correct statement
6. The lipid-like steroidal hormones are synthesized in
SER among (1) Histone proteins have lysine and arginine only
(2) Petite colony in yeast is a mitochondrial
(1) Hopanoid containing bacterial cell
character
(2) Plant cells
(3) RER is involved in detoxification of drugs
(3) Animal cells (4) 20 microtubules are present in the peripheral
(4) More than one option is correct part of centriole
238 Cell : The Unit of Life Last Leap for NEET (Part-I)
12. How many protofilaments are present in each 19. Thin, amorphous and cementing layer between
peripheral triplet of centriole? two adjacent cells, is
(1) 39 (2) Less than 39 (1) Primary wall (2) Middle lamella
(3) 9 (4) 26 (3) Secondary wall (4) Plasma membrane
13. Which of the following synthesizes proteins for 20. Choose incorrect statement regarding fluid mosaic
export? model of plasma membrane
(1) Free ribosomes (2) SER (1) Protein icebergs in sea of lipids
(3) Lysosome (4) RER (2) Glycolipid and glycoprotein present on outer
14. For the fluid mosaic model of membrane given by surface
Singer and Nicolson, which of the following (3) Extrinsic proteins in lipid bilayer cause flip-flop
conditions are not associated? movement
(1) Lipids enable the lateral movement of proteins (4) Two lipid layers are joined by hydrophobic
in the membrane attraction
(2) Fluid nature of membrane helps in secretion 21. Dictyosome is
(3) Lipids can show flip flop movement from one (1) Rough endoplasmic reticulum
layer of membrane to other
(2) Smooth endoplasmic reticulum
(4) Fluidity of membrane is mainly due to
(3) Non-connected cisternae in plants
oligosaccharides
(4) Interconnected cisternae in animals
15. Select the incorrect statement(s) w.r.t. functions
of various cellular components 22. Heterophagosome is
a. Middle lamella works as glue to hold the (1) Primary lysosome
adjacent cells together. (2) Secondary lysosome
b. Mitochondria, chloroplast and vacuoles are (3) Residual bodies
part of endomembrane system as their
functions are coordinated. (4) Autophagic vacuole
c. Lipoidal steroid hormones are synthesized by 23. Both chloroplast and mitochondria show similarity
ER component which is not associated to 80 in
S ribosomes. (1) Presence of DNA with more AT
(1) Only b (2) Only a (2) Presence of 70s ribosome
(3) Both a and c (4) Both b and c (3) Presence of porins
16. Select the correct match (4) More than one option is correct
(1) 70 ‘S’ ribosome – Bacterial mesosome 24. Choose incorrect match
(2) Cytoskeleton – Lipoproteins (1) Chloroplast – Thylakoid
(3) Kinetochore – Centromere (2) Golgi bodies – Cristae
(4) Lysosome – Catalase (3) Mitochondria – Oxisome
17. Which of the following disease is caused by (4) Centriole – Microtubules
failure of residual bodies to move out of the cell?
25. Which of the following is not associated with
(1) Albinism (2) Huntington’s chorea chloroplast of higher plants?
(3) Edward’s syndrome (4) Hurler’s disease (1) Thylakoid (2) Grana
18. Single envelope system is characteristic feature of (3) Quantasome (4) Pyrenoids
(1) Prokaryotic cell 26. Enzymes for -oxidation of fatty acids are found
(2) Eukaryotic cell in
(3) Mesokaryotic cell (1) Glyoxysome (2) Sphaerosome
(4) More than one option is correct (3) Peroxisome (4) Lomasome
Last Leap for NEET (Part-I) Cell : The Unit of Life 239
27. Cell organelle with property of detoxification of 35. Choose the correct statement regarding orthodox
drugs is state of mitochondria
(1) RER (2) Lysosome (1) It is an active state of mitochondria
(3) Sphaerosome (4) SER (2) Matrix is enlarged while outer chamber is
narrow
28. Chromosome found in oocytes of many animals
is (3) Mitochondria are actively engaged in
performing Krebs cycle, ETS and oxidative
(1) Lampbrush chromosome phosphorylation
(2) Polytene chromosome (4) Cristae are more randomly distributed and
(3) B-chromosome outer chamber quite large
(4) More than one option is correct 36. Find the correct statement regarding RER
29. How many microtubules are associated with the (1) It bears enzymes for modifying polypeptides
structure of centriole? (2) It takes part in detoxification of toxic
(1) 11 (2) 18 chemicals with the help of cytochrome 450
(3) 20 (4) 27 (3) It makes glycosomes
30. Plasma membrane is regarded as asymmetric (4) It forms sphaerosome and synthesizes
ascorbic acid
because
37. Microfilaments are
(1) It is made of phospholipid and protein
(2) Lipids in outer and inner side are different (1) Non-contractile & hollow fibrils
(3) Have permeases for facilitated diffusion (2) Contractile & hollow fibrils
(4) Proteins are like icebergs in sea of lipids (3) Contractile & solid fibrils
31. In condensed state of mitochondria (4) Non-contractile & solid fibrils

(1) ATP synthesis is reduced 38. Cilia and flagella in a eukaryotic cell
(2) Oxidative phosphorylation and ETS occurs at (1) Are motile at base
fast rate (2) Are made of 20 microtubules
(3) Intermembranal space becomes smaller (3) Are devoid of matrix and flagellar sheath
(4) Core or matrix is enlarged (4) Shows rotatory movement
32. What is true for plasma membrane? 39. Eukaryotic cells contain
(1) It is asymmetrical due to presence of (1) 70 ‘S’ ribosomes
glycocalyx at inner side only
(2) 70 ‘S’ and 80 ‘S’ ribosomes
(2) Lipids show flip-flop movement
(3) 80 ‘S’ ribosomes
(3) Extrinsic proteins are more abundant on the
outer surface (4) 70 ‘S’ and 60 ‘S’ ribosomes
(4) Percentage of carbohydrates is higher than 40. Choose incorrect statement regarding cells
proteins (1) Mycoplasma, the smallest cell, is only 0.3 m
33. The endomembrane system of cell includes in length while bacteria could be 3 to 5 m
(1) ER + Golgi body + Mitochondria (2) Haemoglobin associated human cells are
about 7 m in diameter
(2) ER + Golgi body + Vacuole + Microtubules
(3) ER + Golgi body + Lysosome + Vacuole (3) The shape of the cell may not vary with the
function they perform
(4) ER + Golgi body + Chloroplast + Lysosome
(4) Nerve cells are longest cells
34. Kinetochores are associated with
41. Robert Brown discovered a dense, spherical body
(1) Outer part of primary constriction in the cells of an ________ and named it as
(2) Centromere in its inner central part 'Nucleus'
(3) Secondary constriction (1) Acetabularia (2) Allium sativa
(4) Satellite (3) Orchid (4) Arceuthobium
42. Which of the following is true for microtubules? 50. In typical structure of plasma membrane
(1) Made up of proteins tubulin and actin a. The lipids are amphipathic
(2) Microtubules are restricted to animal cells only
b. Proteins are arranged asymmetrically and
(3) They are tube like branched cylindrical shows flip flop movement
structures
(4) T.S. of microtubules shows array of 13 rows c. Extrinsic proteins are abundant towards
of subunits cytoplasmic face
43. A group of characters that identifies a particular (1) All are correct
chromosome set is regarded as
(1) Idiogram (2) Karyotype
(3) Only c is correct
(3) Plasmon (4) Genome
44. Which of the following cell organelle is closely (4) Both a and c are incorrect
associated with ER & helps in formation of plasma 51. Ribosomes attach to endoplasmic reticulum by
membrane during cytokinesis?
their
(1) Centrosome (2) Sphaerosomes
(1) 50 ‘S’ sub-unit
(3) Golgi bodies (4) Ribosomes
45. Mitochondria are rich in _______ and their DNA (2) 60 ‘S’ sub-unit
have high _______ ratio (3) 40 ‘S’ sub-unit
(1) Mn, GC
(2) Mn, AT
52. Which of the following is not a membrane bound
(3) Zn, GC
cell organelle present in the cell of mango plant?
(4) Zn, AT
46. The ability of proteins to move laterally within the (1) Mitochondria (2) Chloroplast
overall bilayer lipid molecules of plasma membrane (3) Ribosome (4) Centriole
is measured as its
53. How many statements are incorrect amongst the
(1) Stability
following?
(2) Thickness
a. Microfilaments help in the formation of
(3) Degree of permeability
cleavage furrow during cell division
(4) Fluidity
47. Term 'Ergasome' explains b. Microtubules present in the cytoplasm are
highly labile
(1) mRNA associated with proteins
(2) ER cisternae associated with ribosomes c. Nuclear lamina is a network of acidic proteins
and intermediate filaments
(3) mRNA associated with group of ribosomes
(4) ER vesicles in sarcoplasmic reticulum d. Microtubules control orientation of microfibrils
48. 9 + 0 microtubule constitution with cartwheel in cell wall
structure is present in the proximal region of (1) One (2) Three
(1) Basal bodies (2) Kinetosomes
(3) Four (4) Two
(3) Blepharoplast (4) All of these
54. Neutral solutes directly pass through the lipid
bilayer of plasma membrane because
Column I Column II
(1) Plasma membrane has special carrier for
a. ER (i) Tubulin
them
b. Golgi complex (ii) Acid phosphatase
c. Lysosome (iii) Microsomes (2) They are lipid soluble
d. Microtubule (iv) Phragmosomes (3) They have specific hydrophilic areas for their
(1) a(iii), b(iv), c(ii), d(i) (2) a(i), b(iv), c(iii), d(ii) passage
(3) a(iii), b(ii), c(iv), d(i) (4) a(iii), b(i), c(iv), d(ii) (4) They consume ATP
55. Lateral loops are uncoiled or expanded parts of 60. Select the incorrect match
lampbrush chromosome with one to several
(1) Glyoxysome – -oxidation
transcriptional units. These loops are made up of
(2) Cell plate formation – Centrifugal
(1) DNA only
(3) Cleavage method of – Centripetal
(2) m-RNA only cytokinesis
(3) Protein only (4) Telomere – GC segments
(4) DNA + mRNA + protein 61. The central part of proximal region of centriole is
56. Why concentration of number of ions and other connected with peripheral triplets by radial
materials is higher in vacuole than cytoplasm? spokes. These spokes are made up of
(1) Vacuolar membrane is permeable for all (1) Protein (2) Fatty acid
substances (3) Oligosaccharide (4) Phospholipid
(2) Tonoplast facilitates transport against 62. Cell theory formulated by Schleiden and Schwann
concentration gradient does not explain which one of the following
(3) Vacuole is non-membrane structure features?
(4) Vacuoles store and synthesize ATP to absorb (1) Organisms are composed of cells and their
ions and materials products
57. Find the incorrect statement (2) All cells are basically alike in their structure
and metabolism
(1) Middle lamella is mainly made up of calcium
pectate (3) New cells originate from pre-existing cells
(2) Cell wall is formed on the inner side of the cell (4) The functions of an organism is an outcome
therefore secondary wall formed first of activities and interactions of its constituent
cells
(3) Middle lamella glues the neighbouring cells
together 63. Half membrane bound spherical structure
associated with synthesis and storage of fat is
(4) Cell wall helps in cell to cell interaction and
provides barrier to undesirable macromolecules (1) Sphaerosome (2) Peroxisome
(3) Ribosome (4) Palade granules
58. Transitional vesicles enclosing biochemicals
pinched off from ER fuse with 64. Mitochondrial DNA is
(1) Maturing face of golgi body (1) With high A-T content
(2) Forming face of golgi body (2) With high G-C content
(3) Primary lysosome for intracellular digestion (3) With low G-C content
(4) Plasma membrane to remove them from cell (4) Linear DNA with A-T/G-C ratio equal to one
59. According to fluid mosaic model of plasma 65. Cilia and flagella resemble in the
membrane the quasifluid nature of (1) Microtubular structure
(1) Protein enables lateral movement of lipids (2) Presence of basal granules
within the overall bilayer
(3) Mode of action
(2) Lipid and protein enable the lateral movement
of carbohydrates
66. Which of the following structure in a chromosome
(3) Lipid enables lateral movement of proteins
can be used as a marker?
within the overall bilayer
(1) Telomere (2) Satellite
(4) Lipid enables the flip-flop movement of
proteins (3) Chromocentre (4) Kinetochore
67. The enzymes present in lysosomes belong to the 74. Select the incorrect statement w.r.t. Golgi
class ________ and acidic condition inside the apparatus
lysosome is maintained by ________
(1) The cis and trans faces of the organelle are
(1) Oxidoreductases, pumping protons similar but interconnected
(2) Hydrolases, secretion of acids (2) The Golgi cisternae are concentrically
arranged near the nucleus
(3) Hydrolases, pumping of protons
(3) It remains in close association with the
(4) Lyases, removal of hydroxyl ions
endoplasmic reticulum
68. Find the odd one w.r.t. Lysosomal inefficiency
(4) The ER vesicles fuse with the cis face
(1) Hunter’s disease (2) Jacob’s syndrome
75. Which of the following sequence is correct w.r.t.
(3) Hurler’s syndrome (4) Tay-Sach’s disease size?
69. P450 found in SER is concerned with (1) Eukaryotic cell > PPLO > Viruses > Bacteria
detoxification of drugs and the mechanism (2) Eukaryotic cell > Bacteria > PPLO > Viruses
involved is basically a (3) Eukaryotic cell > PPLO > Bacteria > Viruses
(1) Methylation (2) Glycosylation (4) Eukaryotic cell > Viruses > PPLO > Bacteria
76. Which one of the following organelles is not
(3) Hydroxylation (4) Sulphation
associated with endomembrane system?
70. Naked DNA is found in (1) Golgi bodies (2) ER
(1) Chloroplast and leucoplast only (3) Glyoxysome (4) Vacuole
(2) Leucoplast and chromoplast only 77. Find the incorrect match
(3) Chloroplast and chromoplast only (1) Storage of protein – Aleuroplast

(2) Xenobiotic – RER
(4) All plastids detoxification
71. The endoplasmic reticulum, Golgi complex, (3) Digestive vacuoles – Heterophagosomes
lysosomes and vacuoles are considered together (4) Gluconeogenesis – Glyoxysomes
as an endomembrane system because
78. Which one of the following is not an example of
(1) These are present in eukaryotic cells constitutive heterochromatin?
(2) They lack DNA (1) Satellite (2) Telomere
(3) Primary constriction (4) Sex chromatin
(3) Their functions are coordinated
79. Both cilium and flagellum arise from the part
(4) They have cisternae which is structurally similar to
72. The outer as well as inner membrane of (1) Centriole (2) Kinetochore
mitochondria (3) Kinetosome (4) Centrosphere
(1) Form a number of infoldings towards the 80. Read the statements carefully and select the set
matrix of correct statements
(2) Both have similar amount of cardiolipin a. Palade particles are found in all cellular
organisms
(3) Have more lipids than proteins b. A membrane bound structure in nucleus is the
(4) Have their own specific enzymes site of ribosomal RNA synthesis
c. The mitochondria can divide meiotically to
73. What will be the ratio of number of microtubules
produce daughter mitochondria
in peripheral and central part of axoneme in a
d. Vacuoles can occupy about 90% of the volume
eukaryotic flagellum respectively?
of a plant cell
(1) 9 : 2 (2) 9 : 0 (1) All except b (2) a & c
(3) 9 : 1 (4) 27 : 0 (3) b & d (4) a & d
81. How many radial spokes and microtubules are (1) a(iii), b(iv), c(i), d(ii)
found in an axoneme of a eukaryotic flagellum (2) a(iv), b(ii), c(iii), d(i)
respectively?
(3) a(ii), b(iii), c(iv), d(i)
(1) 9 and 20 (2) 9 and 18
(4) a(ii), b(iii), c(i), d(iv)
(3) 18 and 18 (4) 18 and 20
87. ATP powers the movement of cilia and flagella in
82. How many microtubules are present in the eukaryotic cell. These ATP molecules are
axoneme part of eukaryotic flagellum? hydrolysed into ADP + iP in cilia and flagella by
(1) 9 (2) 27 the activity of
(3) 18 (4) 20 (1) Nexin protein (2) Dynein protein
83. Match the following (3) Myosin of muscles (4) Flagellin protein
Column I Column II 88. For the sectional view of chloroplast which is
given below. Choose the correct statement
a. Cristae (i) Dalton complex
b. SER (ii) NOR
c. Cisternae (iii) Cytochrome P450
d. Secondary (iv) Plastochondria
constriction
(1) a(iv), b(iii), c(ii), d(i) (2) a(iv), b(i), c(ii), d(iii) " !
(3) a(iv), b(iii), c(i), d(ii) (4) a(iii), b(iv), c(ii), d(i) (1) Envelope possess fully permeable
84. The human RBC membrane has approximately membranes
(1) 40% proteins, 52% lipids (2) ‘B’ possess the enzymes required for protein
and carbohydrate synthesis
(2) 50% proteins, 50% lipids
(3) ‘A’ structure giving piles of coins like
(3) 52% proteins, 40% lipids appearance is the site of C3 cycle
(4) 48% proteins, 50% lipids (4) ‘A’ Possess ribosomes, large ss circular DNA
85. Choose the correct match 89. Ribosomes attach to ER by its
Column-I Column-II (1) 50 S subunit (2) 60 S subunit
a. Membrane fluidity (i) Oligosaccharide (3) 40 S subunit (4) 30 S subunit
b. Detoxification (ii) TSD 90 All are membrane bounded cell organelles in a
c. Cells recognition (iii) Lipid typical plant cell, except
d. Residual bodies (iv) Cytochrome P450 (1) Mitochondria (2) Lysosome
(1) a(iii), b(iv), c(ii), d(i) (3) Ribosome (4) Chloroplast
(2) a(iii), b(iv), c(i), d(ii) 91. Lysosomal enzymes act at
(3) a(iv), b(iii), c(i), d(ii) (1) Basic pH
(4) a(ii), b(iv), c(i), d(iii) (2) Acidic pH
86. Match the following (3) Neutral pH
Column-I Column-II (4) Acidic pH inside lysosome and basic pH in

cytosol
a. ER (i) Packaging of material
92. Plasmodesmata connections help in
b. Cytoskeleton (ii) Dense granules
(1) Cytoplasmic streaming
c. Golgi complex (iii) Synthesis of steroidal
(2) Mitotic division
hormones
(3) Movement of substances between the cells
d. Ribosome (iv) Proteinaceous
structure (4) Osmosis only
93. How many statements are incorrect? 100. Vesicles from ER fuse with
a. Colchicine prevents assembly of (1) Maturing face of golgi body
microfilaments (2) Forming face of golgi body
b. Wall of microtubule is made up of 13 laterally (3) Primary lysosome for intercellular digestion
associated and helically arranged tubulin (4) Plasma membrane to remove them out from
proteins cell
c. Protofilaments are made of alternate spirals of 101. Fluidity of the cell membrane is measured
-tubulin and -tubulin (1) On the amount of cholesterol and protein in
d. Pectin controls orientation of cellulosic membrane
subfibrils (2) On the amount of carbohydrate in membrane
(1) One (2) Three (3) On the lateral movement of proteins within the
(3) Zero (4) Two overall bilayer
94. Which of the following feature is common in all (4) On the flip-flop movement of protein
types of plastids? 102. Which of the following cell organelle is a major
(1) Double membrane site for the synthesis of steroidal hormones?
(1) SER (2) Golgi bodies
(2) Presence of chlorophyll
(3) Ribosomes (4) Peroxisome
(3) Storage nature
103. The content of nucleolus is continuous with
(4) Presence of linear DNA nucleoplasm
95. A nuclear pore allows (1) Through microtubules
(1) Unidirectional movement of DNA (2) Through nuclear pores
(2) RNA movement only (3) Due to lack of membrane
(3) RNA and protein movement (4) Due to presence of channels in membrane
(4) Protein movement only 104. The part of chromosome beyond secondary
constriction is known as
96. Disc shaped proteinaceous structure attached to
centromere of a chromosome is called (1) Chromomere (2) Satellite
(1) Chromocentre (2) NOR (3) Kinetochore (4) Centromere
(3) Chromomere (4) Kinetochore 105. The central part of proximal region of centriole is
called hub which is made of
97. Which of the following cell structure is made by
(1) Protein (2) Lipoprotein
NOR?
(3) Phospholipid (4) Oligosaccharide
(1) Aleuroplast (2) Nucleolous
106. Which of the following cell organelle is associated
(3) Sphaerosome (4) Rough ER with muscles constriction by release and uptake
98. Correct statement in relation to vacuoles is of Ca++ ions?
(1) It is a triple membrane bound space found in (1) Vacuole
cytoplasm containing sap (2) Endoplasmic reticulum
(2) It can occupy 90% of cell volume in plants (3) Golgi complex
(3) Its membrane allows transport of materials (4) Microtubules
along the concentration gradient only 107. Middle lamella is first structure formed between
(4) Concentration of ions is significantly lesser in the newly formed daughter cells
vacuole than cytoplasm a. At the time of cytokinesis
99. Find out the incorrect statement b. And is composed of cellulose provided by
(1) Middle lamella is mainly made up of Ca- ribosomes
pectate c. Which is common wall between adjacent cells
(2) Cell wall is formed from inner side therefore d. Which get dissolved during ripening of fruit
secondary wall formed before primary wall (1) All are correct
(3) Middle lamella glues the different (2) Only b is incorrect
neighbouring cells together (3) Both b and c are incorrect
(4) Pits are present in secondary wall (4) Both a and d are incorrect
108. Glycosylation, general secretion and recycling of 115. In prokaryotes, ribosomal RNAs
broken plasma membrane are functions
specifically performed by (1) As well as proteins are synthesized in
cytoplasm
(1) Glyoxysome (2) SER
(3) RER (4) Golgi complex (2) Are synthesized in the nucleolus while
proteins in cytoplasm
(1) Elaioplast - Oil and fats storage (3) Are synthesized in the cytoplasm while
(2) Amyloplast - Carbohydrate storage proteins in nucleolus
(3) Proteinoplast - Protein storage (4) As well as proteins are synthesized in nucleus
(4) Aleuroplast - Starch storage 116. A number of proteins synthesized by ribosomes
110. A normally dividing plant cell may lack on the endoplasmic reticulum are modified in the
(1) Mitochondria (2) Nucleus ________ of the Golgi apparatus before they are
(3) Plastid (4) Ribosome released from its trans face
111. Many of the organisms show coordination in their (1) Tubules
functions and are considered together as an
endomembrane system. Find odd one out w.r.t. (2) Vesicles
this statement (3) Cisternae
(1) ER (2) Golgi complex
(3) Vacuole (4) Plastid
112. Which of the following is not a part of 117. How many microtubules are associated with the
cytoskeleton? structure of centriole?
(1) Microtubule (1) 9 (2) 18
(2) Microfilament (3) 27 (4) 11
(3) Intermediate filament
118. Granular endoplasmic reticulum is associated with
(4) Microfibril
which of the following functions?
113. Which of the following statement is correct for the
given diagram? (1) Synthesis of secretory as well as non-
! secretory proteins
"
$
(2) Synthesis of non-secretory proteins
# %
(3) Synthesis of steroidal hormones
(4) Synthesis of secretory proteins
119. Which of the following plastid store fats?
(1) Elaioplast (2) Aleuroplast
(1) ‘C’ possesses DNA molecule, RNA molecule (3) Proteinoplast (4) Amyloplast
and 80 S ribosomes
120. In plants, which of the following microbody is
(2) ‘A’ and ‘B’ have their own specific enzymes involved in photorespiration?
(3) ‘E’ made by inner membrane towards the inter
membrane space (1) Peroxisome (2) Sphaerosome
(4) ‘B’ forms the continuous limiting boundary of (3) Glyoxysome (4) Ribosome
the organelle
121. Cell organelle showing xenobiotics with the help
114. Select the incorrect statement w.r.t. prokaryotic
of Cytochrome P450 is also involved in
cells
(1) Cytoplasm lacks membrane bound organelles (1) Glycosylation process
(2) Sap vacuoles are absent (2) Glycolate oxidation or metabolism
(3) Chromosome possesses acidic protein i.e., (3) Glycogen metabolism
polyamine
(4) Lack streaming movement of cytoplasm (4) Glyoxylate metabolism
122. Lysosomes are membrane bound vesicular 128. Examine the figure given below and select the
structures and are very rich in part correctly matched with its function/structure
(1) DNAs, proteases and lipases !%# !&#
(2) Enzymes optimally active at the basic pH
(3) Almost all types of hydrolases
(4) RNAs, carbohydrase and cathepsin
123. Nucleolous organising region is
(1) Primary constriction
(2) Euchromatin region near satellite
!$#
(3) Heterochromatin region near secondary
constriction
(4) Basophilic secondary constriction !"#
124. Each centriole in a centrosome is made up of (1) Part (A): Ribosome-made up of 30S and 50S
nine subunits
(1) Peripheral triplets of flagellin protein (2) Part (C): RER - principally performs the
(2) Peripheral doublets of tubulin protein function of packaging materials
(3) Peripheral triplets of tubulin protein (3) Part (D): Nuclear pore - passage through
which movement of RNA takes place
(4) Peripheral triplets and two central singlets of
in one direction only
microtubules
(4) Part (B): SER - synthesis of steroidal
125. Ribosomes in prokaryotes
hormones
a. Are 70 S type
129. In plasma membrane, quasi-fluid nature of lipid
b. Form polysomes
(1) Enables flip-flop movement of proteins
c. Are not surrounded by any membrane
(2) Is essential for endocytosis only
d. Have 23 S rRNA in small subunit
(3) Enables lateral movement of proteins
(1) All are correct
(4) Enables flip-flop as well as lateral movements
(2) Only d is incorrect
of proteins
(3) Both c & d are incorrect
130. Which of the following statement for eukaryotic
(4) Only a is correct flagellum is correct?
126. Select an incorrect match (1) Basal body has nine pairs of doublets of
(1) Virchow – Omnis cellula-e cellula radially arranged peripheral microtubules
(2) Ribosomes – Palade particles (2) It emerge from a centriole like structure called
(3) Golgi complex – Polar structure axoneme
(4) Axoneme of flagella– Cart wheel structure (3) In axoneme, central tubules are connected by
bridge
127. Select incorrect statement w.r.t. plasma
membrane (4) It has a number of microfibrils running parallel
to the long axis
(1) Proteins can move laterally within the overall
bilayer 131. Elaioplasts, amyloplasts and aleuroplasts
(2) Proteins can be distinguished on the basis of (1) Contain ds DNA molecule
ease of extraction
(2) Store nutrients and pigments
(3) Cholesterol is present in all living organisms
(3) Store starch, fat and protein respectively
(4) Protein constitute 52 percent and lipid 40
percent for RBC (4) Divide by multiple fission
132. Which of the following statements are correct? 137. Select the odd one out w.r.t. chloroplasts
a. Rough endoplasmic reticulum is frequently (1) Found in mesophyll cells of the leaves
observed in the cells actively involved in (2) It contains small, double-stranded linear DNA
protein synthesis.
(3) Chlorophyll pigments are present in the
b. Proteins that are to be used outside the cell thylakoid membrane
are synthesised on free ribosomes. (4) Their ribosomes are smaller than cytoplasmic
c. In eukaryotic cell there is an extensive ribosomes
compartmentalisation of cytoplasm through 138. Endomembrane system in eukaryotic cell
the presence of membrane bound organelles
(1) Refers coordinated functions of all
d. ER is found prominently in human eggs and membranous cell organelles
sperms. (2) Includes both membranous and non-
(1) All are correct (2) b & d membranous cell organelles
(3) a, b & d (4) a & c (3) Does not include endoplasmic reticulum and
peroxisome
133. Which of the following organelle is not bounded
(4) Includes single membrane bound structures
by two lipoprotein membranes?
only
(1) Nucleus (2) Golgi body
139. Find correct match (column-I with column-II)
(3) Mitochondria (4) Plastid
Column I Column II
134. Pick the odd one out
a. Steroidal hormone (i) Golgi bodies
(1) Glyoxysome – oxidation of fatty acid
b. Lipochondria (ii) SER
(2) Peroxisome – Enzyme for peroxide c. Porins (iii) Microtubules
synthesis
d. - and -tubulins (iv) Plastids
(3) Sphaerosome – Synthesise and storage of
(1) a(ii), b(i), c(iv), d(iii) (2) a(ii), b(i), c(iii), d(iv)
fats
(3) a(iii), b(ii), c(iv), d(i) (4) a(i), b(ii), c(iii), d(iv)
(4) Mitochondria – Absence of enzymes in
outer membrane 140. In castor, lipid or fat is stored in
135. a. Cytoskeleton is proteinaceous and helps in (1) Aleuroplasts (2) Proteinoplasts

motility and cell division. (3) Elaioplasts (4) Amyloplasts
b. Endomembrane system includes GERL and 141. Select correct match w.r.t. the function of cell
peroxisome. organelles
c. Protein can show lateral movement in Column I Column II

membrane, dependent on lipids. a. Glycosylation (i) Peroxisome
(1) a, c are correct (2) b, c are correct b. Glycolate oxidation (ii) Chloroplast
(3) a, b are correct (4) All are correct c. Oxidation of (iii) Golgi bodies
triglyceride into
136. Select the incorrect statement
carbohydrates
(1) Movement of protein and RNA takes place in
both directions through nuclear pore d. Coupling factors (iv) Glyoxisome
CF0 – CF1
(2) Basal body of cilia or flagella is similar to
centriole by structure in eukaryotes (1) a(iii), b(i), c(ii), d(iv)
(3) Few chromosomes have non-staining (2) a(i), b(iii), c(iv), d(ii)
secondary constrictions at a constant location (3) a(ii), b(i), c(iv), d(iii)
(4) Microbodies are not present in plant cells (4) a(iii), b(i), c(iv), d(ii)
142. Which of the following statement is not related to 148. Read the following statements carefully:
centriole? A. Lipid component of the plasma membrane
mainly consists of phosphoglycerides.
(1) Made up of nine evenly spaced peripheral
fibrils of tubulin protein B. Polar molecules can pass through the lipid
bilayer of plasma membrane, therefore they
(2) Spindle fibres that give rise to spindle do not require carrier proteins to facilitate their
apparatus during cell division in plant cells transport.
(3) Central part of the proximal region is called C. Secondary wall is capable of growth and it is
the hub formed on the outer side of the cell.
D. Quasifluid nature of lipid enables lateral
(4) It form the basal body of eukaryotic flagella
movement of proteins within the overall lipid
143. Chloroplast differs from mitochondria in bilayer of plasma membrane.
(1) Having circular DNA and 70S ribosomes E. Middle lamella glues the different
neighbouring cells together.
(2) Phase of division or duplication during cell
How many statements are incorrect?
cycle
(1) Three (2) Five
(3) Having porins in outer membrane
(3) Four (4) Two
(4) Having enzymes for carbohydrate synthesis in 149. Membrane bound vesicular structures formed by
stroma the process of packaging in the Golgi apparatus
144. Organelles whose functions are coordinated (1) Contains materials not useful for cell and is
constitute endomembrane system, this includes bounded by half unit membrane
all, except (2) Contains all types of hydrolytic enzymes
optimally active at the acidic pH
(1) Lysosome
(3) Are concerned with photorespiration in plants
(2) Peroxisome and animals
(3) Golgi complex (4) Possess enzymes for Krebs cycle
(4) Endoplasmic reticulum 150. In the following diagram, select the part correctly
matched with its character or function.
145. Doublets of microtubules are visible in internal
structure of !
"
(1) Bacterial flagellum
(2) Centriole
(3) Nucleolus
(4) Axoneme of eukaryotic flagellum
146. Cytoskeleton performs many functions like #
mechanical support, motility in
(1) Protists (2) Cyanobacteria $
(1) A – The passage through which movement
(3) Methanogens (4) Viruses
of RNA and protein molecules take
147. A number of organised flattened membranous place in both direction
sacs are present in the (2) B – Frequently observed in cells actively
involved in lipid synthesis and secretion
(1) Matrix of mitochondria
(3) C – Membrane bound structures composed
(2) Nucleoplasm of deoxyribonucleic acid and proteins
(3) Chloroplasts (4) D – Provide surface for DNA and protein
synthesis
(4) Matrix of centriole
151. The organelle considered as the site of aerobic 158. Which one of the following is not a property of
respiration cell membrane?
(1) Produce cellular energy in the form of ATP (1) Polar molecules can not pass through the
hence called ‘Kitchen of cell’
nonpolar lipid bilayer
(2) Outer membrane forms number of infoldings
known as cristae (2) Depending on the case of extraction, proteins
can be classified in two types
(3) Divide by fission
(4) Matrix possesses single, circular and single (3) The quasi-fluid nature of protein enables
stranded DNA molecule flip-flop movement of lipid
152. Match the columns (I with II) (4) Ratio of protein and lipid varies considerably
Column-I Column-II in different cell types
a. Microbodies (i) Ribosome 159. Identify the cell organelles labelled as A, B, C and
b. Chromosome (ii) Sap vacuole D. Mark the correct option w.r.t. organelle and its
function.
c. Polysome (iii) Peroxisome !
d. Tonoplast (iv) Kinetochore
(1) a(iii), b(iv), c(i), d(ii) (2) a(ii), b(iv), c(i), d(iii)
(3) a(iii), b(ii), c(iv), d(i) (4) a(iv), b(ii), c(iii), d(i) "
153. Ribosomes are present in how many types of
semiautonomous organelles in animal and plant cell
respectively?
(1) One, two (2) Two, three
#
(3) Three, four (4) Two, one
$
154. Chromatin contains
(1) DNA, histone protein, basic non-histone (1) A – Major site for synthesis of lipid.
protein, dsRNA
(2) B – Performs the function of packaging
(2) DNA, basic histone protein, non-histone
materials, to be delivered to only
protein, RNA
intracellular targets.
(3) DNA, acidic histone protein, basic non-histone
protein, RNA (3) C – Sites of anaerobic respiration.
(4) DNA, acidic histone protein, non-histone (4) D – Main arena of cellular activities
protein, dsRNA
160. The spherical structures present in the
155. Membrane bound vesicular structures which nucleoplasm
contain digestive acid hydrolases are formed by
(1) Has contents continuous with rest of the
(1) Centrosome (2) Golgi bodies
nucleoplasm.
(3) Peroxisome (4) Nuclear envelopes
(2) Is a membrane bound structure.
156. Choose odd one w.r.t. composition of cell wall of
algae (3) Is a site of active messenger RNA synthesis
(1) Cellulose, galactans (2) Mannans, minerals (4) Are smaller and more numerous in cells
(3) Hemicellulose, pectin(4) Cellulose, minerals actively carrying out protein synthesis
157. Hub is connected with microtubules of the 161. Bacterial flagellum is composed of
peripheral triplets in
(1) Basal body, axoneme and centrosome
(1) Basal body of bacterial flagellum
(2) Basal body, hook and filament
(2) Centriole
(3) Axoneme of eukaryotic flagellum (3) Axoneme, basal body and tubulin protein
(4) More than one option is correct (4) Centriole, hook and axoneme
162. “Many organelles are considered together as an

SECTION - B
endo-membrane system because their functioning
is coordinated.” Assertion - Reason Type Questions
Which of the following statement gives the
correct explanation of this?
(1) Protein synthesised in Golgi bodies are reason is the correct explanation of the
modified in the ER assertion, then mark (1)
(2) Materials formed in ER fuse with the trans (2) If both Assertion & Reason are true but the
phase of Golgi bodies reason is not the correct explanation of the
(3) Lipids synthesised in ER are modified in the
Golgi apparatus
(4) Membrane bound vesicular structures formed (4) If both Assertion and Reason are false
by the packaging in ER work as lysosomes statements, then mark (4)
163. Match the following 1. A : Cell is considered as basic unit of life.
Column I Column II R : All organisms begin their life as a single cell.
a. Telocentric (i) V-shaped 2. A : Fruit colour changes from yellow orange to

green during ripening.
chromosomes R : There is conversion of chromoplasts into
b. Acrocentric (ii) L-shaped chloroplast.
chromosomes 3. A : As the cell grows, its surface to volume ratio
decreases.
c. Submetacentric (iii) J - shaped
R : Its capacity to exchange materials decreases.
chromosomes 4. A : Human RBC membrane has 52% protein.
d. Metacentric (iv) I - Shaped R : It possesses peripheral as well as integral
proteins.
chromosomes
5. A : During condensed stage the matrix of
(1) a(iv), b(iii), c(ii), d(i) mitochondria occupies large area.
(2) a(ii), b(iv), c(i), d(iii) R : Cristae formation is less.
(3) a(i), b(ii), c(iii), d(iv) 6. A : Endomembrane system is present in
eukaryotic cells.
(4) a(iii), b(ii), c(i), d(iv)
R : It comprises of peroxisomes, golgi complex,
164. Which of the following combination is correct? lysosomes and vacuoles.
(1) Xenobiotics – Rough endoplasmic 7. A : Several ribosomes attach to a single mRNA
reticulum and form a chain called polyribosome.
(2) Plasma membrane – 52% lipid of RBC R : Ribosomes are site of protein synthesis.
8. A : Lysosomes are associated with digestion of
(3) Mitochondria – Protein synthesis
biochemicals.
(4) Glyoxysomes – Photorespiration R : Lysosomes are rich in acid hydrolases.
165. Polysome refers to 9. A : Carotenoids are fat soluble pigments.
(1) Chain of volutin granules found in bacterial R : They are present in chromoplasts.
cytoplasm 10. A : The endomembrane system includes single
(2) PHB granules membrane bound as well as non-
membranous organelle.
(3) Chain of ribosomes attached to mRNA
R : They are all membrane bound organelles
(4) Free ribosomes in bacterial cytoplasm present inside the eukaryotic cells.
!" !" !
Chapter 8
Ecosystem
4. Pyramid of numbers in a grassland ecosystem is

SECTION - A
(1) Spindle shaped (2) Upright
(3) Urn shaped (4) Inverted
1. Which of the given below pyramids represents the 5. In hydrosere, sedge meadow stage replaces
variation in biomass at different trophic levels in
pond ecosystem? (1) Submerged stage
(2) Floating stage
#"
(3) Scrub stage
(1) !"
(4) Reed swamp stage
!! 6. What is correct for the diagram given below?
#"
(2) !"
!!
#"
(3) !"
!!
!"
(4)
!!
2. Choose the odd one out w.r.t. succession (1) It represents a food chain
(1) Succession and evolution are parallel (2) It could be accomodated by ecological
processes pyramid
(2) In abandon farmlands, primary succession
(3) Several types of organisms are available at
occurs
each trophic level
(3) Involves changes at every trophic level
(4) From producers to top carnivores, biomass
(4) Generally shows a trend from xeric to mesic
always increases
conditions
3. Net primary productivity 7. Rate of increase in energy containing organic
matter or biomass by heterotrophs or consumers
(1) For oceans is 60% of biosphere productivity per unit time and area is known as
(2) Depends upon the photosynthetic capacity of
(1) Gross primary productivity
transducers
(3) Remains constant in temperate area (2) Net primary productivity
throughout the year (3) Secondary productivity
(4) Limited by light in marine habitats only (4) Ecological efficiency
252 Ecosystem Last Leap for NEET (Part-I)
8. There are certain limitations of ecological 14. Which trophic position is occupied by the
pyramids, like decomposer microorganisms in an aquatic
(1) It does not take into account the same ecosystem?
species belonging to two or more trophic (1) T6
levels
(2) T7
(2) It assumes a long food chain of many trophic
levels (3) T2
(3) Saprobic organisms are not given any place (4) T5
(4) More than one option is correct 15. All given are characteristic features of man made
9. During primary succession in water body, the ecosystems, except
pioneers are _______, they are replaced by (1) Absence of self regulatory mechanism
________ with time
(2) These are part of noosphere
(1) Phytoplanktons, rooted hydrophytes
(3) High productivity in terms of GPP
(2) Free floating hydrophytes, rooted hydrophytes
(4) Little cycling of nutrients
(3) Phytoplanktons, free floating angiosperms
16. The type of productivity which is not available to
(4) Free floating angiosperms, sedges
any given trophic level is called as
10. Which of the following ecosystems show
maximum energy absorption? (1) Primary productivity
(1) Mixed forest (2) NPP
(2) Modern crops (3) Secondary productivity

(3) Terrestrial ecosystem (4) Net community productivity
(4) Grassland ecosystem 17. A detritus food chain
11. Ecological succession in which a community (1) Always ends up in a grazing food chain
replaces the other due to the modification of the
(2) Uses sun as the primary source of energy
environment by the community itself is
(1) Autogenic (2) Allogenic (3) Has minor contribution in productivity of coral
reef ecosystem
(3) Autotrophic (4) Heterotrophic
(4) Requires special organisms called detrivores
12. Find the incorrect statement in relation to mature as top consumers.
successional stages
18. Select a incorrect statement regarding pyramids
(1) Net community production is high and
inorganic nutrients are extrabiotic (1) These are proposed by Charles Elton
(2) Food chains are web like and predominantly (2) It does not explain the role of organisms
detritus present at more than two trophic levels
(3) Stratification and spatial heterogeneity is high (3) Decomposers are not given importance while
and well organised preparing a pyramid
(4) Good nutrient conservation and resistance to (4) It is sometimes upright, if prepared for energy
external disturbances 19. Which of the given pyramid can be spindle
13. Which one of the following is matched correctly? shaped?
(1) Low productive ecosystem – Flood plains (1) If prepared for numbers, for a tree having
grazing food chain
(2) Average productive ecosystem – Grassland
(2) If prepared for number in parasitic food chain
(3) Least productive ecosystem – Temperate
on a tree
forest
(3) If prepared for biomass of a tree
(4) High productive ecosystem – Area of
upwelling (4) If prepared for biomass in a Grassland
Aakash Educational Services Limited : Regd. Office : Aakash Tower, 8, Pusa Road, New Delhi-110005 Ph.011-47623456
Last Leap for NEET (Part-I) Ecosystem 253
20. GPP utilizes ___________ of incident radiation 27. Amount of living material present in different
trophic levels at a given time is called
(1) 1 – 5%
(1) NPP
(2) 2 – 10%
(2) Standing stage
(3) 0.8 – 4%
(3) Standing crop
(4) 1.6 – 8%
(4) Standing quality
21. Which of the following decides the nature of
climax? 28. In primary autotrophic succession, ecesis comes
after
(1) Types of soil and microorganisms
(1) Colonisation
(2) Prevailing climate of the area
(2) Invasion
(3) Nature of surface i.e. nude or not
(3) Migration
(4) Presence of organic matter / inorganic matter
(4) Reaction
22. Succession whether is primary or secondary, it
primarily requires ___________ to occur on a 29. Which one of the following food chain is dominant
area in aquatic ecosystem?
(1) Nudation (1) GFC
(2) Pioneer species (2) DFC
(3) Ecesis (3) Auxiliary food chain

(4) Parasitic food chain
(4) Reaction
30. Select a correct statement for Detritus Food
23. Find odd one w.r.t. climax community
Chain (DFC)
(1) Nutrient conservation is high
(1) Sun is the only source of energy
(2) Niche becomes more specialized (2) These systems are more productive than
(3) Biomass is high systems dominated by GFC
(4) Net community production decreases (3) It is composed of a long chain of decomposer
organisms
24. Annual grass stage in lithosere is followed by
(4) Tropical Rain forests are not dependent on
(1) Moss stage DFC
(2) Perennial grass stage 31. Which of the following productivity is the available
(3) Reed swamp stage biomass for the consumption by heterotrophs?
(4) Marsh meadow stage (1) Net primary productivity
25. Find odd one out w.r.t. sedge stage of hydrosere (2) Gross primary productivity
(3) Secondary productivity
(1) Cyperus
(4) Community productivity
(2) Typha
32. Arrange the following ecosystems in decreasing
(3) Juncus
order of productivity
(4) Carex (1) Sugar-cane field, coral reef, tropical rain
26. Out of total proposed cost of ecological services forest, estuary
by Robert constanza, maximum cost accounts for (2) Coral reef, estuary, sugarcane field, temperate
(1) Climate regulation forest
(2) Soil formation (3) Estuary, coral reef, temperate forest,

sugarcane field
(3) Nutrient cycling
(4) Tropical rain forest, coral reef, estuary,
(4) Habitat for wildlife sugarcane field
33. Key industry animals are 39. Which of the following is incorrect w.r.t.
(1) Primary consumers ecological pyramids?
(2) Secondary consumers (1) Pyramid of number for parasitic food chain on
single tree is inverted
(3) Tertiary consumers
(2) Pyramid of energy is always upright
(4) Primary producers
34. Mark the incorrect statement w.r.t. food chain (3) Pyramid of biomass for aquatic habitat is
upright
(a) GFC is the major conduit of energy flow in
aquatic ecosystem (4) Pyramid of number for grazing food chain on
single tree is spindle-shaped
(b) Source of energy in detritus food chain is not
sun 40. Select the correct statement
(c) Detritus food chain may be connected to (1) The number of trophic levels in the GFC is
grazing food chain never restricted
(d) In grazing food chain size of organisms (2) GFC is major conduit of energy flow in a
commonly decreases at higher level terrestrial ecosystem
(1) (a) & (b) (2) (a) & (c)
(3) Some of the organisms of DFC are prey to
(3) (c) only (4) (d) only the animals of GFC
35. The given pyramid represents ______parameter (4) In a natural ecosystem some organisms are
in _______ ecosystem omnivores, like fungi and actinomycetes
!" $% 41. Ecological pyramids

!! # (1) Assume a food web
(1) Number, pond (2) Take into account the same species
belonging to two or more trophic levels
(2) Standing crop, tree
(3) Do not include saprophytes
(3) Number, tree
(4) Involve consumers only
(4) Standing crop, pond
36. Shape of the pyramid explains the growth status 42. Trophic level of herbivore is
of a population, like Urn shaped pyramid reflects (1) T1 (2) T2
(1) A declining population (3) T3 (4) T4
(2) A population of developing country
43. In terrestrial ecosystems, the pyramids of number
(3) A population showing negative growth and biomass are generally
(4) More than one option is correct (1) Spindle shaped
37. Ecological pyramid of number can be ______ for (2) Upright
different ecosystems
(3) Upright and inverted respectively
(1) Upright (2) Inverted
(4) Inverted and upright respectively
(3) Spindle shaped (4) All of these
44. What is the pioneer community for hydrarch and
38. Number pyramid for tree ecosystem w.r.t. parasitic
food chain is xerarch succession respectively?
(1) Upright (1) Plankton, Annual grasses
(2) Spindle shaped (2) Lichens, Zooplankton
(3) Inverted (3) Plankton, Lichens

(4) Both upright and inverted (4) Free floating, Sedges
45. Pyramid of biomass in an aquatic habitats 50. Price tag put by Robert Constanza as nature life
explains that support services is __________ and of it ______
(1) High standing crop of phytoplanktons is for soil formation.
supports a large standing crop of (1) US $ 3.3 trillion, < 10%
zooplanktons
(2) US $ 330 trillion, 6%
(2) Energy at successive higher trophic level
increases (3) US $ 33 trillion, < 10%
(3) Phytoplanktons have shorter life span and (4) US $ 33 trillion, 50%
high annual productivity 51. Which of the following is not correctly matched?
(4) Consumers cannot survive for long (1) Productivity – Rate of biomass
46. Which stage of primary succession in a water production
body is shown in the figure given below? (2) Gross primary – Rate of production
productivity of earth of organic matter
during
photosynthesis
(3) Net primary productivity – Available biomass
(1) Scrub stage for consumption
(2) Reed swamp stage by heterotrophs
(3) Marsh meadow stage (4) Secondary productivity – Formation of new

organic matter by
(4) Submerged, free floating plant stage
producers
47. A part of energy captured by producers is used
52. !" #$
(1) As a food to herbivores only
!! %
(2) For maintenance and as a food to herbivores
Ecosystem which shows above pyramid of
(3) For synthesis of protoplasm only biomass possess ________ and _________
(4) For synthesis of ATP only pyramid of number and energy respectively.
48. In temperate lakes, phytoplanktons are (1) Inverted, upright (2) Upright, upright
(1) Completely absent in winter and summer (3) Upright, inverted (4) Spindle, upright
seasons
53. In hydrarch succession pioneer community is
(2) Abundant in spring season only phytoplankton and climax community is forest
(3) Abundant twice a year (mesic). Given below is name of seral stages,
arrange them in accordance with their
(4) Very less in autumn and spring seasons appearance.
49. Which of the following statements are concerned
a. Submerged free floating plant stage
with the organisms like antelope, grasshopper and
cow? b. Reed-swamp stage
a. Key industry animals c. Marsh-meadow stage
b. Third trophic level d. Submerged plant stage
c. Secondary producers e. Scrub stage

d. Predators (1) a, b, c, d & e
e. Primary consumers (2) b, a, c, d & e
(1) All, except (b) (2) All, except (b) & (d) (3) d, a, c, b & e
(3) All, except (d) (4) All, except (c) & (d) (4) d, a, b, c & e
54. Ecological pyramids 60. Out of the total cost of various ecosystem
(1) Include provision for seasonal and diurnal services, the soil formation accounts for about
variations (1) 50%
(2) Do not include decomposers and transducers (2) 35%
(3) Have no remedy for multi-level organisms (3) 60%
(4) Are based on food webs (4) 85%
55. Range of tolerance for all the factors influencing 61. The available biomass for the consumption to
a species distribution is consumers and decomposers is
(1) Ecotone (1) Gross primary productivity
(2) Ecological amplitude (2) Secondary productivity
(3) Phenotypic plasticity (3) Net primary productivity
(4) Edge effect (4) Trophic level efficiency
56. Rate of increase in biomass by heterotrophs or 62. Which one of the following statements is correct?
consumers per unit time and area is known as
(1) Trophic level of key industry animals is T3
(1) Gross primary productivity
(2) More energy flows in tropical rain forests
(2) Net primary productivity
through GFC
(3) Secondary productivity
(3) Diversity decreases from higher to lower
(4) Community productivity altitudes
57. Productivity in an ecosystem at producer level (4) Eastern Himalaya is an active centre of
depends upon evolution of flowering plants
(1) Availability of nutrients in soil 63. Pyramid of number is spindle - shaped in
(2) Photosynthetic capacity of plants (1) Tree ecosystem
(3) Variety of environmental factors (2) Pond ecosystem
(4) All of these
(3) Grassland ecosystem
58. Choose incorrect w.r.t. DFC
(4) Lake ecosystem
(1) Major energy flow in terrestrial ecosystem
64. Detritus Food Chain (DFC)
(2) Dominated by fungi and bacteria mainly
(1) Begins with living organic matter
(3) Begins with sunlight as source of energy
(2) Prevents wastage of energy bound in organic
(4) May be connected with GFC matter
59. Read the following statements :
(3) Provides organic nutrients to grazing food
(a) Warm blooded animals have larger body size chain
in colder areas as compared to animals of
(4) Is also called subsidiary food chain
warmer areas, is explained by Allen’s rule.
65. An ecosystem supported by 1000000 J of sunlight
(b) Each trophic level has a certain mass of living
material at a particular time called as the will have what amount of energy available to the
standing state. organisms of tertiary consumer level?
(1) Only (b) is correct (1) 1000 J
(2) Both (a) & (b) are incorrect (2) 100 J
(3) Only (a) is correct (3) 10 J
(4) Both (a) & (b) are correct (4) 10000 J
66. All succession wheather taking place in water or 70. A. GFC is major conduit of energy flow in aquatic
land proceeds to a similar climax community, that ecosystem.
is
B. Food chain maintains stability in an ecosystem
(1) Hydrosere (2) Xeric by providing alternate organisms at different
(3) Mesic (4) Halosere trophic level.
67. Various stages of succession in a water body are C. DFC may be connected to GFC.
given below, find correct set of their sequential (1) All are correct (2) A & B are incorrect
arrangement of occurrence.
(3) Only B is incorrect (4) B & C are correct
a. Submerged plant stage
b. Phytoplankton stage
SECTION - B
c. Scrub stage Assertion - Reason Type Questions
d. Forest In the following questions, a statement of assertion

(A) is followed by a statement of reason (R).
e. Marsh-meadow stage
f. Reed-swamp stage
g. Submerged free floating plant stage assertion, then mark (1)
(1) b, a, g, e, f, c, d (2) If both Assertion & Reason are true but the
(2) b, a, g, f, e, c, d reason is not the correct explanation of the
(3) b, a, e, g, c, f, d
(4) b, a, g, c, f, e, d
68. Amount of biomass or organic matter produced
per unit area over a time period by plants during
photosynthesis is known as
(1) Gross primary productivity 1. A : Desert ecosystems are less stable in
comparison to a tropical rain forests
(2) Net primary productivity
(3) Secondary productivity R : There is available more energy at last trophic
(4) Primary production level as the food chains are short
69. Which of the following statement is true for the 2. A : Complexity of food web is dependent over
given ecological pyramid? length of food chains
R : Complexity of food webs determine the

!" #$
stability of an ecosystem
!! %&
3. A : Ecological equivalents occupies same type of
(1) Small number of phytoplankton supports large niches but in different habitats
number of zooplankton
R : Similar ecosystems may develop in different
(2) Small biomass of primary producers supports geographical areas due to same climatic
large number of primary consumers in aquatic
conditions
habitats
(3) A large number of herbivores is supported by 4. A : The food chains are generally limited at 3-4
small number of producers in aquatic habitats trophic levels.
(4) A large standing crop of zooplankton is R : Autotrophs loose 20% energy, herbivores
supported by small standing crop of
30% and carnivores 60% during respiration.
phytoplankton
5. A : In an aquatic ecosystem, DFC is the major 7. A : In an aquatic ecosystem, DFC is the major
conduit for energy flow. conduit for energy flow.
R : Solar energy is required for energy supply in

R : DFC begins with living organic matter.
a DFC system.
6. A : In aquatic ecosystem, grazing food chain is
8. A : Detritus food chain (DFC) begins with dead
the major conduit of energy flow. organic matter.
R : Net primary productivity of aquatic ecosystem R : DFC may be connected with the grazing food
is more as compared to terrestrial. chain at some levels.
!" !" !
Chapter 9
Environmental Issues
SECTION - A 5. Choose the odd one out w.r.t. ozone depletion in

the stratosphere
(1) UV rays have the ability to both degrade as
1. Concentration of DDT for first trophic level and
fourth trophic level is respectively in aquatic food well as form ozone layer
chains
(2) UV rays are depleting the good ozone in the
(1) 0.04 ppm, 25 ppm troposphere
(2) 0.003 ppm, 2 ppm
(3) CFC’s are disturbing the balance of ozone
(3) 0.5 ppm, 2 ppm equilibrium
(4) 0.04 ppm, 2 ppm (4) UV-B rays cause inflammation of cornea
2. Cleaning of waste water in Arcata Marsh involves called colour blindness
(1) Only conventional method of sewage treatment 6. Rivet popper hypothesis was given by Paul
(2) Removal of dissolved heavy metals through Ehrlich to explain
biological process
(1) The cause of greater biological diversity in
(3) Filteration, chlorination like chemical processes tropics as compared to temperate regions
(4) Utilisation of microorganisms only for pollution
(2) Extinction of indigenous species due to
control
introduction of alien species
3. Eco-san toilets are not associated with which of
the following? (3) The role of ecological hotspots in biodiversity
(1) Are working in Sri Lanka and Kerala conservation
(2) Composting method for recycling of human (4) The importance of rich biodiversity in
excreta maintaining ecological health
(3) Recycled material forms natural fertilizer 7. Catalytic converters are fitted into automobiles for
(4) Enhance the need for chemical fertilizers reducing emission of poisonous gases. Which of
4. Choose the correct sequence of greenhouse the following reaction does not take place in
gases with respect to their relative contribution to catalytic converter?
global warming in increasing order
(1) Unburnt hydrocarbons – CO2 and water
(1) N2O, CFC, CH4, CO2
(2) Ozone – O2
(2) CFC, N2O, CO2, CH4
(3) Carbon monoxide – CO2
(3) CH4, N2O, CO2, CFC
(4) N2O, CO2, CH4, CFC (4) Nitric oxide – N2
260 Environmental Issues Last Leap for NEET (Part-I)
8. Which of the following is correct for the diagram 12. _________ was held in _________, and adopted
given below? the recommendations of CCC for reducing green
house gases.
(1) UNCED, Rio-de-Janeiro
(2) Earth Summit, Johannesburg
(3) Kyoto Protocol, Kyoto
(4) World Summit, Buenos Aires
13. Read the following statements in relation to
environmental pollution and find the correct
answer
a. Catalytic converters have platinum, palladium
and strontium as catalysts which are fitted into
automobiles for reducing poisonous gas
emissions
(1) (A) Dissolved oxygen, (B) Point of sewage
discharge, (C) BOD b. Motor vehicles equipped with catalytic
converters should not use unleaded petrol
(2) (A) BOD, (B) Point of treated water discharge, because lead in petrol activates the catalyst
(C) Dissolved oxygen
c. DDT disturbs calcium metabolism in birds
(3) (A) Dissolved oxygen, (B) Point of treated leading to thinning of egg shells
water discharge, (C) BOD
d. Cultural eutrophication refers to natural aging
(4) (A) BOD, (B) Point of sewage discharge, of a lake due to climate, size of lake and
(C) Dissolved oxygen man’s activities like effluents
9. The thickness of ozone over poles changes with
e. Montreal protocol to control emission of ozone
the season being lowest in depleting substances became effective in
(1) Antarctic spring 1987
(2) Polar autumn (1) Only a & d are incorrect
(3) Antarctic autumn (2) Only c is correct
(4) North hemisphere spring (3) b, c, d & e are correct
10. Mark the incorrect statement (4) a, d & e are correct
(1) CFCs, halons, methyl bromide, CCl4 and N2O
14. Greatest harm to human health is caused by
are responsible for O3 depletion
particle size __________or less, as suggested by
(2) The main precursors of acid rain are SO2 and CPCB
NO2 in atmosphere
(1) 2.5 micrometer (2) 10 micrometer
(3) Lichens and Mosses act as indices of
(3) 1 mm (4) 2.5 mm
atmospheric purity
(4) Blue baby syndrome is cause due to 15. Normal rain water is slightly acidic due to the
increased level of nitrates in air presence of
11. Photochemical smog has mainly (1) NOx (2) CO2
(1) SPM, O3 and CO (3) SO2 (4) O3
(2) O3, PAN and NOx 16. Find odd one out w.r.t. catalytic converters
(3) CO, H2S and PAN (1) Palladium (2) Rhodium
(4) H2S, SO2 and SPM (3) Platinum (4) Iron
Last Leap for NEET (Part-I) Environmental Issues 261
17. All the buses of Delhi were converted to run on 23. Select an incorrect statement
CNG by the end of 2002 as (1) Montreal Protocol became effective in 1989
(a) It is cheaper than petrol or diesel as Helsinki declaration
(b) It burns more efficiently (2) Lichens are indicators of SO2 pollution
(c) It can easily be siphoned off (3) There are proposed 5 'F's of Chipko
movement
(1) All are correct
(4) Slash and Burn agriculture is very popular
(2) Both (a) and (c) are correct
among western states of India
(3) Only (c) is incorrect
24. Biomagnification of DDT causes all except
(4) Both (b) and (c) are correct
(1) Thinning of egg shell in birds
(2) Liver cirrhosis
(1) Black foot – Arsenic
(3) Cyanosis
(2) BOD – Lower than COD
(4) Softening of brain and haemorrhage
(3) DDT – Bio-magnification
25. Match the following w.r.t. pollution
(4) Minamata – e-waste Column I Column II
19. What occurs when sewage is discharged in a (a) Incineration (i) Soil erosion
flowing water (lotic) body?
(b) Green Muffler (ii) Third poison
(1) BOD decreases initially (c) Ground water pollution (iii) Solid waste
(2) BOD decreases with decreasing DO finally (d) Negative pollution (iv) Noise pollution
(3) DO Increases initially but decreases finally (1) a(iii), b(iv), c(ii), d(i)
(4) DO decreases and BOD increases initially (2) a(iii), b(iv), c(i), d(ii)
20. If carried out in ecofriendly manner, (3) a(iv), b(iii), c(ii), d(i)
____________ is the only method for treatment (4) a(ii), b(iv), c(iii), d(i)
of e-waste
26. Which one of the following is known as chemical
(1) Open burning (2) Recycling weed?
(3) Pyrolysis (4) Incineration (1) Amaranthus
21. Global warming is a global threat to environment (2) Chlorofluorocarbon
due to its given major effects, except (3) Ozone
(1) It will lead to melting of ice caps (4) Halons
(2) It will change the global climate 27. Select an incorrect match
(3) There will be cooling of stratosphere and (1) Photochemical smog – O3 + PAN + NOx
warming of trophosphere (2) Classical smog – SO2 + H2S + NOx +
(4) It will maintain earths average temperature H2O
at 15°C (3) SPM – Mist, Dust, Aerosol,
22. 'Ozone depletion' means thinning of ozone layer Flyash
during spring season and (4) Indoor pollution – HCHO
(1) This will allow UV – A to enter stratosphere 28. Organic enrichment of lakes is also considered to
which will cause snow blindness be “death of lakes” and is associated with
(2) This is caused by N2O as major pollutant (1) Increases DO
(3) Ozone is released during this as O2 or ClO (2) Decreased BOD
(4) First large hole was discovered over north (3) Decreased non-biodegradable components
pole (4) Growth of algal blooms
29. Global warming is caused by green-house gases 36. Select the incorrect match
and is supposed to be responsible for many (1) ESP – SPM
possible negative effects, but some positive
effects are also there, like (2) Land fills – Solid waste
(1) Rising of sea level (3) Catalytic converter – Aerosol
(2) Changing the rainfall pattern, helping proper (4) Ear muffs – Noise pollution
distribution of H2O 37. Read the following statements and select the
(3) Maintaining earth’s average temperature at right choice.
present value a. Use of incinerators is crucial to disposal of
(4) Warming of trophosphere hospital wastes.
30. Which of the following will not suffer from b. Dobson units are used to measure oxygen
minimata disease? content.
(1) Rabbit c. Methane and carbondioxide are greenhouse

gases.
(2) Seal
d. The Montreal protocol is associated with the
(3) Fish control of emission of ozone depleting
(4) More than one option is correct substances.
31. Mark the correct one w.r.t. Los Angeles smog (1) a & b are correct (2) Only d is correct
(1) It contains H2S and SO2 (3) Only b is incorrect (4) b, c & d are correct
(2) There is no role of secondary pollutant 38. Euro-II norms stipulate that sulphur be controlled
(3) Formed at low temperature at
(4) Its components can inhibit ETS (1) 350 ppm in diesel and 150 ppm in petrol
32. Mark the incorrect statement (2) 50 ppm in petrol and 100 ppm in diesel
(1) Ozone is a friend at troposphere and foe at (3) 150 ppm in diesel and 350 ppm in petrol
stratosphere (4) 100 ppm in petrol and 50 ppm in diesel
(2) It is continuously formed by the action of UV- 39. Catalytic converters have expensive metals and
rays on molecular oxygen and also degraded can convert
into molecular oxygen in the stratosphere
(1) N2 NOx
(3) Montreal Protocol was signed at Canada in
1987 to control the emission of ODS (2) CO2 CO
(4) The thinning of ozone layer is known as (3) NOx N2

ozone hole (4) More than one option is correct
33. Horizon of soil profile characterized by leaching of 40. Pick the correct set of gases labelled A, B, C and
minerals i.e., eluviation is called D in the given figure showing their respective
(1) O horizon (2) A2 horizon contribution to global warming
!"
(3) B1 horizon (4) C horizon
#$" )
34. Brown air or haze is produced by *
(1) NOX (2) SO2 ' !&"
(
(3) VOC’s (4) CO %&"
35. Flammingoes, cormorants or cranes will be

harmed the most if the aquatic system is polluted (1) A – CFCs, B – CH4, C – CO2, D – N2O
by (2) A – CO2, B – CH4, C – CFCs, D – N2O
(1) NOX (2) Fertilizers (3) A – N2O, B – CH4, C – CO2, D – CFCs
(3) DDT (4) Domestic sewage (4) A – CO2, B – CFCs, C – CH4, D – N2O
41. There is a sharp decline in dissolved oxygen in a 47. Select incorrect statement
canal from the point of sewage discharge. The (1) Photochemical smog has mainly O3, PAN and
BOD of water NOx
(1) Rises as water flows (2) CFC is most effective green house gas
(2) Remains constant (3) Biodiversity decreases from lower to higher
(3) First rises and then declines as water flows altitudes and increases from lower to higher
latitudes
(4) First declines and then rises as water flows
(4) Dodo and Tasmanian wolf have become
42. High concentration of DDT disturbs/causes
extinct due to overexploitation
(1) Potassium metabolism in birds
48. What is the relative contribution of CFCs to global
(2) Thinning of egg shell in birds warming?
(3) Stone leprosy
(1) 60% (2) 20%
(4) Hearing abilities of humans
(3) 14% (4) 6%
43. Greenhouse gas which causes maximum
contribution to global warming is 49. Read the following statements carefully
(1) CO2 (2) CH4 a. Montreal protocol was signed in 1987 to
control the emission of ODS
(3) CFC (4) N2O
b. By the end of twentieth century the forest
44. High concentration of DDT in birds disturb the
metabolism of cover shrunk to about 30 percent
(1) Magnesium (2) Iron c. Integrated organic farming is a cyclical, zero

waste procedure, that allows maximum
(3) Calcium (4) Phosphorus utilisation of resources and increase the
45. Select the correct option respectively w.r.t. A, B, efficiency of production
C and D in the given figure of relative contribution
d. Biomagnification refers to increase in
of various greenhouse gases to global warming
concentration of toxic substances at lower
%
"$
trophic level only
&
'($ (1) a & c are correct (2) a & d are correct
(3) Only d is correct (4) Only b is incorrect
50. Mark the incorrect match
)
*#$
(1) Noise pollution – Dobson unit
! (2) National Forest Policy – 1968
"#$
(3) Terror of Bengal – Eutrophic water
bodies
(1) Carbon dioxide, CFCs, methane, N2O
(2) Carbon dioxide, methane, CFCs, N2O (4) Water (Prevention and – 1974
Control of Pollution) Act
(3) Carbon dioxide, N2O, CFCs, methane
51. Which of the following option is incorrect about
(4) Carbon dioxide, CFCs, N2O, methane
effects of air pollutants on human health?
46. Mark the incorrect statement
(1) Deleteriously affect respiratory system in
(1) Good ozone acts as shield absorbing humans
ultraviolet radiations from sun
(2) Harmful effects depend on concentration of
(2) Ozone causes odd climatic changes i.e., El-
pollutants and duration of exposure
nino effect
(3) Good ozone is found in upper part of (3) Particulate size 2.5 micrometer or less in
atmosphere diameter are responsible for causing the
greatest harm
(4) Ozone depletion is occurring widely in the
stratosphere region (4) Phaeophytization
52. Which of the following effects are related with the 56. Amrita Devi Bishnoi Award is given for individuals
use of DDT? or communities from rural areas that have shown
a. Accumulates in human being as it cannot be extra-ordinary courage and dedication in
metabolised or excreted. (1) Protecting wildlife
b. Disturbs calcium metabolism in birds causing
(2) Minimising the ODS
thinning of egg shells.
(3) Organic farming
c. Responsible for decline in population of fish
eating birds. (4) Biotechnology
Select the correct option. 57. Most harmful size of SPM is
(1) Only a & b are correct (1) PM 10 (2) PM > 10
(2) a, b & c are correct (3) PM 2.5 (4) PM 100
(3) Only b & c are correct 58. Electrostatic precipitators are used in thermal
(4) Only c is correct power plants for the
53. Cultural eutrophication (1) Conversion of NOx to nitrogen
(1) Is natural aging of water body (2) Removal of SO2
(2) Is accelerated aging of water body due to (3) Removal of particulate matter
human activity
(4) Conversion of CO to CO2
(3) Takes thousand of years
59. According to Euro-II norms amount of sulphur in
diesel should be controlled at
54. Polyblend, a fine powder of recycled modified
plastic is mixed with bitumen to lay roads, which (1) 350 PPm (2) 50 PPm
help to increase road life by a factor of (3) 250 PPm (4) 150 PPm
(1) Two (2) Three 60. Which of the following device can remove over
(3) Four (4) Five 99% of particulate matter present in the exhaust
55. Consider the following four statements (a–d) from a thermal power plant?
related to greenhouse effect and global warming (1) Wet scrubbers
and select the correct option stating which ones
are true (T) and which ones are false (F). (2) Bag filters
Statements : (3) Cyclone collectors
a. Greenhouse effect is responsible for (4) Electrostatic precipitators (ESP)
maintaining average earth temperature at
61. Match Column-I with Column-II w.r.t. trophic level
18°C.
and their example
b. CO2, CH4, CFC, N2O are greenhouse gases
Column I Column II
c. Rise in temperature is leading to deleterious
changes in the environment and resulting in a. Primary producer (i) Lion
odd climatic changes (El Nino effect)
b. Primary consumer (ii) Phytoplanktons
d. Montreal protocol is for biodiversity
conservation and control of GHGs. c. Secondary consumer (iii) Grasshopper
a b c d d. Tertiary consumer (iv) Fishes
(1) T T F F (1) a(ii), b(iv), c(iii), d(i)
(2) F F T T (2) a(ii), b(iii), c(iv), d(i)

(3) F T T F (3) a(iii), b(ii), c(iv), d(i)
(4) T F F T (4) a(ii), b(iv), c(i), d(iii)
62. Select odd one w.r.t. measures to control global (1) c a d b (2) a c b d
warming
(3) c d a b (4) a d c b
(1) Improving efficiency of energy usage
68. Find correct set of relative contribution of
(2) Cutting down use of fossil fuel greenhouse gases to global warming.
(3) Slowing down the growth of human
(A) CO2 (B) CH4
population
(C) CFCs (D) N2O
(4) Increasing deforestation
(A) (B) (C) (D)
63. Calcium metabolism in fish eating birds get
disturbed, if there is high concentration of (1) 20% 14% 60% 6%
(1) Urea (2) DDT (2) 14% 60% 6% 20%
(3) Cadmium (4) CFC (3) 60% 20% 14% 6%
64. It has been recommended that storage of nuclear
(4) 20% 6% 60% 14%
waste, after sufficient pre-treatment, should be
done in suitably shielded containers buried within 69. Choose incorrect w.r.t. greenhouse effect
rocks, about _______ deep below the earth’s
(1) Warming of troposphere
surface.
(2) Melting of ice caps
(1) 100 m (2) 50 m
(3) 500 m (4) 200 m (3) Snow blindness
65. Find out the correctly matched pair (4) CO2 fertilization effect
(1) Water (Prevention and Control of Pollution) SECTION - B

Act – 1981
(2) Integrated organic farming – Cyclical zero
waste procedure In the following questions, a statement of assertion
(3) Air (Prevention and Control of Pollution) (A) is followed by a statement of reason (R)
Act – 1974 (1) If both Assertion & Reason are true and the
(4) Snow-blindness – Caused by methyl reason is the correct explanation of the
isocyanate assertion, then mark (1)
66. Find odd one w.r.t. primary pollutants. (2) If both Assertion & Reason are true but the
(1) CO (2) H2S reason is not the correct explanation of the
(3) PAN (4) SO2
67. Arrange the following in the correct sequence of (3) If Assertion is true statement but Reason is
increasing order of DDT concentration false, then mark (3)
1. A : Noise pollution is now considered as a kind of
a. b.
air pollution
R : In 1987, it becomes as part of amended
air act.
2. A : Royal waste causes mutations to occur at a
very high rate
c. d.
R : UV-causes formation of thymine dimers in
DNA
3. A : Electrostatic precipitator is most efficient in R : Leaded petrol should be used as lead

removing particulate matter. activates these catalysts.
R : It can remove over 99% of particulate matter 6. A : Integrated organic farming is a cyclical zero
present in the exhaust from thermal power waste procedure.
plant.
R : It uses waste products of one process as
4. A : Electrostatic precipitator can remove over
nutrients in other process.
99% particulate matters present in the
exhaust. 7. A : Biomagnification is increase in concentration
R : It has cathodes only. of a growth factor at successive trophic levels.
5. A : Catalytic converter has platinum, palladium R : This phenomenon is well known for biological
and rhodium as the catalysts. fungicides.
!" !" !
Last Leap for NEET (Part-I) Answers 267
ANSWERS
CHEMISTRY
Chapter 1 : Structure of Atom
Section A : Objective Type Questions
1. (4) 2. (2) 3. (2) 4. (1) 5. (3) 6. (2) 7. (3)
8. (2) 9. (2) 10. (4) 11. (3) 12. (1) 13. (3) 14. (2)
15. (2) 16. (2) 17. (1) 18. (4) 19. (3) 20. (1) 21. (2)
22. (4) 23. (2) 24. (1) 25. (3) 26. (1) 27. (4) 28. (3)
29. (2) 30. (4) 31. (3) 32. (1) 33. (1) 34. (1) 35. (4)
36. (2) 37. (4) 38. (4) 39. (3) 40. (2) 41. (2) 42. (3)
43. (1) 44. (3) 45. (1) 46. (4) 47. (3) 48. (3) 49. (1)
50. (3) 51. (1) 52. (2) 53. (3) 54. (1) 55. (1) 56. (4)
57. (1) 58. (2) 59. (3) 60. (4) 61. (2) 62. (3) 63. (4)
64. (2) 65. (4) 66. (1) 67. (1) 68. (1) 69. (4) 70. (1)
71. (2) 72. (3) 73. (4) 74. (3) 75. (1) 76. (4) 77. (2)
78. (4) 79. (4) 80. (4) 81. (3) 82. (4) 83. (3) 84. (2)
85. (4) 86. (1) 87. (1) 88. (4) 89. (1) 90. (1) 91. (4)
92. (1) 93. (1) 94. (3) 95. (4) 96. (1) 97. (2) 98. (4)
99. (1) 100. (4) 101. (1) 102. (1) 103. (2) 104. (2) 105. (1)
106. (3) 107. (3) 108. (1) 109. (3) 110. (1) 111. (3) 112. (3)
113. (3) 114. (1) 115. (2) 116. (1) 117. (1) 118. (2) 119. (4)
120. (4) 121. (4) 122. (1) 123. (3) 124. (4) 125. (3) 126. (2)
127. (4) 128. (2) 129. (2) 130. (1) 131. (1) 132. (1) 133. (3)
134. (4) 135. (3) 136. (4) 137. (1) 138. (1) 139. (2) 140. (4)
141. (4) 142. (4) 143. (4) 144. (3) 145. (1) 146. (1) 147. (3)
148. (4) 149. (4) 150. (3) 151. (3) 152. (3) 153. (3) 154. (4)
155. (2) 156. (3) 157. (1) 158. (3) 159. (3) 160. (3) 161. (2)
162. (2) 163. (3) 164. (4) 165. (1) 166. (4) 167. (3) 168. (2)
169. (4) 170. (3) 171. (1) 172. (2) 173. (4) 174. (1) 175. (4)
176. (4) 177. (3) 178. (3) 179. (3) 180. (4) 181. (4) 182. (4)
183. (4) 184. (2) 185. (3) 186. (4) 187. (2) 188. (1) 189. (3)
190. (2) 191. (2) 192. (1) 193. (3) 194. (2) 195. (4) 196. (1)
197. (1) 198. (3) 199. (2) 200. (4) 201. (1) 202. (2) 203. (4)
204. (4) 205. (2) 206. (4) 207. (2)
Section B : Assertion-Reason Type Questions
1. (2) 2. (2) 3. (1) 4. (4) 5. (2) 6. (2) 7. (2)
8. (1) 9. (4) 10. (1) 11. (4) 12. (3) 13. (3) 14. (3)
15. (3)
268 Answers Last Leap for NEET (Part-I)
Chapter 2 : Chemical Bonding and Molecular Structure

1. (2) 2. (4) 3. (2) 4. (3) 5. (3) 6. (4) 7. (3)
8. (2) 9. (1) 10. (2) 11. (3) 12. (2) 13. (2) 14. (1)
15. (3) 16. (3) 17. (2) 18. (1) 19. (4) 20. (4) 21. (2)
22. (1) 23. (1) 24. (2) 25. (3) 26. (4) 27. (1) 28. (4)
29. (1) 30. (1) 31. (2) 32. (1) 33. (4) 34. (1) 35. (2)
36. (3) 37. (2) 38. (4) 39. (2) 40. (4) 41. (2) 42. (4)
43. (1) 44. (3) 45. (4) 46. (2) 47. (4) 48. (4) 49. (2)
50. (1) 51. (2) 52. (3) 53. (4) 54. (3) 55. (3) 56. (3)
57. (3) 58. (3) 59. (3) 60. (2) 61. (3) 62. (1) 63. (1)
64. (4) 65. (2) 66. (4) 67. (2) 68. (4) 69. (4) 70. (3)
71. (3) 72. (3) 73. (2) 74. (2) 75. (2) 76. (3) 77. (3)
78. (4) 79. (2) 80. (3) 81. (4) 82. (3) 83. (1) 84. (3)
85. (1) 86. (3) 87. (2) 88. (1) 89. (1) 90. (4) 91. (1)
92. (2) 93. (1) 94. (3) 95. (1) 96. (3) 97. (1) 98. (4)
99. (3) 100. (1) 101. (2) 102. (4) 103. (3) 104. (3) 105. (1)
106. (1) 107. (1) 108. (4) 109. (2) 110. (4) 111. (3) 112. (3)
113. (2) 114. (2) 115. (2) 116. (4) 117. (4) 118. (3) 119. (2)
120. (3) 121. (1) 122. (4) 123. (3) 124. (4) 125. (1) 126. (3)
127. (1) 128. (1) 129. (4) 130. (1) 131. (4) 132. (3) 133. (4)
134. (2) 135. (1) 136. (4) 137. (4) 138. (1) 139. (4) 140. (4)
141. (4) 142. (3) 143. (3) 144. (4) 145. (3) 146. (2) 147. (4)
148. (4) 149. (3) 150. (3) 151. (4) 152. (3) 153. (2) 154. (4)
155. (2) 156. (2) 157. (4) 158. (4) 159. (4) 160. (2) 161. (2)
162. (4) 163. (4) 164. (3) 165. (4) 166. (3) 167. (2) 168. (2)
169. (4) 170. (2) 171. (3) 172. (4) 173. (3) 174. (2) 175. (4)
176. (2) 177. (4) 178. (3) 179. (3) 180. (4) 181. (1) 182. (1)
183. (1) 184. (4) 185. (2) 186. (4) 187. (2) 188. (1) 189. (1)
190. (1) 191. (4) 192. (1) 193. (1) 194. (2) 195. (1) 196. (2)
197. (1) 198. (4) 199. (1) 200. (4) 201. (3) 202. (3) 203. (3)
204. (4) 205. (1) 206. (3) 207. (4) 208. (3) 209. (4) 210. (4)
211. (1) 212. (4) 213. (3) 214. (2) 215. (4) 216. (4) 217. (1)
218. (1) 219. (1) 220. (4) 221. (3) 222. (2) 223. (3) 224. (2)
225. (4) 226. (2) 227. (4) 228. (4) 229. (3) 230. (3) 231. (2)
232. (4) 233. (4) 234. (2) 235. (4) 236. (3) 237. (1) 238. (4)
239. (3) 240. (2)
1. (2) 2. (2) 3. (3) 4. (3) 5. (3) 6. (3) 7. (2)
8. (3) 9. (3) 10. (3) 11. (3) 12. (2) 13. (4) 14. (1)
15. (2) 16. (3) 17. (1) 18. (1) 19. (2) 20. (2) 21. (4)
Chapter 3 : Equilibrium

1. (1) 2. (2) 3. (2) 4. (3) 5. (2) 6. (4) 7. (2)
8. (3) 9. (4) 10. (4) 11. (3) 12. (3) 13. (3) 14. (1)
15. (4) 16. (3) 17. (2) 18. (3) 19. (3) 20. (4) 21. (3)
22. (3) 23. (1) 24. (4) 25. (4) 26. (4) 27. (4) 28. (1)
29. (3) 30. (3) 31. (2) 32. (2) 33. (3) 34. (4) 35. (2)
36. (1) 37. (4) 38. (1) 39. (4) 40. (2) 41. (2) 42. (4)
43. (4) 44. (1) 45. (1) 46. (2) 47. (3) 48. (2) 49. (3)
50. (1) 51. (1) 52. (3) 53. (4) 54. (4) 55. (1) 56. (3)
57. (3) 58. (1) 59. (2) 60. (1) 61. (2) 62. (4) 63. (3)
64. (1) 65. (4) 66. (1) 67. (4) 68. (3) 69. (3) 70. (2)
71. (3) 72. (2) 73. (2) 74. (4) 75. (1) 76. (1) 77. (4)
78. (4) 79. (1) 80. (4) 81. (2) 82. (4) 83. (3) 84. (2)
85. (4) 86. (1) 87. (4) 88. (3) 89. (1) 90. (3) 91. (3)
92. (3) 93. (2) 94. (2) 95. (3) 96. (3) 97. (4) 98. (3)
99. (3) 100. (1) 101. (3) 102. (3) 103. (4) 104. (2) 105. (1)
106. (1) 107. (4) 108. (2) 109. (2) 110. (4) 111. (4) 112. (2)
113. (2) 114. (2) 115. (4) 116. (4) 117. (1) 118. (1) 119. (3)
120. (3) 121. (2) 122. (3) 123. (4) 124. (4) 125. (1) 126. (1)
127. (1) 128. (1) 129. (1) 130. (1) 131. (3) 132. (3) 133. (4)
134. (4) 135. (4) 136. (1) 137. (4) 138. (3) 139. (4) 140. (4)
141. (3) 142. (2) 143. (3) 144. (4) 145. (3) 146. (1) 147. (4)
148. (4) 149. (2) 150. (4) 151. (2) 152. (2) 153. (1) 154. (2)
155. (2) 156. (4) 157. (2) 158. (3) 159. (3) 160. (2) 161. (2)
162. (3) 163. (4) 164. (3) 165. (1) 166. (4) 167. (1) 168. (2)
169. (2) 170. (1) 171. (2) 172. (4) 173. (1) 174. (1) 175. (3)
176. (2) 177. (2) 178. (2) 179. (3) 180. (2) 181. (1) 182. (3)
183. (1) 184. (1) 185. (2) 186. (1) 187. (1) 188. (3) 189. (2)
190. (3) 191. (2) 192. (4) 193. (3) 194. (2) 195. (3) 196. (2)
197. (1) 198. (2) 199. (1) 200. (3) 201. (1) 202. (2) 203. (4)
204. (1) 205. (2) 206. (3) 207. (1) 208. (1) 209. (3) 210. (3)
211. (4) 212. (4) 213. (1) 214. (3) 215. (3) 216. (2) 217. (1)
218. (3) 219. (4) 220. (4) 221. (3) 222. (2) 223. (3) 224. (4)
225. (2) 226. (3) 227. (3) 228. (4) 229. (3) 230. (2) 231. (3)
232. (1) 233. (4) 234. (3) 235. (4) 236. (1) 237. (3) 238. (4)
239. (3) 240. (2) 241. (2) 242. (3) 243. (1) 244. (1) 245. (3)
246. (4) 247. (1) 248. (4) 249. (1) 250. (4) 251. (2) 252. (3)
253. (3) 254. (1) 255. (4)

1. (4) 2. (3) 3. (4) 4. (4) 5. (1) 6. (2) 7. (1)
8. (4) 9. (1) 10. (2) 11. (2) 12. (3) 13. (3) 14. (3)
15. (1) 16. (2) 17. (3) 18. (2) 19. (1)
Chapter 4 : Electrochemistry

1. (1) 2. (2) 3. (3) 4. (4) 5. (1) 6. (2) 7. (1)
8. (4) 9. (1) 10. (2) 11. (3) 12. (2) 13. (2) 14. (3)
15. (3) 16. (4) 17. (3) 18. (1) 19. (2) 20. (4) 21. (1)
22. (2) 23. (2) 24. (2) 25. (3) 26. (4) 27. (3) 28. (1)
29. (2) 30. (3) 31. (1) 32. (1) 33. (3) 34. (4) 35. (2)
36. (4) 37. (3) 38. (3) 39. (1) 40. (1) 41. (1) 42. (1)
43. (3) 44. (3) 45. (2) 46. (3) 47. (3) 48. (3) 49. (2)
50. (2) 51. (3) 52. (3) 53. (4) 54. (1) 55. (4) 56. (2)
57. (3) 58. (3) 59. (1) 60. (3) 61. (4) 62. (4) 63. (4)
64. (1) 65. (3) 66. (3) 67. (1) 68. (2) 69. (4) 70. (2)
71. (3) 72. (1) 73. (4) 74. (3) 75. (4) 76. (1) 77. (4)
78. (1) 79. (3) 80. (1) 81. (3) 82. (3) 83. (4) 84. (4)
85. (4) 86. (3) 87. (1) 88. (2) 89. (4) 90. (2) 91. (1)
92. (4) 93. (2) 94. (1) 95. (3) 96. (4) 97. (1) 98. (2)
99. (4) 100. (1) 101. (1) 102. (1) 103. (3) 104. (1) 105. (1)
106. (4) 107. (2) 108. (1) 109. (2) 110. (2) 111. (4) 112. (3)
113. (2) 114. (1) 115. (3) 116. (4) 117. (2) 118. (1) 119. (1)
120. (2) 121. (3) 122. (3) 123. (4) 124. (4) 125. (4) 126. (1)
127. (4) 128. (1) 129. (3) 130. (3) 131. (1) 132. (1) 133. (3)

1. (2) 2. (3) 3. (1) 4. (2) 5. (1) 6. (4) 7. (2)
8. (4) 9. (1)
Chapter 5 : p-Block Elements (Group 15-18)

1. (2) 2. (4) 3. (4) 4. (1) 5. (1) 6. (3) 7. (2)
8. (2) 9. (1) 10. (3) 11. (4) 12. (1) 13. (4) 14. (3)
15. (3) 16. (1) 17. (3) 18. (4) 19. (3) 20. (4) 21. (1)
22. (4) 23. (2) 24. (4) 25. (2) 26. (1) 27. (3) 28. (1)
29. (1) 30. (3) 31. (1) 32. (1) 33. (2) 34. (2) 35. (1)
36. (2) 37. (3) 38. (1) 39. (2) 40. (2) 41. (3) 42. (4)
43. (3) 44. (2) 45. (2) 46. (2) 47. (3) 48. (4) 49. (4)
50. (2) 51. (3) 52. (4) 53. (1) 54. (3) 55. (1) 56. (3)
57. (2) 58. (3) 59. (1) 60. (4) 61. (1) 62. (3) 63. (1)
64. (3) 65. (4) 66. (2) 67. (4) 68. (2) 69. (2) 70. (1)
71. (3) 72. (2) 73. (2) 74. (3) 75. (2) 76. (3) 77. (3)
78. (4) 79. (2) 80. (4) 81. (3) 82. (1) 83. (4) 84. (4)
85. (4) 86. (3) 87. (3) 88. (3) 89. (4) 90. (3) 91. (1)
92. (4) 93. (4) 94. (4) 95. (1) 96. (1) 97. (3) 98. (3)
99. (3) 100. (3) 101. (3) 102. (4) 103. (3) 104. (2) 105. (2)
106. (3) 107. (3) 108. (3) 109. (2) 110. (2) 111. (3) 112. (3)
113. (1) 114. (1) 115. (1) 116. (1) 117. (1) 118. (4) 119. (4)
120. (1) 121. (3) 122. (3) 123. (1) 124. (1) 125. (2) 126. (1)
127. (2) 128. (3)

1. (1) 2. (4) 3. (1) 4. (4) 5. (1) 6. (2) 7. (3)
Chapter 6 : Organic Chemistry : Some Basic Principles and Techniques

1. (2) 2. (3) 3. (1) 4. (1) 5. (1) 6. (1) 7. (2)
8. (2) 9. (3) 10. (3) 11. (1) 12. (2) 13. (3) 14. (3)
15. (2) 16. (3) 17. (2) 18. (3) 19. (3) 20. (2) 21. (1)
22. (1) 23. (3) 24. (3) 25. (4) 26. (4) 27. (1) 28. (3)
29. (3) 30. (2) 31. (2) 32. (3) 33. (4) 34. (3) 35. (3)
36. (3) 37. (3) 38. (4) 39. (4) 40. (2) 41. (3) 42. (1)
43. (1) 44. (3) 45. (2) 46. (3) 47. (1) 48. (2) 49. (3)
50. (3) 51. (4) 52. (2) 53. (2) 54. (4) 55. (2) 56. (4)
57. (4) 58. (2) 59. (2) 60. (3) 61. (1) 62. (3) 63. (4)
64. (3) 65. (3) 66. (3) 67. (3) 68. (1) 69. (4) 70. (1)
71. (2) 72. (2) 73. (1) 74. (2) 75. (4) 76. (3) 77. (4)
78. (3) 79. (2) 80. (4) 81. (1) 82. (3) 83. (1) 84. (4)
85. (3) 86. (1) 87. (3) 88. (1) 89. (2) 90. (2) 91. (4)
92. (3) 93. (2) 94. (4) 95. (4) 96. (3) 97. (1) 98. (3)
99. (3) 100. (4) 101. (2) 102. (4) 103. (2) 104. (2) 105. (1)
106. (3) 107. (1) 108. (1) 109. (4) 110. (3) 111. (1) 112. (3)
113. (3) 114. (4) 115. (1) 116. (1) 117. (2) 118. (3) 119. (3)
120. (4) 121. (2) 122. (1) 123. (1) 124. (1) 125. (2) 126. (3)
127. (3) 128. (4) 129. (4) 130. (1) 131. (4) 132. (2) 133. (1)
134. (2) 135. (1) 136. (2) 137. (1) 138. (4) 139. (4) 140. (1)
141. (2) 142. (4) 143. (4) 144. (2) 145. (3) 146. (2) 147. (2)
148. (3) 149. (1) 150. (4) 151. (4) 152. (4) 153. (1) 154. (4)
155. (4) 156. (4) 157. (4) 158. (2) 159. (4) 160. (3) 161. (4)
162. (4) 163. (3) 164. (4) 165. (1) 166. (1) 167. (4) 168. (4)
169. (3) 170. (4) 171. (2) 172. (2) 173. (2) 174. (3) 175. (4)
176. (2) 177. (1) 178. (1) 179. (4) 180. (1) 181. (3) 182. (1)
183. (1) 184. (4) 185. (4) 186. (2) 187. (2) 188. (3) 189. (3)
190. (2) 191. (4) 192. (3) 193. (2) 194. (1) 195. (2) 196. (2)
197. (3)

1. (2) 2. (3) 3. (3) 4. (2) 5. (1) 6. (2) 7. (1)
8. (1) 9. (3) 10. (2) 11. (2) 12. (4) 13. (1) 14. (1)
15. (3) 16. (3) 17. (3) 18. (3)
Chapter 7 : Hydrocarbons

1. (2) 2. (3) 3. (2) 4. (2) 5. (3) 6. (3) 7. (1)
8. (4) 9. (1) 10. (4) 11. (3) 12. (4) 13. (3) 14. (2)
15. (4) 16. (3) 17. (3) 18. (3) 19. (4) 20. (3) 21. (2)
22. (3) 23. (3) 24. (4) 25. (1) 26. (4) 27. (2) 28. (2)
29. (3) 30. (1) 31. (1) 32. (2) 33. (1) 34. (2) 35. (1)
36. (4) 37. (2) 38. (4) 39. (2) 40. (4) 41. (1) 42. (4)
43. (1) 44. (3) 45. (1) 46. (1) 47. (1) 48. (4) 49. (4)
50. (3) 51. (4) 52. (3) 53. (1) 54. (2) 55. (3) 56. (4)
57. (4) 58. (2) 59. (2) 60. (3) 61. (1) 62. (4) 63. (3)
64. (3) 65. (3) 66. (1) 67. (1) 68. (4) 69. (3) 70. (1)
71. (2) 72. (1) 73. (1) 74. (2) 75. (2) 76. (2) 77. (2)
78. (4) 79. (3) 80. (2) 81. (3) 82. (1) 83. (2) 84. (3)
85. (3) 86. (3) 87. (3) 88. (2) 89. (1) 90. (3) 91. (1)
92. (2) 93. (2) 94. (2) 95. (2) 96. (1) 97. (2) 98. (2)
99. (3) 100. (3) 101. (3) 102. (4) 103. (4) 104. (1) 105. (2)
106. (1) 107. (3) 108. (2) 109. (3) 110. (1) 111. (3) 112. (1)
113. (2) 114. (3) 115. (2) 116. (4) 117. (1) 118. (4) 119. (2)
120. (3) 121. (1) 122. (3) 123. (4) 124. (2) 125. (2) 126. (2)
127. (1) 128. (3) 129. (4) 130. (2) 131. (1) 132. (3) 133. (3)
134. (2) 135. (4) 136. (4) 137. (1) 138. (4) 139. (4) 140. (2)
141. (4) 142. (3) 143. (2) 144. (2) 145. (3) 146. (1) 147. (2)
148. (1) 149. (2) 150. (2) 151. (1) 152. (3) 153. (4) 154. (2)
155. (2) 156. (3) 157. (3) 158. (2) 159. (3) 160. (4) 161. (2)
162. (2) 163. (3) 164. (3) 165. (3) 166. (1) 167. (3) 168. (3)
169. (4) 170. (2) 171. (2) 172. (4) 173. (4) 174. (3) 175. (2)

1. (3) 2. (3) 3. (2) 4. (1) 5. (2) 6. (3) 7. (2)
8. (4) 9. (1) 10. (3) 11. (3) 12. (1) 13. (1) 14. (3)
15. (1) 16. (1) 17. (2) 18. (4) 19. (4) 20. (1)
BOTANY
Chapter 1 : Biological Classification
1. (3) 2. (4) 3. (2) 4. (4) 5. (2) 6. (2) 7. (3)
8. (1) 9. (4) 10. (3) 11. (1) 12. (3) 13. (1) 14. (3)
15. (3) 16. (4) 17. (4) 18. (1) 19. (2) 20. (3) 21. (4)
22. (3) 23. (1) 24. (3) 25. (4) 26. (2) 27. (3) 28. (3)
29. (1) 30. (1) 31. (3) 32. (1) 33. (2) 34. (2) 35. (3)
36. (4) 37. (3) 38. (2) 39. (3) 40. (3) 41. (1) 42. (2)
43. (2) 44. (4) 45. (2) 46. (2) 47. (3) 48. (3) 49. (4)
50. (3) 51. (2) 52. (3) 53. (1) 54. (3) 55. (1) 56. (2)
57. (1) 58. (3) 59. (4) 60. (4) 61. (3) 62. (1) 63. (4)
64. (2) 65. (3) 66. (2) 67. (3) 68. (3) 69. (1) 70. (4)
71. (3) 72. (3) 73. (3) 74. (1) 75. (4) 76. (4) 77. (4)
78. (4) 79. (2) 80. (3) 81. (1) 82. (1) 83. (4) 84. (1)
85. (3) 86. (2) 87. (2) 88. (1) 89. (4) 90. (2) 91. (2)
92. (1) 93. (3) 94. (1) 95. (3) 96. (4) 97. (3) 98. (2)
99. (3) 100. (4) 101. (3) 102. (4) 103. (3) 104. (2) 105. (1)
106. (2) 107. (4) 108. (3) 109. (1) 110. (2) 111. (3) 112. (4)
113. (3) 114. (3) 115. (3) 116. (2) 117. (2) 118. (3) 119. (4)
120. (4) 121. (1) 122. (1) 123. (2) 124. (3) 125. (1) 126. (3)
127. (2) 128. (2) 129. (2) 130. (2) 131. (1) 132. (4) 133. (4)
134. (1) 135. (2) 136. (1) 137. (2) 138. (2) 139. (1) 140. (3)
141. (1) 142. (3) 143. (4) 144. (3) 145. (2) 146. (2) 147. (3)
148. (4) 149. (3) 150. (3) 151. (3) 152. (2) 153. (2) 154. (1)
155. (4) 156. (1) 157. (4) 158. (4) 159. (1) 160. (2) 161. (3)
162. (2) 163. (2) 164. (2) 165. (3) 166. (2) 167. (4) 168. (4)
169. (4) 170. (2) 171. (2) 172. (3) 173. (4) 174. (4) 175. (3)
176. (3) 177. (2) 178. (1) 179. (4) 180. (3) 181. (3) 182. (3)
183. (1) 184. (2) 185. (3) 186. (4) 187. (2) 188. (3) 189. (2)
190. (3) 191. (4) 192. (2) 193. (2) 194. (2) 195. (1) 196. (2)
197. (1) 198. (2) 199. (3) 200. (1) 201. (4) 202. (2) 203. (3)
204. (3) 205. (4) 206. (2) 207. (3) 208. (4) 209. (3) 210. (2)
211. (1) 212. (2) 213. (2) 214. (2) 215. (3) 216. (2) 217. (3)
218. (3) 219. (3) 220. (4) 221. (2) 222. (3) 223. (4) 224. (2)
225. (4) 226. (1) 227. (3) 228. (2) 229. (3) 230. (1) 231. (2)
232. (1) 233. (1) 234. (3) 235. (4) 236. (4) 237. (3) 238. (3)
239. (4) 240. (3) 241. (4) 242. (2) 243. (3) 244. (2) 245. (2)
246. (3) 247. (1) 248. (1) 249. (4) 250. (1) 251. (4) 252. (2)
253. (2) 254. (3) 255. (2) 256. (2) 257. (3) 258. (3) 259. (4)
260. (3) 261. (2) 262. (4) 263. (4) 264. (4) 265. (1) 266. (1)
267. (2) 268. (3) 269. (1) 270. (2) 271. (3) 272. (2) 273. (1)
274. (4) 275. (2) 276. (3) 277. (2) 278. (4) 279. (2) 280. (3)
281. (3) 282. (2) 283. (1) 284. (2) 285. (2) 286. (2) 287. (2)
288. (2) 289. (2) 290. (3) 291. (1) 292. (1) 293. (1) 294. (1)
295. (4) 296. (1) 297. (1) 298. (3) 299. (3) 300. (1) 301. (2)
302. (3) 303. (2) 304. (3) 305. (1) 306. (2) 307. (4) 308. (4)
309. (3) 310. (2) 311. (1) 312. (4) 313. (1) 314. (4) 315. (1)
316. (3) 317. (3) 318. (4) 319. (2) 320. (2) 321. (3) 322. (3)
323. (3) 324. (1) 325. (4) 326. (4) 327. (1) 328. (2) 329. (2)
330. (3) 331. (1) 332. (3) 333. (3) 334. (3) 335. (3) 336. (4)
337. (4) 338. (2) 339. (4) 340. (3) 341. (3) 342. (3) 343. (3)
344. (1) 345. (4) 346. (3) 347. (3) 348. (4) 349. (2) 350. (2)
351. (2) 352. (3) 353. (3) 354. (3) 355. (1) 356. (2) 357. (2)
358. (2) 359. (3) 360. (2) 361. (3) 362. (4) 363. (4) 364. (3)
365. (2) 366. (3) 367. (3)

1. (1) 2. (2) 3. (4) 4. (4) 5. (4) 6. (1) 7. (2)
8. (3) 9. (3) 10. (3) 11. (4) 12. (4) 13. (2) 14. (1)
15. (3) 16. (3) 17. (1) 18. (1) 19. (4) 20. (2) 21. (3)
22. (2) 23. (1) 24. (1) 25. (2) 26. (4) 27. (2) 28. (4)
29. (3) 30. (4) 31. (2) 32. (3) 33. (2) 34. (2) 35. (3)
36. (3) 37. (4)
Chapter 2 : Reproduction in Organisms and Sexual Reproduction in Plants

1. (3) 2. (4) 3. (1) 4. (4) 5. (3) 6. (3) 7. (2)
8. (1) 9. (2) 10. (3) 11. (2) 12. (3) 13. (2) 14. (1)
15. (3) 16. (4) 17. (2) 18. (3) 19. (2) 20. (3) 21. (2)
22. (4) 23. (2) 24. (3) 25. (2) 26. (4) 27. (1) 28. (2)
29. (4) 30. (4) 31. (3) 32. (3) 33. (1) 34. (4) 35. (1)
36. (2) 37. (2) 38. (1) 39. (3) 40. (3) 41. (2) 42. (2)
43. (3) 44. (3) 45. (3) 46. (2) 47. (3) 48. (2) 49. (3)
50. (3) 51. (2) 52. (2) 53. (3) 54. (3) 55. (1) 56. (4)
57. (1) 58. (4) 59. (4) 60. (4) 61. (3) 62. (4) 63. (1)
64. (3) 65. (3) 66. (4) 67. (2) 68. (2) 69. (3) 70. (3)
71. (3) 72. (2) 73. (1) 74. (4) 75. (2) 76. (2) 77. (1)
78. (1) 79. (1) 80. (2) 81. (2) 82. (4) 83. (3) 84. (1)
85. (4) 86. (1) 87. (3) 88. (3) 89. (3) 90. (2) 91. (1)
92. (2) 93. (3) 94. (2) 95. (4) 96. (3) 97. (1) 98. (3)
99. (4) 100. (4) 101. (3) 102. (4) 103. (4) 104. (2) 105. (1)
106. (2) 107. (4) 108. (1) 109. (1) 110. (4) 111. (2) 112. (3)
113. (3) 114. (2) 115. (1) 116. (1) 117. (3) 118. (3) 119. (3)
120. (2) 121. (1) 122. (1) 123. (1) 124. (3) 125. (3) 126. (1)
127. (3) 128. (2) 129. (3) 130. (2) 131. (4) 132. (3) 133. (4)
134. (3) 135. (2) 136. (1) 137. (1) 138. (4) 139. (1) 140. (2)
141. (4) 142. (1) 143. (4) 144. (2) 145. (2) 146. (1) 147. (2)
148. (1) 149. (3) 150. (4) 151. (3) 152. (4) 153. (2) 154. (3)
155. (1) 156. (4) 157. (2) 158. (2) 159. (4) 160. (2) 161. (4)
162. (2) 163. (4) 164. (2) 165. (3) 166. (2) 167. (2) 168. (1)
169. (4) 170. (4) 171. (1) 172. (1) 173. (2) 174. (1) 175. (2)
176. (3) 177. (4) 178. (1) 179. (4) 180. (1) 181. (1) 182. (4)
183. (1) 184. (1) 185. (4) 186. (3) 187. (4) 188. (1) 189. (3)
190. (3) 191. (2) 192. (2) 193. (4) 194. (3) 195. (1) 196. (1)
197. (4) 198. (3) 199. (2) 200. (2) 201. (1) 202. (1) 203. (1)
204. (3) 205. (1) 206. (2) 207. (1) 208. (3) 209. (2) 210. (2)
211. (3) 212. (2) 213. (3) 214. (2) 215. (2) 216. (3) 217. (2)
218. (2) 219. (2) 220. (2) 221. (3) 222. (2) 223. (3) 224. (3)
225. (3) 226. (1) 227. (2) 228. (4) 229. (3) 230. (1) 231. (2)
232. (1) 233. (3) 234. (1) 235. (2) 236. (4) 237. (2) 238. (3)
239. (4) 240. (3) 241. (1) 242. (3) 243. (2) 244. (2) 245. (3)
246. (4) 247. (3) 248. (4) 249. (1) 250. (4) 251. (3) 252. (2)
253. (3) 254. (4) 255. (2) 256. (1) 257. (3) 258. (4) 259. (1)
260. (3) 261. (4) 262. (4) 263. (3) 264. (3) 265. (3) 266. (3)
267. (1) 268. (1) 269. (1) 270. (2) 271. (4) 272. (2) 273. (4)
274. (4) 275. (4) 276. (1) 277. (4) 278. (3) 279. (1) 280. (2)
281. (3) 282. (1) 283. (4) 284. (2) 285. (3) 286. (3) 287. (2)
288. (1) 289. (2) 290. (4) 291. (4) 292. (3) 293. (2) 294. (2)
295. (4) 296. (3) 297. (3) 298. (4) 299. (1) 300. (4) 301. (1)
302. (3) 303. (2) 304. (4)

1. (3) 2. (1) 3. (3) 4. (3) 5. (3) 6. (3) 7. (4)
8. (2) 9. (2) 10. (1) 11. (4) 12. (1) 13. (1) 14. (2)
15. (4) 16. (2) 17. (1) 18. (2) 19. (4) 20. (1) 21. (2)
22. (1) 23. (3) 24. (1) 25. (1) 26. (3) 27. (3) 28. (2)
29. (3) 30. (2)
Chapter 3 : Molecular Basis of Inheritance

1. (4) 2. (4) 3. (2) 4. (4) 5. (2) 6. (3) 7. (1)
8. (2) 9. (3) 10. (4) 11. (3) 12. (2) 13. (4) 14. (2)
15. (3) 16. (2) 17. (4) 18. (2) 19. (3) 20. (1) 21. (2)
22. (1) 23. (3) 24. (1) 25. (3) 26. (2) 27. (4) 28. (1)
29. (4) 30. (3) 31. (3) 32. (1) 33. (4) 34. (1) 35. (1)
36. (1) 37. (3) 38. (4) 39. (3) 40. (2) 41. (2) 42. (4)
43. (3) 44. (4) 45. (4) 46. (1) 47. (2) 48. (3) 49. (3)
50. (4) 51. (4) 52. (2) 53. (3) 54. (4) 55. (4) 56. (3)
57. (3) 58. (2) 59. (4) 60. (4) 61. (1) 62. (4) 63. (4)
64. (4) 65. (3) 66. (1) 67. (2) 68. (1) 69. (4) 70. (1)
71. (4) 72. (3) 73. (4) 74. (3) 75. (2) 76. (1) 77. (3)
78. (2) 79. (3) 80. (4) 81. (3) 82. (3) 83. (2) 84. (3)
85. (3) 86. (3) 87. (4) 88. (2) 89. (4) 90. (4) 91. (2)
92. (2) 93. (3) 94. (3) 95. (2) 96. (4) 97. (3) 98. (3)
99. (4) 100. (3) 101. (2) 102. (4) 103. (4) 104. (2) 105. (2)
106. (3) 107. (4) 108. (2) 109. (4) 110. (1) 111. (3) 112. (4)
113. (1) 114. (3) 115. (4) 116. (1) 117. (2) 118. (1) 119. (3)
120. (3) 121. (2) 122. (2) 123. (2) 124. (2) 125. (1) 126. (1)
127. (3) 128. (1) 129. (3) 130. (4) 131. (4) 132. (3) 133. (3)
134. (2) 135. (3) 136. (4) 137. (3) 138. (3) 139. (3) 140. (3)
141. (4) 142. (1) 143. (4) 144. (4) 145. (2) 146. (2) 147. (3)
148. (2) 149. (3) 150. (4) 151. (1) 152. (2) 153. (4) 154. (3)
155. (3) 156. (3) 157. (2) 158. (2) 159. (4) 160. (2) 161. (3)
162. (3) 163. (2) 164. (2) 165. (1) 166. (3) 167. (2) 168. (4)
169. (2) 170. (4) 171. (1) 172. (2) 173. (2) 174. (3) 175. (4)
176. (1) 177. (1) 178. (2) 179. (1) 180. (2) 181. (4) 182. (3)
183. (2) 184. (1) 185. (4) 186. (3) 187. (3) 188. (1) 189. (3)
190. (3) 191. (4) 192. (4) 193. (2) 194. (3) 195. (1) 196. (4)
197. (3) 198. (1) 199. (2) 200. (3) 201. (2) 202. (2) 203. (1)
204. (2) 205. (1) 206. (2) 207. (2) 208. (3) 209. (3) 210. (2)
211. (3) 212. (3) 213. (1) 214. (4)

1. (4) 2. (1) 3. (2) 4. (1) 5. (4) 6. (1) 7. (1)
8. (1) 9. (3) 10. (2) 11. (1) 12. (3) 13. (3) 14. (3)
15. (1) 16. (1) 17. (4)
Chapter 4 : Anatomy of Flowering Plants

1. (2) 2. (1) 3. (3) 4. (2) 5. (2) 6. (3) 7. (4)
8. (2) 9. (3) 10. (4) 11. (2) 12. (4) 13. (4) 14. (4)
15. (3) 16. (1) 17. (4) 18. (4) 19. (2) 20. (2) 21. (4)
22. (3) 23. (2) 24. (3) 25. (3) 26. (1) 27. (3) 28. (1)
29. (3) 30. (3) 31. (4) 32. (2) 33. (1) 34. (1) 35. (2)
36. (4) 37. (1) 38. (2) 39. (2) 40. (2) 41. (4) 42. (4)
43. (2) 44. (1) 45. (2) 46. (3) 47. (2) 48. (2) 49. (4)
50. (3) 51. (1) 52. (2) 53. (3) 54. (4) 55. (4) 56. (1)
57. (3) 58. (2) 59. (4) 60. (4) 61. (1) 62. (2) 63. (1)
64. (1) 65. (4) 66. (1) 67. (4) 68. (3) 69. (4) 70. (3)
71. (2) 72. (4) 73. (4) 74. (3) 75. (1) 76. (2) 77. (2)
78. (3) 79. (1) 80. (4) 81. (2) 82. (4) 83. (2) 84. (2)
85. (2) 86. (3) 87. (2) 88. (1) 89. (2) 90. (2) 91. (4)
92. (2) 93. (1) 94. (3) 95. (3) 96. (1) 97. (2) 98. (1)
99. (1) 100. (3) 101. (2) 102. (2) 103. (2) 104. (3) 105. (3)
106. (4) 107. (1) 108. (4) 109. (2) 110. (3) 111. (3) 112. (3)
113. (3) 114. (3) 115. (2) 116. (4) 117. (4) 118. (1) 119. (3)
120. (2) 121. (1) 122. (4) 123. (4) 124. (4) 125. (2) 126. (2)
127. (1) 128. (4) 129. (4) 130. (3) 131. (1) 132. (4) 133. (3)
134. (1) 135. (1) 136. (4) 137. (1) 138. (3) 139. (4) 140. (2)
141. (4) 142. (1) 143. (1) 144. (4) 145. (2) 146. (2) 147. (2)
148. (4) 149. (2) 150. (4) 151. (1) 152. (4) 153. (3) 154. (3)
155. (1) 156. (2) 157. (4) 158. (2) 159. (1) 160. (1) 161. (2)

1. (4) 2. (3) 3. (4) 4. (1) 5. (3) 6. (1) 7. (4)
8. (3) 9. (4) 10. (4) 11. (1) 12. (2)
Chapter 5 : Morphology of Flowering Plants

1. (3) 2. (3) 3. (4) 4. (4) 5. (2) 6. (1) 7. (2)
8. (3) 9. (4) 10. (3) 11. (4) 12. (1) 13. (4) 14. (1)
15. (2) 16. (2) 17. (3) 18. (4) 19. (3) 20. (3) 21. (1)
22. (2) 23. (4) 24. (2) 25. (1) 26. (3) 27. (4) 28. (1)
29. (1) 30. (2) 31. (2) 32. (2) 33. (2) 34. (1) 35. (1)
36. (1) 37. (3) 38. (2) 39. (2) 40. (3) 41. (1) 42. (1)
43. (3) 44. (3) 45. (3) 46. (2) 47. (3) 48. (2) 49. (3)
50. (1) 51. (1) 52. (3) 53. (3) 54. (3) 55. (3) 56. (3)
57. (3) 58. (4) 59. (4) 60. (2) 61. (2) 62. (1) 63. (3)
64. (2) 65. (1) 66. (3) 67. (2) 68. (4) 69. (1) 70. (3)
71. (2) 72. (3) 73. (4) 74. (2) 75. (1) 76. (4) 77. (1)
78. (2) 79. (1) 80. (2) 81. (3) 82. (1) 83. (2) 84. (4)
85. (3) 86. (2) 87. (3) 88. (2) 89. (3) 90. (4) 91. (1)
92. (1) 93. (2) 94. (4) 95. (3) 96. (1) 97. (3) 98. (2)
99. (3) 100. (2) 101. (2) 102. (1) 103. (1) 104. (2) 105. (2)
106. (1) 107. (1) 108. (2) 109. (4) 110. (3) 111. (2) 112. (4)
113. (1) 114. (2) 115. (1) 116. (2) 117. (2) 118. (4) 119. (4)
120. (2) 121. (1) 122. (2) 123. (4) 124. (2) 125. (1) 126. (3)
127. (4) 128. (4) 129. (1) 130. (4) 131. (2) 132. (3) 133. (4)
134. (1) 135. (1) 136. (2) 137. (4) 138. (1) 139. (2) 140. (3)
141. (4) 142. (1) 143. (4) 144. (4) 145. (3) 146. (3) 147. (2)
148. (4) 149. (4) 150. (3) 151. (2) 152. (2) 153. (4) 154. (3)
155. (4) 156. (3) 157. (2) 158. (2) 159. (2) 160. (3) 161. (4)
162. (2) 163. (1) 164. (2) 165. (4) 166. (1) 167. (3) 168. (3)
169. (1) 170. (2) 171. (2) 172. (1) 173. (2) 174. (1) 175. (3)
176. (2) 177. (4) 178. (3) 179. (1) 180. (2) 181. (4) 182. (3)
183. (1) 184. (4) 185. (3) 186. (3) 187. (2) 188. (3) 189. (3)
190. (2) 191. (1) 192. (3) 193. (3) 194. (2) 195. (4) 196. (1)
197. (3) 198. (1) 199. (4) 200. (4) 201. (3) 202. (4) 203. (2)
204. (1) 205. (3) 206. (4) 207. (4) 208. (2) 209. (2) 210. (4)
211. (3) 212. (4) 213. (4) 214. (2) 215. (2) 216. (4) 217. (4)
1. (1) 2. (3) 3. (3) 4. (2) 5. (3) 6. (2)
Chapter 6 : Principles of Inheritance and Variation
1. (3) 2. (3) 3. (2) 4. (1) 5. (3) 6. (1) 7. (1)
8. (4) 9. (3) 10. (2) 11. (1) 12. (3) 13. (1) 14. (2)
15. (3) 16. (1) 17. (1) 18. (4) 19. (4) 20. (3) 21. (1)
22. (2) 23. (2) 24. (4) 25. (4) 26. (2) 27. (4) 28. (1)
29. (3) 30. (1) 31. (1) 32. (1) 33. (3) 34. (2) 35. (3)
36. (2) 37. (2) 38. (1) 39. (2) 40. (3) 41. (1) 42. (3)
43. (3) 44. (3) 45. (4) 46. (4) 47. (2) 48. (1) 49. (1)
50. (2) 51. (3) 52. (2) 53. (4) 54. (4) 55. (3) 56. (2)
57. (3) 58. (2) 59. (3) 60. (4) 61. (2) 62. (3) 63. (3)
64. (4) 65. (1) 66. (2) 67. (2) 68. (4) 69. (2) 70. (4)
71. (4) 72. (1) 73. (4) 74. (2) 75. (3) 76. (2) 77. (2)
78. (1) 79. (3) 80. (1) 81. (2) 82. (2) 83. (2) 84. (3)
85. (2) 86. (4) 87. (3) 88. (3) 89. (4) 90. (1) 91. (3)
92. (4) 93. (3) 94. (2) 95. (4) 96. (1) 97. (2) 98. (1)
99. (3) 100. (4) 101. (4) 102. (4) 103. (2) 104. (2) 105. (4)
106. (2) 107. (2) 108. (4) 109. (3) 110. (2) 111. (1) 112. (3)
113. (2) 114. (3) 115. (2) 116. (2) 117. (1) 118. (1) 119. (1)
120. (4) 121. (3) 122. (1) 123. (4) 124. (4) 125. (1) 126. (3)
127. (4) 128. (2) 129. (3) 130. (1) 131. (4) 132. (4) 133. (1)
134. (2) 135. (3) 136. (2) 137. (2) 138. (2) 139. (3) 140. (3)
141. (4) 142. (2) 143. (4) 144. (2) 145. (2) 146. (2) 147. (3)
148. (3) 149. (1) 150. (2) 151. (4) 152. (2) 153. (4) 154. (3)
155. (3) 156. (2) 157. (4) 158. (2) 159. (2) 160. (1) 161. (3)
162. (4) 163. (1) 164. (3) 165. (3) 166. (2) 167. (2) 168. (4)
169. (3) 170. (4) 171. (2) 172. (3) 173. (2) 174. (1) 175. (1)
176. (2) 177. (3) 178. (1) 179. (3) 180. (1) 181. (4) 182. (4)
183. (3) 184. (1) 185. (3) 186. (2) 187. (2) 188. (1) 189. (3)
190. (3) 191. (4) 192. (2) 193. (1) 194. (2) 195. (4) 196. (3)
197. (3) 198. (4) 199. (3) 200. (3) 201. (4) 202. (2) 203. (1)
204. (3) 205. (4) 206. (1) 207. (1) 208. (4) 209. (2) 210. (1)
211. (3) 212. (4) 213. (1) 214. (2) 215. (1) 216. (4) 217. (3)
218. (4) 219. (2) 220. (2) 221. (2)
1. (3) 2. (2) 3. (4) 4. (1) 5. (3) 6. (1) 7. (1)
8. (3) 9. (2) 10. (3) 11. (3) 12. (2) 13. (4)
Chapter 7 : Cell : The Unit of Life

1. (4) 2. (2) 3. (1) 4. (2) 5. (2) 6. (3) 7. (1)
8. (3) 9. (2) 10. (3) 11. (2) 12. (2) 13. (4) 14. (4)
15. (1) 16. (3) 17. (4) 18. (1) 19. (2) 20. (3) 21. (3)
22. (2) 23. (4) 24. (2) 25. (4) 26. (1) 27. (4) 28. (1)
29. (4) 30. (2) 31. (2) 32. (2) 33. (3) 34. (1) 35. (2)
36. (1) 37. (3) 38. (2) 39. (2) 40. (3) 41. (3) 42. (4)
43. (2) 44. (3) 45. (1) 46. (4) 47. (3) 48. (4) 49. (1)
50. (2) 51. (2) 52. (3) 53. (1) 54. (2) 55. (4) 56. (2)
57. (2) 58. (2) 59. (3) 60. (4) 61. (1) 62. (3) 63. (1)
64. (2) 65. (4) 66. (2) 67. (3) 68. (2) 69. (3) 70. (4)
71. (3) 72. (4) 73. (3) 74. (1) 75. (2) 76. (3) 77. (2)
78. (4) 79. (1) 80. (4) 81. (1) 82. (4) 83. (3) 84. (3)
85. (2) 86. (1) 87. (2) 88. (2) 89. (2) 90. (3) 91. (2)
92. (3) 93. (4) 94. (1) 95. (3) 96. (4) 97. (2) 98. (2)
99. (2) 100. (2) 101. (3) 102. (1) 103. (3) 104. (2) 105. (1)
106. (2) 107. (2) 108. (4) 109. (4) 110. (3) 111. (4) 112. (4)
113. (2) 114. (3) 115. (1) 116. (3) 117. (3) 118. (4) 119. (1)
120. (1) 121. (3) 122. (3) 123. (2) 124. (3) 125. (2) 126. (4)
127. (3) 128. (4) 129. (3) 130. (3) 131. (1) 132. (4) 133. (2)
134. (4) 135. (1) 136. (4) 137. (2) 138. (4) 139. (1) 140. (3)
141. (4) 142. (2) 143. (4) 144. (2) 145. (4) 146. (1) 147. (3)
148. (4) 149. (2) 150. (1) 151. (3) 152. (1) 153. (1) 154 (2)
155. (2) 156. (3) 157. (2) 158. (3) 159. (4) 160. (1) 161. (2)
162. (3) 163. (1) 164. (3) 165. (3)

1. (1) 2. (4) 3. (2) 4. (2) 5. (4) 6. (3) 7. (2)
8. (1) 9. (2) 10. (4)
Chapter 8 : Ecosystem
1. (3) 2. (2) 3. (2) 4. (2) 5. (4) 6. (3) 7. (3)
8. (4) 9. (3) 10. (2) 11. (1) 12. (1) 13. (4) 14. (2)
15. (3) 16. (4) 17. (1) 18. (4) 19. (1) 20. (1) 21. (2)
22. (1) 23. (4) 24. (2) 25. (2) 26. (2) 27. (3) 28. (3)
29. (1) 30. (2) 31. (1) 32. (2) 33. (1) 34. (4) 35. (4)
36. (4) 37. (4) 38. (3) 39. (3) 40. (3) 41. (3) 42. (2)
43. (2) 44. (3) 45. (3) 46. (4) 47. (2) 48. (3) 49. (1)
50. (4) 51. (4) 52. (2) 53. (4) 54. (3) 55. (2) 56. (3)
57. (4) 58. (3) 59. (2) 60. (1) 61. (3) 62. (4) 63. (1)
64. (2) 65. (3) 66. (3) 67. (2) 68. (4) 69. (2) 70. (3)
1. (2) 2. (2) 3. (1) 4. (1) 5. (4) 6. (3) 7. (4)
8. (2)
Chapter 9 : Environmental Issues
1. (1) 2. (2) 3. (4) 4. (1) 5. (2) 6. (4) 7. (2)
8. (1) 9. (1) 10. (4) 11. (2) 12. (1) 13. (2) 14. (1)
15. (2) 16. (4) 17. (3) 18. (4) 19. (4) 20. (2) 21. (4)
22. (3) 23. (4) 24. (3) 25. (1) 26. (3) 27. (2) 28. (4)
29. (3) 30. (1) 31. (4) 32. (1) 33. (2) 34. (1) 35. (3)
36. (3) 37. (3) 38. (1) 39. (3) 40. (2) 41. (3) 42. (2)
43. (1) 44. (3) 45. (2) 46. (2) 47. (3) 48. (3) 49. (1)
50. (1) 51. (4) 52. (2) 53. (2) 54. (2) 55. (3) 56. (1)
57. (3) 58. (3) 59. (1) 60. (4) 61. (2) 62. (4) 63. (2)
64. (3) 65. (2) 66. (3) 67. (1) 68. (3) 69. (3)
1. (1) 2. (2) 3. (1) 4. (3) 5. (3) 6. (1) 7. (4)
!" !" !

Last Leap 3

Uploaded by

Copyright:

Available Formats

Last Leap 3

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Last Leap 3

Uploaded by

Copyright:

Available Formats

https://neetforsure.blogspot.

1. Preface ................................................................................................. (i) – (i)

2. Chemistry .......................................................................................... 01 – 112

3. Botany .............................................................................................. 113 – 266

4. Answers........................................................................................... 267 – 280

CHAPTER No. TOPIC PAGE No.

1. Structure of Atom ....................................................................... 01 – 16

2. Chemical Bonding and Molecular Structure .............................. 17 – 34

5. p-Block Elements (Group 15 - 18) ............................................ 67 – 74

6. Organic Chemistry : Some Basic Principles

7. Hydrocarbons ............................................................................. 93 – 112

(2) It is applicable for H– and H-like species

(3) –1.5 eV (4) –13.6 eV ! %

(3) 5 2 (4) 6 2 (1) 4.4 BM (2) 1.1 BM

" (1) 1 (2) 2

(3) O2– (4) CO+ (1) 3 (2) 4

74. If it is assumed that the electron exist within the

87. Find the correct statement about Bohr’s theory (3) 1( 0 – 2) = 2( 0 – 1)

(1) The stationary orbits are arranged around the (4) 3( 1 – 2) =( 0 – 1)

(3) d 9 (4) d 10 (1) Nuclear charge

! 107. The permissible values of azimuthal quantum

109. If 0 and be the threshold wavelength and the *

(1) K-shell (2) L-shell (4) Violet light of visible part

(1) 2 (2) 4 (2) Orbital angular momentum of 1s, 2s and

178. An ion Mna+ has the magnetic moment equal to

! " ! II. d-subshell has five orbitals.

194. Which transition of electron in H-atom spectrum (3) $ #! (4) # "!

(3) (4) All of these (3) "#! !"#$ $%

(1) !"! (2) !""!

9. Hypervalent compound is 17. The bond angle in hydrogen bonding of HF is

(1) NH3 combines with H+ (1) sp3d linear

(2) AlH3 combines with H– (2) sp3d2 octahedral

(d) SeF4 and CH4 have same shape (3) A + B (4) A – B

15. Which of the following is correct about bond (3) CaCl2

25. The molecule with zero dipole moment is !

!"#! (1) sp (2) sp2

(3) !" " (4) !" " !

(3) See-Saw 79. Which type of bond is not present in HNO 3

(4) PO43–, SO42–, ClO4– (1) CH2Cl2 (2) CHCl3

! 108. Find the incorrect match

(3) T-shaped (1) NH3, NH4+ (2) BF3, BF4–

(4) Seesaw (3) H2O, H3O+ (4) SO2, SO3

126. Identify the false statement

(3) (4) ! (3) XeO2F2 (4) XeF2

(2) Trans-1,2-dichloroethene and cis-1,2- (3) In !"! covalency of N = 3

(1) sp2, sp2 140. Correct sequence of indicated property is

(4) sp3, sp2 (3) C – C > C = C > C C (Bond length)

(1) XeF4 – Octahedral (3) 6, 6 (4) 6, 12

(3) SO2 – Linear (1) dxy (2) !

(4) All of these (3) ! (4) dyz

(3) !!! !! !! !! (4) !! !! !! !!! (3) NH3 (4) !"!

164. The enthalpies of hydrogen bond in most !

(4) 5 – 10 J/mol (3) 2 (4) 3

(4) Different with 1, 0 and 2 lone pairs of !" !"

(3) Square planar

(4) 18.8% (4) Linear XeF2 and square planar XeO3

P +780 –920 191. The maximum number of hydrogen bonds that

206. Hybridization of nitrogen in pyrrole is (1) O22– and F2 (2) F2 and B2

(2) !! !! !! !! !! 225. Which of the following pair is having same