Journal of Integrative Agriculture 2018, 17(0): 60345-7

Available online at www.sciencedirect.com

ScienceDirect

RESEARCH ARTICLE

Combined application of Trichoderma harzianum SH2303 and

difenoconazole-propiconazolein controlling Southern corn leaf
blight disease caused by Cochliobolus heterostrophus in maize
WANG Shao-qing1, 2, 3*, MA Jia4*, WANG Meng1, 2, 3, WANG Xin-hua1, 2, 3, LI Ya-qian1, 2, 3, CHEN Jie1, 2, 3

1
School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai 200240, P.R.China
2
Key Laboratory of Urban Agriculture (South) Ministry of Agriculture, Shanghai Jiao Tong University, Shanghai 200240, P.R.China
3
State Key Laboratory of Microbial Metabolism, Shanghai Jiao Tong University, Shanghai 200240, P.R.China
4
Plant Genetic Engineering Center of Hebei Province, Institute of Genetics and Physiology, Hebei Academy of Agriculture and
Forestry Sciences, Shijiazhuang 050051, P.R.China

Abstract
Southern corn leaf blight (SCLB) disease caused by Cochliobolus heterostrophus is one of the major threats to corn
production worldwide. The synergistic application of low toxic chemical fungicide and biocontrol agents could improve
biocontrol stability and efficiency against plant diseases, which ultimately reduce use of chemical fungicide. Trichoderma
spp., well-known biocontrol fungi have been used to control some foliar diseases. However, few work has been reported on
synergistic application of chemical fungicide and Trichoderma against foliar diseases. This study was aimed to investigate
the control effect on the synergistic application of Trichoderma harzianum SH2303 and difenoconazole-propiconazole (DP)
against SCLB. Results showed that the synergistic application of DP and SH2303 reduced the leaf spot area compared
to the control. The efficacy of synergistic application of DP+SH2303 against SCLB could last for 15–20 d in pot trial under
the greenhouse condition. Under the natural field condition, maize treated with DP+DP and DP+SH2303 showed 60%
control, which was higher than that of SH2303+DP (45%) and SH2303+SH2303 (35%). All these treatments induced the
synthesis of defense-related enzymes (phenylalanine ammonia lyase (PAL), catalase (CAT), and superoxide dismutase
(SOD)) and the defence-related gene expression of SA pathway (PR1). Taken together the in-vitro leaf test and field trial,
the control of SCLB by synergistic application of DP+SH2303 was similar to that of DP+DP. Among synergistic application,
the sequential application of DP+SH2303 showed better control than the sequential application of SH2303+DP. It was
concluded that the synergistic application of chemical fungicide (DP) and biocontrol agent (T. harzianum SH2303) could be
used to reduce the chemical fungicide and to reduce the SCLB diseases in maize, which provided alternative approach to
realize an eco-friendly controlling the foliar disease.

Keywords: synergistic bio-control, chemical fungicide, Trichoderma harzianum, maize leaf spot disease

Received 12 September, 2018 Accepted 14 December, 2018

WANG Shao-qing, E-mail: [email protected]; MA Jia,
E-mail: [email protected]; Correspondence CHEN Jie, Tel:
+86-21-34206141, E-mail: [email protected]
1. Introduction
*
These authors contributed equally to this study.
Maize (Zea mays L.) is the most important crops next
© 2019 CAAS. Publishing services by Elsevier B.V. All rights
reserved. to wheat and rice. It is often threatened by a variety of
doi: 10.1016/S2095-3119(19)62603-1 pathogens. Southern corn leaf blight (SCLB) is a fungal
 *** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7 3

disease caused by the Cochliobolus heterostrophus (Wang Although Trichoderma BCAs are widely welcome by
et al. 2017). At present, the control of the leaf spot disease farmers from point of eco-protection view, their application
is dependent on the multiple application of fungicide. For are often challenged by stress natural condition in farming
instance, difenoconazole is used to stop the fungal growth field that thereby leading to sometimes unpredictable
on leaf, and also low toxicity to humans and environment. control effect (Howell 2003; Legrand et al. 2017; Malik
It inhibits the growth of pathogenic fungi by breaking their et al. 2018). Hence, the integrated control strategies
cell membrane structures (Hirooka and Ishii 2013). In recent containing Trichoderma with fungicide could be developed
years, the chemical fungicides are widely used to control to improve the sustainability of disease control and to
the plant foliar diseases (Li et al. 2011; WuXiaojia 2007). reduce the use of chemical fungicides. Hu et al. (2016)
However, the chemical fungicide is less toxic to the used Trichoderma agent (Tri-1) formulated with chemical
humans and environment, the continuous applications fungicide carbendazim to control Sclerotinia sclerotiorum
endanger humans, non-target wildlife, and ecosystems. infected oilseed rape disease and found the significant
Further, it induces the resistance in pathogens (Bringel reduction in disease, which was similar to the carbendazim
and Couee 2018). Hence the alternative plant protection treatment. Wilson et al. (2008) observed that combined
strategy is an essential tool to reduce the usage of fungicide. use of T. harzianum and flutolanil effectively decresed the
Biological control (BC) is an effective alternative method infection of R. solani and lasted for 30 d. It suggests that
to control the fungal diseases. Among the biological the combined use of Trichoderma with low toxic chemical
control agents (BCAs), Trichoderma was effectively used fungicide would enhance biocontrol efficacy against the
to control the soil-borne diseases (Vinale et al. 2008), fungal pathogens and thereby increase the stability of
such as root rot, stalk rot, sheath blight, etc. (Šrobárová Trichiderma in natural condition. Besides, a few studies
and Eged 2005; Orole and Adejumo 2009; Li et al. 2016; were conducted on the synergistic effect of Trichoderma
Saravanakumar et al. 2017; Wu et al. 2017). But there are and fungicide against foliar pathogens.
few applications to control crop foliar diseases in the field The control of SCLB is mainly relied on chemical
conditions, particularly on the maize leaf spot disease. It is fungicide. However, the extensive application of fungicide
mainly due to its unstable activity under stress and lowers was increasingly limited due to the side effects on consumers
the cost benefit ratio of crop production. Since increasing and environment. Therefore, the aim of our study was to
demands for an eco-friendly approach to control the plant determine whether combined application of Trichoderma and
diseases, maize industry requires to develop a new method fungicide DP had control effect of C. heterostrophus, and
to control the foliar disease. The application of Trichoderma how to synergistic combination of Trichoderma and chemical
against maize foliar diseases were increased. Bhagyashree. fungicide. And furthermore, on what effects of combined
and Beura (2014) studied the biocontrol effects of Bacillus use on host plant defensive enzymes in the greenhouse
subtilis, Trichoderma viride, Trichoderma harzinum and and field conditions.
Pseudomonas fluorescens against Helminthosporium
maydis and observed that different densities of T. harzinum 2. Materials and methods
considerably reduced the disease severity and improved
plant height and dry weight in the guava trees. Kumar et al. 2.1. Microbe strains and maize variety
(2009) measured the in vitro and field efficacy of T. viride,
Trichoderma harzianum and Trichoderma virens against T. harzianum SH2303 was provided by Trichoderma
H. maydis under field condition. Results showed that T. Resource Library of Shanghai Jiao Tong University, China.
viride inhibited the H. maydis growth to an extent of 60.7%, C. heterostrophus race O was isolated from corn leaves in the
followed by T. harzianum (55.1%) and T. virens (52.6%). field, and identified as a highly pathogenic strain, and stored in
Furthermore, soil application of these three Trichoderma, the center of plant pathology in Shanghai Jiao Tong University.
and treatment with T. viride resulted in a minimum disease T. harzianum SH2303 and C. heterostrophus race O were
intensity (2.6), followed by T. harzianum (2.8) and T. cultured on PDA medium and incubated at 28°C for 7 d,
virens (3.0). Wang et al. (2015) observed that foliar spray followed by the fungal spores were collected for further study.
of Trichoderma atroviride SG3403 conidia suspension Maize variety Zhetian 6 provided by Maize Research
protected the maize leaves against SCLB, and it lasted for Institute of Dongyang, Zhejiang Province, China, were
30 d in the field. In addition, resistant-related enzymes, sown in pots each containing five seeds. Then seeds
phenylalanine ammonia lyase (PAL), catalase (CAT), and were cultivated in the greenhouse (16 h light/8 h dark,
superoxide dismutase (SOD), were all up-regulated in maize 26°C/22°C). Four leaf stages were prepared to test the
with T. atroviride SG3403, implying that T. atroviride SG3403 bio-control efficacy of synergistic and individual application
could trigger ISR in maize for pathogenic biocontrol. of T. harzianum SH2303 and DP against C. heterostrophus
4 *** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7

race O. results of biocontrol efficacy were statistically analyzed.

Disease severity index was calculated as described by
2.2. Pot experiment Wang et al. (2015). The disease control efficiency was
calculated as follows:
Evaluation of synergistic and individual application of Control efficiency (%)=(The disease index of control–The
T. harzianum SH2303 and DP on C. heterostrophus race disease index of different treatment groups)/(The disease
O using detached leaf assay Treatments were designed index of control)×100
to test the synergistic application of T. harzianum SH2303
and DP on C. heterostrophus race O as follows (Table 1): 2.3. Field experiment
i) DP+DP. The 30% DP (Switzerland Syngenta Crop
Protection Co., Ltd.) was diluted 1 500 times to be sprayed Five treatments were designed as that of pot experiment, the
over maize leaves in vitro. After 7 d, the second spray was first spray was given at 10 d before V6 period (the sixth leaf
made with the same DP concentration; ii) DP+T. harzianum is fully unfolded, and the growth cone of the tassel begins
SH2303 (DP+SH2303). 30% DP with diluted to elongate, that is, the jointing stage of the corn), and
1 500 times was sprayed on maize leaves, and after 7 d, second spray at the V6 period. The disease index of each
1×106 mL–1 sporesuspension of T. harzianum SH2303 was treatment was evaluated at tasseling, silking and maturity
sprayed evenly on maize leaves; iii) T. harzianum SH230 stage. To calculate the disease control efficiency, survey
3+DP (SH2303+DP). 1×106 mL–1 spore suspension of plots were established at five points, each plot contains 40
T. harzianum SH2303 were sprayed evenly on maize plants. Control efficiency was calculated as shown above.
leaves, and 7 d later, 30% DP with diluted 1 500 times was
sprayed on maize leaves; iv) T. harzianum SH2303+T. 2.4. Assays of defense-related enzymes
harzianum SH2303 (SH2303+SH2303). 0.1×106 mL–1 spore
suspension of T. harzianum SH2303 were sprayed twice Enzyme activity Spore suspensions of pathogen C.
as the above methods mentioned; v) CK. Only water was heterostrophus race O (1×106 mL–1) were sprayed onto
sprayed on maize leaves twice. Each treatment contains maize seedlings leaves and incubated at (28±2)°C in the
five pots each with five seeds. After treatments the leaves greenhouse conditions. Treated leaves were collected at 0,
were collected five times on 1, 5, 10, 15 and 20 d of maize 12, 24, 36, 48, 72, 96, and 120 h to determine the enzyme
seedlings. The leaves were cut into small pieces and placed activity.
in a culture dishes (18 cm in diameter) with filter papers The activity of PAL was determined according to the
pre-moistened with 6-BA (6-benzylaminopurine) solution. method of Rosler et al. (Rosler et al. 1997). The enzyme
Then these leaves were inoculated with 10 µL of 1×106 activity was defined as the amount of enzyme that causing
mL–1 spore suspension of pathogen C. heterostrophus race an increase in 0.01 OD at 290 nm per minute.
O. After incubation at 25°C for 48 h, the infections were The activity of SOD was measured as described by
photographed and lesion sizes were measured. Prochazkova et al. (2001). And the amount of enzyme
Evaluation of synergistic and individual application of T. catalyzed half the maximum inhibition of nitro blue
harzianum SH2303 and DP against C. heterostrophus race tetrazolium reduction was defined as one unit of enzyme
O on maize plants under the greenhouse conditions The activity.
greenhouse experiment was designed using the maize at The CAT activity was assayed according to the procedure
four leaves stage with the same treatments as previous of Aebi (1984). One unit of CAT activity was defined by
mentioned. After treatments, 6 mL of the C. heterostrophus decreasing 0.1 OD value at 240 nm after 1 h of adding H2O2.
race O (1×106 mL–1) spore suspension was sprayed at 1, 5, Defense-related gene expression The leaves at 0, 12,
10, 15 and 20 d of maize seedlings and incubated at 25°C 24, 36, 48 post inoculation of C. heterostrophus race O
moisturizing for 48 h. There were three replicates of each were collected and quickly frozen in liquid nitrogen. Total
treatment, and the experiment was repeated thrice. The RNA was extracted from leaves using Trizol (Invitrogen,

Table 1 Treatments were designed to test the synergistic application of Trichoderma harzianum SH2303 and difenoconazole-
propiconazole (DP) on Cochliobolus heterostrophus race O
Treatments DP+DP DP+SH2303 SH2303+DP SH2303+SH2303 CK
First spray DP DP T. harzianum SH2303 T. harzianum SH2303 Water
(1 500 times diluted) (1 500 times diluted) (1×106 mL–1) (1×106 mL–1)
Second spray DP T. harzianum SH2303 DP (1 500 times diluted) T. harzianum SH2303 Water
(1 500 times diluted) (1×106 mL–1) (1×106 mL–1)
 *** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7 5

Carlsbad, CA, USA), followed by the genome DNA were 2.5. Statistical analysis
removed and converted into first strand cDNA according to
the PrimeScriptTM RT Reagent Kit (TaKaRa, Japan). The The biocontrol effects of the different treatments including in-
cDNA was used as the template for real-time quantitative vitro detached leaf assay, greenhouse and field experiments
RT-PCR (qRT-PCR), using SYBR Premix Ex Taq (2×) (Tli were investigated and compared with the control. All
RNaseH Plus) (TaKaRa, Japan) in the LightCycler® 96 experiments were repeated three times. Control efficiencies,
quantitative thermocycler (Roche, Switzerland). qRT-PCR the enzymes activities and gene expressions of all different
primers for pal, sod, cat and pathogenesis-related protein treatments from three replicates were statistically analyzed
gene (PR1), and jasmonic acid-related gene (OPR1), using one-way ANOVA and Fisher LSD (P≤0.05) (Statistical
were shown in the Table 2. Actin was used as an internal Software Sigma Stat® 2.0 Program, SPSS Inc., USA).
reference gene. The PCR program was performed as
follows: 95°C for 3 min, and 40 cycles of 95°C for 30 s, 3. Results
55°C for 30 s, 72°C for 30 s, extension at 72°C for 5 min.
All experiments were repeated thrice. The qRT-PCR data 3.1. Integrated control effects on the synergistic use
were analyzed using the comparative 2–ΔΔCT method (Gao of T. harzianum and DP against C. heterostrophus
and Chen 2018). race O on maize plants under greenhouse condition

Table 2 Primer sequences for real-time quantitative RT-PCR Evaluation of disease control effect using detached leaf
(qRT-PCR) analysis of defense response-related genes in assay Maize plants grown in the pot at four leaf stage and
maize treated with different combinations of DP+DP, DP+SH2303,
Gene name Primer sequence (5´→3´) SH2303+DP, SH2303+SH2303 and CK. To enusre the
Pal-F GAAGCTCATGTCGTCCACCTA
impacts of DP on T. harzianum and pathogen growth and
Pal-R GTTCATGGTCAGCACCTTCTT
Sod-F AGAATAACATCCCGAAGACATC
reproduction on maize leaves, we analysed the residue of
Sod-R AGCCAACAGTCCAACACAGT DP present over the leaves after the 7th d of spraying. After
Cat-F GAGGGAGAAGGCAACCATAC 7 d of treatment only 0.05 ng g–1 of DP was detected on
Cat-R CTTGGCGAGGAGGTCTATC the leaves (Appendix A), and these residue was ineffective
PR1-F TGGGTGTCCGAGAAGCAGTA
to inhibit the conidial germination and mycelium growth of
PR1-R GCGTTGTTGTCGCAGACG
OPR1-F CGTATGGGAGGCTGTTCTTG T. harzianum and C. heterostrophus (Appendix B). Hence,
OPR1-R AGCGGTCGTATTTGTTGAGTG we analysed the disease control on leaves after the 7th d
Actin-F GGTTCTATTCCAGCCATCCTTCATTG of treatment. The leaves were detached from pot plants
Actin-R TCTCCTTGCTCATGCGGTCAC after 1, 5, 10, 15 and 20 d of treatment and inoculated with

A a b c d e a b c d e a b c d e B
DP+DP DP+SH2303 SH2303+DP

12 SH2303+SH2303 CK

10
The lesion size (mm)

8
1d 5d 10 d
6
a b c d e a b c d e
4

0
1d 5d 10d 15d 20d
–2
15 d 20 d Time (dpt)

Fig. 1 Evaluation of control effect on detached leaf. In pot experiment, maize seedling leaves were treated with DP+DP (a),
DP+SH2303 (b), SH2303+DP (c), SH2303+SH2303 (d), and CK (e). And then 1, 5, 10, 15, 20 d post-treatment were detached
to test the control effect by incubated with Southern corn leaf blight (SCLB) pathogen Cochliobolus heterostrophus race O. A, the
infections were observed and pictured. B, the lesion sizes were measured in these different treatments. Five maize seedlings
were counted for the statistic of lesion sizes in each treatment, and the experiment was repeated three times. Data are expressed
as mean±SD.
6 *** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7

the spore suspension of SCLB pathogen C. heterostrophus 3.3. Induction of maize defense response by the syn-
race O. Based on the results of disease control efficiency ergistic application of DP and T. harzianum SH2303
(Fig. 1-A and B), all treatments were ranked as follows:
DP+DP>DP+SH2303>SH2303+DP>SH2303+SH2303>CK. Enzyme activity analysis To understand the effects
All treatments showed significantly fewer spots compared to of combined use of T. harzianum SH2303 and DP on
the CK. Leaves treated with DP+DP, DP+SH2303 showed maize defense enzyme, several important defense-related
no obvious spots until 10 d of post-treatment (dpt), which enzymes of maize leaf were measured (Fig. 3). The PAL
was followed by SH2303+DP, SH2303+SH2303 and CK. activity in treatments DP+DP, DP+DH2303, SH2303+DP got
There is no significant difference between these treatments the peak at 24 h post-inoculation (hpi) with the pathogen
at 20 dpt, indicating that the control effects of the synergistic and then began to decline. But the maize treated with
SH2303 and DP would last for 15–20 d. The foliar spray of SH2303+SH2303 reached maximum at 36 hpi, which was
DP+SH2303 showed long lasting and better control effect slower than other three treatments. The maize treated with
than other synergistic treatments. DP+SH2303, showed the highest enzyme activities of SOD
Evaluation of disease control effects in pot experiment and CAT. The activities of SOD and CAT in treatments
Maize seedlings at four leaf stage were sprayed with the DP+DP, DP+DH2303, SH2303+DP also showed maximum
C. heterostrophus race O spore suspension at 1, 5, 10, 15, at 24 hpi, and then declined slightly and continued until
and 20 dpt, respectively. The disease control efficiencies 48–120 hpi, which were different with the PAL activity.
of different treatments were statistically investigated and qRT-PCR analysis To ensure the induction of defense-
compared with CK (Table 3). The results obtained were related enzymes by different treatments, qRT-PCR was
consistent with detached leaf assay. The disease symptoms used to measure transcript expressions of defense-related
were not observed until 10 dpt. The disease control genes, such as Pal, Cat, Sod, PR1 (SA pathway marker
efficiency of Trichoderma and DP was gradually declined gene), OPR1 (JA pathway marker gene) (Fig. 4). The
from 10 to 20 dpt. However, the disease control efficiency results showed that the transcript expressions of Pal, Cat,
of DP+SH2303 showed 59.57% at 20 dpt, indicating that and Sod showed maximum in the treatments DP+DP,
sequential spray of DP and SH2303 was better than the DP+SH2303 and SH2303+DP at 24 hpi. Among them,
SH2303+DP. DP+SH2303 revealed the highest peak for Pal, PR1 and
Cat, but, SH2303+SH2303 attained maximum at 36 hpi
3.2. Integrated control effects on the synergistic use and higher than other treatments for Pal, PR1 and Cat.
of T. harzianum and DP against C. heterostrophus However, OPR1, the JA synthesis-related gene (Liu et al.
race O on maize plants under field experiment 2016), had little up-regulated at all the treatments, which was
significantly less than that of SA synthesis-related gene PR1.
The naturally infested SCLB field was chosen to evaluate
the synergistic effects of Trichoderma and DP. Maize 4. Discussion
plants at 10 d before V6 stage were given the first spray
DP or SH2303, and then second spray was practiced at V6 In this study, the biocontrol effects of the synergistic
stage. Though the disease symptoms were not visible in application of DP and T. harzianum SH2303 against C.
tasseling and silking, the disease control efficiency of each heterostrophus race O in maize was tested in greenhouse
treatment was investigated at maturity stage. DP+DP and and field conditions. In the present study, we observed that
DP+SH2303 treatments showed 60% of control efficiency, treatment of DP+SH2303 showed similar efficiency like that
followed by SH2303+DP (45%) and SH2303+SH2303 of DP+DP under different conditions, indicating that the DP
(35%) (Fig. 2-A and B). This was consistent with that of the (spray first)+T. harzianum SH2303 (spray later) might be
greenhouse experiment. a better alternative strategy to control SCLB. Thus, this

Table 3 Control efficiencies investigated at varied inoculation time points after spraying Cochliobolus heterostrophusin pot experiment
Treatment1) 1 d (%) 3 d (%) 10 d (%) 15 d (%) 20 d (%)
DP+DP 100 Aa 100 Aa 98.42 Aa 89.79 Bb 63.09 Cc
DP+SH2303 100 Aa 100 Aa 97.11 Ab 88.02 Bc 59.57 Cd
SH2303+DP 99.04 Aa 98.44 Aa 89.55 Bb 74.94 Cc 29.48 Dd
SH2303+SH2303 99.82 Aa 98.66 Aa 90.69 Bb 71.06 Cc 19.93 Dd
1)
DP, difenoconazole-propiconazole; SH2303, Trichoderma harzianum.
Means were separated by least significant difference (LSD). Values within a column followed by the different uppercase letters
represent significant differences at P≤0.01, and lowercase letters represent significant differences at P≤0.05.
 *** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7 7

A B 70

60

Control efficiency (%)

50
40
a b c 30
20
10
0
DP+DP DP+SH2303 SH2303+ SH2303+
d e DP SH2303

Fig. 2 Control efficiency of Southern corn leaf blight (SCLB) by combined use of Trichoderma harzianum SH2303 and difenoconazole-
propiconazole (DP) in field condition. In field condition, maize before V6 stage and at V6 stage, were respectively treated with
DP+DP (a), SH2303+SH2303 (b), DP+SH2303 (c), SH2303+DP (d), and CK (e). The control effects were measured at maturity
stage. A, the disease incidences were observed and pictured. B, the control efficiencies were measured in these different treatments.
Plots in filed were established at five points, each plot contains 40 plants, and the experiment was repeated three times. Data are
expressed as mean±SD.

DP+DP DP+SH2303 SH2303+DP SH2303+SH2303 CK

A B 8
12 7
SOD activity (OD min–1 g–1)

10 6
PAL activity (OD min–1 g–1)

8 5
4
6
3
4
2
2 1
0 0
0 12 24 36 48 72 96 120 0 12 24 36 48 72 96 120
–2 –1 Time (hpi)
Time (hpi)

C 14

12
CAT activity (OD min–1 g–1)

10

6
Fig. 3 Effects of difenoconazole-propiconazole (DP) and
4 Trichoderma harzianum SH2303 treatments on activities of
defense-related enzymes in maize. Phenylalanine ammonia
2 lyase (PAL, A), superoxide dismutase (SOD, B), and catalase
(CAT, C) activities in maize at 0, 12, 24, 36, 48, 72, 96, 120
0 h post-inoculation (hpi) with Southern corn leaf blight (SCLB)
0 12 24 36 48 72 96 120 pathogen Cochliobolus heterostrophus race O. Data are
Time (hpi) expressed as mean±SD.

strategy might help to reduce 50% of DP. In other words, with SH2303+DP and SH2303+SH2303 showed the lower
Trichoderma agent could be an alternative to reduce effect to control C. heterostrophus race O in maize. It
chemical fungicide use without sacrificing control efficacy, suggested that the selection of sequential spraying was very
it was expected at least reduction 30–50% of chemicals important to control of SCLB in field condition. The stability
fungicide could be reached. Whereas, the maize treated of T. harzianum SH2303 on leaves was not stable due to the
8 *** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7

DP+DP DP+SH2303 SH2303+DP SH2303+SH2303 CK

A
12 B
The expression level of pal

The expression level of sod

10 7
8 6
5
6
4
4 3
2
2
1
0 0
0 12 24 36 48 –1 0 12 24 36 48
–2 Time (hpi) Time (hpi)
C D
14

The expression level of PR1

The expression level of cat

12
12 10
10
8
8
6
6
4 4
2 2
0 0
–2 0 12 24 36 48 –2 0 12 24 36 48
Time (hpi) Time (hpi)
E
The expression level of OPR1

1.2
1.0
0.8
0.6
Fig. 4 Real-time quantitative RT (qRT)-PCR analysis of defense
0.4 genes in maize leaves with combined use of difenoconazole-
0.2 propiconazole (DP) and Trichoderma harzianum SH2303. The
expression levels of defense-related genes, pal, sod, cat, PR1,
0 and OPR1 (A–E, respectively), in maize at 0, 12, 24, 36, 48 h
0 12 24 36 48 post-inoculation (hpi) with SCLB pathogen C. heterostrophus
Time (hpi) race O. Data are expressed as mean±SD (n=3).

different abiotic stress in the natural environment (Howell toxicity (Polidoros et al. 2001; Kużniak and Sklodowska
2003). Hence, the DP could not be completely replaced by 2005). In the present study, the synergistic application
T. harzianum SH2303. But, the DP could be supplemented of Trichoderma and chemical fungicide DP induced both
with T. harzianum SH2303. enzyme activity and transcript expressions of PAL, SOD
Trichoderma species have been recognized as biocontrol and CAT, after C. heterostrophus race O. Similarly, Wang
agents against several pathogens (Perazzolli et al. 2008; et al. (2015), proved that the combined use of DP and
Shoresh et al. 2010). The biocontrol ability of Trichoderma Trichoderma induce the disease resistance against C.
species is based on different mechanisms such as heterostrophus in maize. Note worthily, it was shown that
interference with pathogen’s pathogenicity enzymes (Kapat the defense-related enzymes activities were up-regulated
et al. 1998), direct interaction with the pathogen through in treatment of DP+DP, it suggested that chemical fungicide
antibiosis or parasitism (Elad and Freeman 2002; Howell (DP) not only break the fungal cell membrane but also
2003) and activation of plant disease resistance (Korolev induce maize resistant against pathogen. However, the
et al. 2008). PAL, SOD, and CAT are very important enzymes activities in DP+SH2303 showed much higher
defense-related enzymes in several plants. PAL can not than that in DP+DP, which suggested that the Trichoderma
only catalyze the biosynthesis of lignin but also involved could induce the defense-related enzyme higher than that
in the synthesis of phytoalexin, which are considered as of chemical fungicide (DP). Furthermore, the enzyme
pathogen-resistant compounds (Hemm et al. 2004; Ma activity and transcript expression of CAT in the treatment
et al. 2006). SOD and CAT, as an antioxidant enzyme SH2303+SH2303 reached maximum at 36 hpi, but in other
chain, can scavenge harmful superoxide anion free radicals treatment (DP+SH2303 and SH2303+DP), it reached
to harmless water, protecting the plant from bio-oxygen maximum at 24 hpi. And the treatment SH2303+SH2303
 *** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7 9

showed the highest enzyme activity and gene expression at earmarked fund for China Agriculture Research System
48 hpi. These results suggested that Trichoderma requires (CARS-02), the Key National R&D Programs of China - Key
more time to induce the systemic resistance in plants, and International Intergovernmental Scientific and Technological
it continues for longer time when compared to the chemical Innovation Cooperation Projects (2017YFE0104900) and
fungicide DP (Michele Perazzolli et al. 2011). The disease the Agriculture Research System of Shanghai, China
control efficiency of SH2303+DP showed much lower than (201710).
that of DP+SH2303, it was inferred that the first spraying of
DP could show stronger resistance than the first spraying Appendices associated with this paper can be available on
of Trichoderma, which may be related to the potential http://www.ChinaAgriSci.com/V2/En/appendix.htm
mechanism that Trichoderma strain usually needs some time
for reproduction and secreting elicitor compounds in leaves, References
whereas the first use of DP can initiate the fast inhibition to
pathogen early infection through directly kill and induced Aebi H. 1984. Catalase in vitro. In Methods in Enzymology,
host plant resistance. This might be the reason behind the 105, 121–126.
successful control of the leaf spot in DP+SH2303. On the Bhagyashree K, Beura S K. 2014. Efficacy of biocontrol
other hand, the DP will be degraded within 7 d after spraying, agents against maydis leaf blight of maize. Journal of Plant
hence the second application of Trichoderma would not be Protection and Environment, 11, 95–97.
Bringel F, Couee I. 2018. Plant-pesticide interactions and the
affected by the DP and it continuously induced the systemic
global chloromethane budget. Trends in Plant Science,
resistance in plants.
23, 95–99.
In order to unravel the signaling network governing
Elad Y, Freeman S. 2002. Biological control of fungal plant
the biocontrol effect in maize, we analyzed the transcript
pathogens. In: Agricultural Applications. Springer, Berlin,
expressions of SA- and JA-mediated defense signaling Heidelberg. pp. 93–109.
related marker gene PR1 and OPR1. The results showed Gao J X, Chen J. 2018. Transcriptome analysis identifies
higher expression of PR1 gene compared to the OPR1, candidate genes associated with melanin and toxin
suggesting that SA played more important role than that of biosynthesis and pathogenicity of the maize pathogen,
JA-mediated signal transduction. Similarly, Medina et al. Curvularia lunata. Journal of Phytopathology, 166, 233–241.
(2017) found that SA-mediated defense responses in tomato Hemm M R, Rider S D, Ogas J, Murry D J, Chapple C. 2004.
were triggered in early stage to limit nematode root invasion Light induces phenylpropanoid metabolism in Arabidopsis
(Martínez-Medina et al. 2017). roots. The Plant Journal, 38, 765–778.
Hirooka T, Ishii H. 2013. Chemical control of plant diseases.
Journal of General Plant Pathology, 79, 390–401.
Conclusion
Howell C R. 2003. Mechanisms employed by Trichoderma
species in the biological control of plant diseases: The
The synergistic application of DP and SH2303 in maize
history and evolution of current concepts. Plant Disease,
displayed good biocontrol effects to prevent SCLB in maize
87, 4–10.
under both green house and field conditions. Moreover, Hu X, Roberts D P, Xie L, Yu C, Li Y, Qin L, Hu L, Zhang Y,
defense-related enzymes such as PAL, SOD and CAT, Liao X. 2016. Use of formulated Trichoderma sp. Tri-1 in
and signal substance SA, not JA might be induced by combination with reduced rates of chemical pesticide for
combined uses of DP and SH2303, implying that the mode control of Sclerotinia sclerotiorium on oilseed rape. Crop
of action may include trigger the basal immunity and SA- Protection, 79, 124–127.
mediated immunity. Our study clearly showed that there Kapat A, Zimand G, Elad Y. 1998. Effect of two isolates of
is a synergistic action between T. harzianum SH2303 and Trichoderma harzianumon the activity of hydrolytic enzymes
DP against SCLB, and could reduce the use of chemical produced by Botrytis cinerea. Physiological and Molecular
fungicide, thereby reduce the hazards to consumers and Plant Pathology, 52, 127–137.
Korolev N, David D R, Elad Y. 2008. The role of phytohormones
environment, providing a green and effective way to prevent
in basal resistance and Trichoderma-induced systemic
and control maize SCLB.
resistance to Botrytis cinerea in Arabidopsis thaliana.
BioControl, 53, 667–683.
Acknowledgements Kużniak E, Skłodowska M. 2005. Fungal pathogen-induced
changes in the antioxidant systems of leaf peroxisomes
This work was supported by the National Key Research from infected tomato plants. Planta, 222, 192–200.
and Development Program of China (2017YFD0200901, Legrand F, Picot A, Cobo-Díaz J F, Chen W, Le Floch G. 2017.
2017YFD0201108), the National Natural Science Foundation Challenges facing the biological control strategies for the
of China (31672072, 31872015, 31750110455), the management of Fusarium head blight of cereals caused by
10 *** et al. Journal of Integrative Agriculture 2018, 17(0): 60345-7

F. graminearum. Biological Control, 113, 26–38. Prochazkova D, Sairam R K, Srivastava G C, Singh D V. 2001.
Li Q, Yan F, Chen L, He Y. 2011. Study on two methods of Oxidative stress and antioxidant activity as the basis of
chemical control for maize gray spot disease. Journal of senescence in maize leaves. Plant Science, 161, 765–771.
Yunnan Agricultural University (Natural Science Edition), Rosler J, Krekel F, Amrhein N, Schmid J. 1997. Maize
26, 735–739. (in Chinese) phenylalanine ammonia-lyase has tyrosine ammonia-lyase
Li Y, Sun R, Yu J, Saravanakumar K, Chen J. 2016. Antagonistic activity. Plant physiology, 113, 175–179.
and biocontrol potential of Trichoderma asperellum Kumar S, Rani A, Jha M M. 2009. Potential of Trichoderma spp.
ZJSX5003 against the maize stalk rot pathogen Fusarium as biocontrol agents against pathogens causing maydis leaf
graminearum. Indian Journal of Microbiology, 56, 318–327. blight of maize. Journal of Biological Control, 23, 89–91.
Liu H, Carvalhais L C, Kazan K, Schenk P M. 2016. Development Saravanakumar K, Li Y, Yu C, Wang Q, Wang M, Sun J, Gao
of marker genes for jasmonic acid signaling in shoots and J, Chen J. 2017. Effect of Trichoderma harzianum on maize
roots of wheat. Plant Signaling and Behavior, 11, e1176654. rhizosphere microbiome and biocontrol of Fusarium stalk
Ma C, Zhai C X, Wang L A, Xia C, Li Y, Guo X, Cui S, Li G. rot. Scientific Report, 7, 1771.
2006. Induced resistance by the toxin filtrate of Bipolaris Shoresh M, Harman G E, Mastouri F. 2010. Induced systemic
maydis race T cultivation. Agricultural Sciences in China, resistance and plant responses to fungal biocontrol agents.
5, 678–684. Annual Review of Phytopathology, 48, 21–43.
Malik V K, Singh M, Hooda K S, Yadav N K, Chauhan P K. 2018. Šrobárová A, Eged S. 2005. Trichoderma and sulphoethyl
Efficacy of newer molecules, bioagents and botanicals glucan reduce maize root rot infestation and fusaric acid
against maydis leaf blight and banded leaf and sheath content. Plant Soil and Environment, 51, 322–327.
blight of maize. The Plant Pathology Journal, 34, 121–125. Vinale F, Sivasithamparam K, Ghisalberti E L, Marra R, Woo S
Martínez Medina A, Fernandez I, Lok G B, Pozo M J, Pieterse L, Lorito M. 2008. Trichoderma-plant-pathogen interactions.
C M, Van Wees S. 2017. Shifting from priming of salicylic Soil Biology and Biochemistry, 40, 1–10.
acid to jasmonic acid regulated defences by Trichoderma Wang M, Ma J, Fan L, Fu K, Yu C, Gao J, Li Y, Chen J. 2015.
protects tomato against the root knot nematode Meloidogyne Biological control of southern corn leaf blight by Trichoderma
incognita. New Phytologist, 213, 1363–1377. atroviride SG3403. Biocontrol Science and Technology,
Orole O O, Adejumo T O. 2009. Activity of fungal endophytes 25, 1133–1146.
against four maize wilt pathogens. African Journal of Wang M, Wang S, Ma J, Yu C, Gao J, Chen J. 2017. Detection of
Microbiology Research, 3, 969–973. Cochliobolus heterostrophus races in South China. Journal
Perazzolli M, Dagostin S, Ferrari A, Elad Y, Pertot I. 2008. of Phytopathology, 165, 681–691.
Induction of systemic resistance against Plasmopara Wilson P S, Ahvenniemi P M, Lehtonen M J, Kukkonen M, Rita
viticola in grapevine by Trichoderma harzianum T39 and H, Valkonen J P T. 2008. Biological and chemical control
benzothiadiazole. Biological Control, 47, 228–234. and their combined use to control different stages of the
Perazzolli M, Roatti B, Bozza E, Pertot I. 2011. Trichoderma rhizoctonia disease complex on potato through the growing
harzianum T39 induces resistance against downy mildew by season. Annals of Applied Biology, 153, 307–320.
priming for defense without costs for grapevine. Biological Wu Q, Zhang L, Xia H, Yu C, Dou K, Li Y, Chen J. 2017. Omics
Control, 58, 74–82. for understanding synergistic action of validamycin A and
Polidoros A N, Mylona P V, Scandalios J G. 2001. Transgenic Trichoderma asperellum GDFS1009 against maize sheath
tobacco plants expressing the maize Cat2 gene have altered blight pathogen. Scientific Report, 7, 40140.
catalase levels that affect plant-pathogen interactions and Wu X. 2007. Formulation study of 10% difenoconazole water
resistance to oxidative stress. Transgenic Research, 10, dispersible granules. Anhui Chemical Industry, 33, 33–34.
555–569. (in Chinese)

Section editor WAN Fang-hao

Managing editor ZHANG Juan