Nutrition & Metabolism BioMed Central

Research Open Access

Plasma homocysteine in adolescents depends on the interaction
between methylenetetrahydrofolate reductase genotype, lipids and
folate: a seroepidemiological study
Ruth Gil-Prieto*1, Valentín Hernández1, Beatriz Cano2, Manuel Oya2 and
Ángel Gil1

Address: 1Preventive Medicine & Public Health Unit, Health Sciences I Department, Rey Juan Carlos University Avda de Atenas s/n, 28922
Alcorcón, Madrid, Spain and 2Lipids Unit, Jiménez Díaz Fundation, Madrid, Avda Reyes Católicos, 2, 28040 Madrid, Spain
Email: Ruth Gil-Prieto* - [email protected]; Valentín Hernández - [email protected]; Beatriz Cano - [email protected];
Manuel Oya - [email protected]; Ángel Gil - [email protected]
* Corresponding author

Published: 5 October 2009 Received: 27 July 2009

Accepted: 5 October 2009
Nutrition & Metabolism 2009, 6:39 doi:10.1186/1743-7075-6-39
This article is available from: http://www.nutritionandmetabolism.com/content/6/1/39
© 2009 Gil-Prieto et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract
Background: Many publications link high homocysteine levels to cardiovascular disease. In Spain there is
little information on the prevalence of hyperhomocysteinaemia and associated vitamin factors among the
general population, and less still among children. Cardiovascular risk factors in the childhood population
may be related to the appearance of cardiovascular disease at adult age. The aim of this study is to establish
a definition of hyperhomocysteinaemia in adolescents and to analyze the influence of vitamin and metabolic
factors in homocysteine levels in this population group.
Methods: Descriptive, cross-sectional epidemiological study to estimate serum homocysteine, vitamin
B12 and folate levels, as well as plasma total, HDL- and LDL- cholesterol in a schoolgoing population aged
13 to 17 years in Madrid, Spain.
Spearman correlation analysis was performed to ascertain quantitative comparison, Pearson's χ2 test
(frequency < 5, Fisher) was used for comparison of prevalences, Mann-Whitney U and Kruskal-Wallis test
were used for comparison of means and Bonferroni correction was used for post-hoc tests. A multivariate
logistic regression model was performed in the multivariate analysis.
Results: Based on the classic values for definition of hyperhomocysteinaemia in adults, prevalence of
hyperhomocysteinaemia in the study population was: 1.26% for 15 μmol/L; and 2.52% for 12 μmol/L.
Deficits in HDL cholesterol and serum folate levels yielded adjusted Odds Ratios (OR) for
hyperhomocysteinemia of 2.786, 95% CI (1.089-7.126), and 5.140, 95% CI (2.347-11.256) respectively.
Mutation of the methylenetetrahydrofolate reductase (MTHFR) C677T genotype also raises the risk of
hyperhomocysteinaemia (CC→CT: OR = 2.362; 95% CI (1.107-5.042) CC→TT: OR = 6.124, 95% CI
(2.301-16.303))
Conclusion: A good definition of hyperhomocysteinaemia in adolescents is the 90th percentile, equivalent
to 8.23 μmol/L. Risk factors for hyperhomocysteinaemia are cHDL and folate deficiency, and the MTHFR
C677T mutant genotype. No significant effect could be assessed for vitamin B12. Coexistence of all three
factors increases the risk of suffering from hyperhomocysteinaemia 87-fold.

Page 1 of 9
(page number not for citation purposes)
Nutrition & Metabolism 2009, 6:39 http://www.nutritionandmetabolism.com/content/6/1/39

Background When these reactions are altered, homocysteine accumu-

In addition to being the principal cause of premature lates and is excreted into the blood, causing hyperhomo-
death in most European countries, cardiovascular diseases cysteinaemia [8], which, according to a number of
(CVDs) are a major cause of disability, and, by extension, epidemiological studies, is associated with an increase in
increased health care cost [1]. Such diseases are generally the probability of suffering from CVDs [9-15].
due to a combination of several risk factors [2]. In 1996,
the 27th Bethesda Conference proposed hyperhomocystei- Hyperhomocysteinaemia is defined as elevated concentra-
naemia as one of the new cardiovascular risk factors [3,4]. tion of fasting plasma total homocysteine.

Inasmuch as it involves a potentially modifiable and cor- As is the case with other parameters, such as arterial hyper-
rectable risk factor, this hypothesis is of great health care tension, no threshold plasma homocysteine value has
importance since it opens the door to a new form of inter- been established, above which the risk of suffering from a
vention against cardiovascular diseases, such as dietary vascular disease is increased [16,17]. In most studies, this
supplementation with group B vitamins and folic acid. threshold is obtained arbitrarily, with values above the
mean found in the control group plus two standard devi-
Homocysteine is a sulphur-containing amino acid derived ations [17-20], or above the 95th percentile, being used to
from methionine, present in proteins of animal origin define hyperhomocysteinaemia [16,17,20-22].
ingested as part of dietary intake. It is produced by intrac-
ellular demethylation of methionine and then exported to In Spain, Pijoan et al. constructed a reference interval (5-
the plasma, where it circulates, mainly in its oxidised 15 μmol/l) based on a sample of 396 apparently healthy
form. individuals [23].

Homocysteine is metabolised to methionine via remeth- Plasma homocysteine levels increase with weight, height,
ylation or to cysteine via transulphuration at the hepatic body mass index, blood pressure, systolic and diastolic
level. During vitamin B6-dependent transulphuration, pressure, age, male gender and MHTFR 677TT genotype.
homocysteine is irreversibly catabolised into cysteine, In contrast, they decrease with high plasma folate and
thanks to the action of cystathionine-β-synthetase intraerythrocyte, vitamin B6 and vitamin B12 concentra-
enzyme, in the presence of serine. Most of the homo- tions.
cysteine is remethylated, regenerating methionine, mainly
due to the action of methionine synthetase, the enzyme The established drug treatments for hyperhomocysteinae-
that depends on the action of methylcobalamine (vitamin mia are vitamin supplements consisting of folate, vitamin
B12) as a co-factor and folate, in the form of 5-methyl-tet- B6, vitamin B12 or any combination of the three [24].
rahydrofolate, as a methyl group donor.
In the healthy paediatric population, homocysteine levels
The enzyme, 5,10-methyl-tetrahydrofolate reductase are influenced more by biochemical than by genetic fac-
(MTHFR) reduces 5,10-methylenetetrahydrofolate to 5- tors, due to the high folate reserves present during child-
methyl-tetrahydrofolate in the presence of NADPH. This hood. No significant differences in homocysteine levels
reaction is irreversible in vivo and its activity regulates the were observed between boys and girls until postpubertal
entry of folate into the homocysteine remethylation path- age, when these rise in males [25].
way.
Arterosclerosis begins at early ages of life [26,27] and envi-
The MTHFR C677T mutation is the most frequent cause of ronmental factors in childhood are known to be linked to
moderate hyperhomocysteinaemia due to genetic factors. the appearance of cardiovascular disease at adult age [28].
The TT genotype has been found to have a direct effect on
homocysteine concentration, with MTHFR enzymatic Determination of plasma homocysteine in children could
activity being reduced by as much as 50% in individuals have a predictive value vis-à-vis adult vascular risk [29].
with this mutation [5]. This polymorphism is present in
its homozygous form in 5%-18% of the population [6]. Methods
A descriptive, cross-sectional epidemiological study was
The effect of the TT homozygote genotype on homo- conducted to estimate serum homocysteine levels in the
cysteine concentration is not observed, however, when schoolgoing population aged 13 to 17 years in the Madrid
folic acid levels are elevated [7]. This is due to the fact that, Region (Comunidad de Madrid). All children who partici-
despite the reduction in its enzymatic activity, MTHFR has pated (172 girls and 145 boys) were recruited at selected
sufficient 5-10 methyltetrahydrofolate substrate to gener- junior schools, using random, stratified, cluster sampling.
ate the 5-methyltetrahydrofolate necessary for remethyla- Junior schools were selected in strata that would ensure
tion of homocysteine. representation of socio-economic differences.

Page 2 of 9
(page number not for citation purposes)
Nutrition & Metabolism 2009, 6:39 http://www.nutritionandmetabolism.com/content/6/1/39

For a level of precision of 3%, an estimated prevalence of analysis, higher decile (P90) was defined as hyperhomo-
5% and a confidence level of 95%, a minimum sample cysteinemia.
size of 202 was needed. Assuming lost of 20%, a total of
243 subjects was needed. (EPI-INFO 2002; version 6). Determination of vitamin B12
Vitamin B12 (Vit B12) in the fasting blood specimen [31]
The study included subjects of both sexes, who were aged was determined, using a Roche Elecsys E170 MODULAR
over 13 years, attended schools in the Madrid Region and ANALYTICS immunoanalysis assay.
produced informed consent. The following were subjects
excluded from the study: those whose parents failed to Determination of folate
sign the authorisation to participate; those who were Folate in the fasting blood specimen [32] was determined,
authorised but were nevertheless unwilling to participate; using a Roche Elecsys E170 MODULAR ANALYTICS
and those who presented with some type of acute or immunoanalysis assay.
chronic illness that might affect the variables of interest.
Determination of the MTHFR C677T genotype
In each case, data were collected on age, gender, physical Replacement of cytosine by thimine at nucleotide posi-
activity, blood pressure and anthropometric variables. tion 677 converts the amino acid, alanine, into valine:
(normal genotype = CC, heterozygous genotype = CT,
Anthropometric variables mutated homozygous genotype = TT). DNA was ampli-
Subjects' weight and height, as well as arm, waist and hip fied by PCR in a PTC-100 thermal cycler using nucle-
circumferences were measured in duplicate, using cali- otides:
brated precision scales (Seca 812, precision 0.1 kg), port-
able wall-mounted stadiometres (Seca Ka We 4444 Forward: 5'TGAAGGAGAAGGTGTCTGCGGGA 3'
model) and flexible, inelastic, plastic belt-type measuring
tapes fitted with a read-out buckle at one end. Body mass Reverse: 3'AGGACGGTGCGGTGAGGAGGTG 3'.
index (weight in kg/height2 in m2) was then calculated on
the basis of these measures. The product of this reaction was digested with HinfI
restriction enzyme, and the fragments then separated in
Blood pressure non-denaturing polyacrylamide gel.
Three readings were taken from each subject in accord-
ance with standardised guidelines issued by international For a negative control, distilled water instead of DNA in
bodies, using a mercury sphygmomanometer (Diplomat the reaction system was used for each panel of PCR. For
Presameter Riester Model) and an appropriately sized cuff positive DNA control, DyNAzyme DNA Polymerase Kit
chosen in line with the individual's arm circumference. (Finnzymes Oy) was used.

Lipid profile Statistical data analysis

Cholesterol and triglyceride levels were measured in total Based on all the valid data obtained, we performed a
plasma through enzymatic methods. descriptive analysis of both the independent and depend-
ent variables of interest, using centralisation and disper-
In the case of girls, information was collected on the sion measures (means or medians where the distribution
appearance or non-appearance of menarchy. was asymmetric), accompanied by their corresponding
95% confidence intervals in the case of quantitative varia-
Processing of blood specimens bles and distribution of frequencies (prevalences and pro-
A first morning, 12-hour, fasting, 14-ml blood specimen portions with 95% confidence intervals) in the case of
was extracted from each subject by venipuncture, using a qualitative variables.
Vacutainer tube containing EDTA-Na2 as antioxidant and
anticoagulant (10 ml EDTA) and an SST Vacutainer with- This analysis was stratified by gender, presence of men-
out anticoagulant (4 ml SST). struation, age group, and MTHFR C677T genotype.

The specimens were then stored on ice and sent immedi- The normality of the homocedasticity variables was veri-
ately to the laboratory for analysis, where they were cen- fied using the Kolmogorov-Smirnov test. Where variables
trifuged at 3500 rpm for 6 minutes a 4°C within the hour. did not follow a normal distribution, non-parametric tests
were used. Homoscedasticity or homogeneity of variances
Determination of total homocysteine was examined using Levene's test.
Total homocysteine in the fasting blood specimen [30]
was determined, using an Abbott Diagnostics fluores- A Spearman correlation analysis was performed to ascer-
cence polarisation immunoassay (FPIA). For multivariate tain the magnitude of the linear relationship between the

Page 3 of 9
(page number not for citation purposes)
Nutrition & Metabolism 2009, 6:39 http://www.nutritionandmetabolism.com/content/6/1/39

quantitative anthropometric, biochemical and metabolic Table 1: Biochemical variables and hormonal factors
cycle variables and homocysteine values. The technique
Mean 95% Confidence Interval
used for comparison of prevalences was Pearson's χ2 test
(frequency < 5, Fisher). We used the Mann-Whitney U test Glucose (mg/dl) 90.9 90.0-91.9
for comparison of means, and the Kruskal-Wallis test for Total cholesterol (mg/dl) 160.9 157.9-163.9
variables with more than two categories or for inclusion of HDL cholesterol (mg/dl) 47.3 46.0-48.7
different variables simultaneously. Bonferroni correction LDL cholesterol(mg/dl) 96.7 94.0-99.4
was used for post-hoc tests to ensure that all comparisons Total cholesterol/cHDL 3.60 3.48-3.71
were made with α = 0.05. cLDL/cHDL 2.20 2.10-2.30
Menarche age (years) 12.01 11.86-12.15

Independent variables that displayed a significant associ-

Folate (nmol/L) 7.83 7.42-8.23
ation in the simple analysis as well as those that were clin- Vitamin B12 (pmol/L) 503 478-528
ically linked to the study variable, were included in a Homocysteine (μmol/L) 4.92 4.50-5.35
multivariate logistic regression model. Based on this, the
adjusted Odds Ratios of the principal study factors were HDL: High Density Lipoproteins
obtained, along with their corresponding 95% confidence LDL: Low Density Lipoproteins
intervals.
When analysing MTHFR C677T genotype, normal
In all hypothesis testing to determine differences, associa- homozygous CC in the methylenetetrahydrofolate reduct-
tions and relationships were deemed significant at p < ase enzyme was present in 37.8%, heterozygous CT geno-
0.05. type was present in 47.3%, and TT genotype,
corresponding to the homozygous mutation, was present
Statistical data analyses were performed using the SPSS in 14.9% of cases.
computer software programme (Statistical Package for
Social Sciences) version 16.0. Table 3 shows the prevalence of potential cardiovascular
risk factors and variables implicated in homocysteine
Ethical aspects metabolism. Of the total study population, 23.8% dis-
The research protocol was approved by the Jiménez Díaz played deficient serum folate levels (≤ 5.3 nmol/l) and
Foundation Clinical Research Ethics Committee. This 24.6% displayed deficient vitamin B12 levels (≤ 336 pmol/
study complied in all respects with the ethical safeguards l). Overweight, elevated glucose levels, deficient vitamin
laid down by the Helsinki Declaration and its subsequent B12 and HDL cholesterol values were greater in boys,
updates, and with Spanish legislation governing clinical whilst girls showed greater sedentariness and hypercho-
research involving humans and protection of data of a lesterolaemia. Prevalence of occasional tobacco and alco-
personal nature hol use increased with age. Folate deficit was significantly
greater among subjects that displayed total (homozygote
Results TT) mutation of the MTHFR C677T genotype (Table 3).
The study population totalled 317 students, 50% aged 13
years, 35% aged 14 years and 15% aged 15 or more years; In order to assess analyze the influence of vitamin and
54% were females and 46% males. The mean age of the metabolic factors in homocysteine levels in this popula-
study subjects was 13.69 years, 95% CI (13.60-13.78), tion group, hyperhomocysteinemia was defined as per-
and their anthropometric characteristics corresponded to centile 90th. Crude analysis showed how prevalence of
the expected values for their age. hyperhomocysteinaemia increases with male gender
(32.4% vs. 18.0% in female), age (21.0%, 22.3%, 40.4%
Table 1 shows the serum or plasma values for the princi- for 13, 14 and >14, respectively), mutation of the MTHFR
pal biochemical variables and possible hormonal factors C677T genotype (15.1%, 24.8%, 46.8% for CC, CT and
implicated in cardiovascular disease. Mean concentra- TT genotype, respectively), HDL cholesterol (22,7% vs.
tions were as follows: serum folate, 7.83 nM, 95% CI 37.2% for normal and low levels, respectively) and defi-
(7.42-8.23) nM; vitamin B12, 503 pM, 95% CI (478-528) cient folate values (19.4 vs. 43.2% for normal and low lev-
pM; and homocysteine, 4.92 μM, 95% CI (4.50-5.35) μM. els, respectively). These independent variables, as well of
other of interest as vitamin B12, were included in a multi-
Taking the classic values as reference, prevalence of hyper- variate logistic regression model, obtaining adjusted Odds
homocysteinaemia in the study population was 1.26% for Ratios for the principal study factors (Table 4).
15 μmol/L, and 2.52% for 12 μmol/L. Table 2 defines dif-
ferent cut-off points for hyperhomocysteinaemia in chil- Deficient HDL cholesterol and serum folate levels regis-
dren. tered adjusted Odds Ratios of OR = 2.786, 95% CI (1.089-

Page 4 of 9
(page number not for citation purposes)
Nutrition & Metabolism 2009, 6:39 http://www.nutritionandmetabolism.com/content/6/1/39

Table 2: Threshold determination to define hyperhomocysteinemia

Hyperhomocysteinemia P50 P75 P90 P95 Hcy ≥ 12 Hcy ≥ 15

Threshold [Hcy]/μM 4.30 5.93 8.23 10.41 12.00 15.00

Number of cases 157 78 32 15 8 4
Prevalence % 49.53 24.61 10.1 4.73 2.52 1.26
95% CI 43.99-55.06 19.84-29.37 6.78-13.41 2.38-7.08 0.79-4.26 0.03-2.50

P: percentile

7.126) and OR = 5.140, 95% CI (2.347-11.256) respec- folate and cHDL is almost 34 times more likely to suffer
tively. The MTHFR C677T mutant genotype raised the risk from hyperhomocysteinaemia; and if that same individ-
of hyperhomocysteinaemia (CC→CT: OR = 2.362; 95% ual has these deficits plus the TT genotype, the likelihood
CI (1.107-5.042) CC→TT: OR = 6.124, 95% CI (2.301- of his/her having high serum homocysteine levels is then
16.303)) 87 times higher.

After plausible biologically interactions have been ruled Discussion

out, the multiplicative nature of the association among This study suffers from the limitations inherent in all
several risk factors in the sample can be observed, namely, cross-sectional studies, in that it does not allow for causal
prevalence of hyperhomocysteinaemia increases in or temporal relationships among variables to be estab-
accordance with the number of risk factors (FR) that accu- lished, thus rendering it necessary for subsequent analyti-
mulate. cal epidemiological studies to be conducted in order to
confirm the results and hypotheses generated. Further-
From Table 5, it will be seen how the prevalence of hyper- more, some confounding variables may not have not been
homocysteinaemia rises when deficient folate and HDL included in this study, e.g., methionine intake, creatinine
cholesterol values and mutant genotype coincide. Shown levels, or polymorphisms of the nicotinamide-methyl-
in Figure 1 is the cumulative effect of the most important transferase enzyme (chromosome 11q23), which have
risk factors, i.e., genotype, folate deficit and HDL choles- recently been linked to plasma homocysteine levels [33].
terol deficit. An indiviual with CT genotype and deficient

Table 3: Prevalence of cardiovascular risk factors and lipid profile

Total (%) Gender* Age* MTHFR C677T genotype*

Male Female 13 14 >14 CC CT TT

Overweight 30.3 35.9 25.6 ns ns

Hypertension 8.5 ns ns ns
Glucose (≥ 100 mg/dl) 15.3 22 9.6 ns ns
Total cholesterol (≥ 200 mg/dl) 7.0 2.8 10.5 ns ns
HDL cholesterol (≤ 35 mg/dl) 13.8 20.1 8.3 ns ns
LDL cholesterol (≥ 130 mg/dl) 6.4 ns ns ns
Total cholesterol/cHDL 9.1 ns ns ns
(>5en 씹/4.5 en 씸)
cLDL/cHDL 8.5 ns ns ns
(>3.5 씹/3 씸)
Smoking 7.6 ns 3.2 14.5 19.1 ns
Alcohol 9.8 ns 1.9 12.5 12.8 ns
Sedentariness 17.7 9 25.1 ns ns
Folate (≤ 5.3 nmol/l) 23.8 ns ns 18.8 20.4 46.7**
Vitamin B12 24.6 30.3 10 ns ns
(≤ 336 pmol/l)

*Statistically significant p < 0.05. ns: non-significant; ** differences in folate deficit were statistically significant (p < 0.001) only for homozygotic TT
mutation. CT heterozygotic mutation does not show an statistically significant difference (p = 0.758)
HDL: High Density Lipoproteins
LDL: Low Density Lipoproteins
MTHFR: methylenetetrahydrofolate reductase
C: Cytosine; T:Thymine

Page 5 of 9
(page number not for citation purposes)
Nutrition & Metabolism 2009, 6:39 http://www.nutritionandmetabolism.com/content/6/1/39

Table 4: Adjusted ORs for hyperhomocysteinemia

Odds Ratio 95% CI p

cHDL deficit*,** 2.786 1.089-7.126 0.033

Folate deficit*,*** 5.140 2.347-11.256 <0.001
MTHFR C677T genotype *
CT 2.362 1.107-5.042 0.001
TT 6.124 2.301-16.303

*Statistically significant.
HDL: High Density Lipoproteins
MTHFR: methylenetetrahydrofolate reductase
C: Cytosine; T:Thymine
**<5.3 nmol/l
***<35 mg/dl
In Spain, Gutiérrez-Revilla et al. (n = 83), Vilaseca et al. (n The distribution of the various polymorphisms of the
= 195) and Mainou et al. (n = 80) have respectively pub- MTHFR C677T enzyme in our sample was very similar to
lished cross-sectional studies in children and adolescents. that observed in other studies [35,36], i.e., Hiraoka, with
The first two targeted the population aged 0 to 18 years, 32.9%, 51.6% and 15.5%, in CC, CT and TT respectively
and the third the population aged 5 to 18 years. Ours is [37], or Gutiérrez-Revilla et al., with 42.2%, 41% and
the first study conducted in Spain and focused on the ado- 16.9%, in CC, CT and TT respectively [25]. The cardiovas-
lescent population to have a substantial sample size. cular risk factors studied showed no significant variation
according to MTHFR genotype, which only affects folate
In Western countries, vitamin deficiencies are rather infre- and serum homocysteine levels.
quent, but in populations with important vitamin defi-
ciencies, plasma homocysteine levels rise until reaching The mean homocysteine values obtained by us are very
age-adjusted hyperhomocysteinaemia prevalences of 73% similar to those found in children and adolescents in Nor-
in men and 41% in women, as shown by a recent study way and the USA, namely, 5.25 and 5 μmol/l, respectively
conducted in Iran [34]. [38,39]. There is no international consensus regarding the
establishment of a cut-off point for defining hyperhomo-
cysteinaemia, and there are still fewer data relating to the
adolescent population. Prevalence of hyperhomocystein-
aemia in the study population was 1.26% for 15 μmol/L
and 2.52 for 12 μmol/L, results very similar to those
recently obtained in young adults aged 20-22 years in
OR=
Folate deficit cHDL deficit Tokyo (1.18% for > 15 μmol/L) [37]. Taking into account
(<5.3 nmol/l) 14.32 (<35 mg/dl other international studies, which use percentiles for
OR = 5.140 OR = 2.786
determining other magnitudes in childhood and adoles-
OR=
cence, the 90th percentile is considered a good cut-off
87.70
point for defining hyperhomocysteinaemia in developed
OR= OR=
31.48 17.06
countries [29,40,41]. In our study, this cut-off allowed us
to show a statistically significant increase of plasma
homocysteine levels depending on the study variables. In
line with other studies [5,23,42-46], prevalence of hyper-
Genotipe homocysteinaemia was seen to increase in our study with
CCCT the MTHFR C677T mutant allele (2- and 6-fold for partial
OR = 2.362 and total C→T mutation, respectively), serum folate defi-
cit (5-fold) and cHDL deficit (2.7-fold). No significant
association was found with vitamin B12 after adjusting by
age, gender and CV risk factors.
Figure 1 ORs: Folate, cHDL and MTHFR C677T genotype
Cumulative
Cumulative ORs: Folate, cHDL and MTHFR C677T It has been observed that the coexistence of several risk
genotype. Cumulative effect of risk factors in homocystein factors, none of which is necessarily elevated to an extraor-
prevalence. HDL: High Density Lipoproteins. MTHFR: meth-
dinary degree, in any given individual can actually be
ylenetetrahydrofolate reductase. C: Cytosine; T: Thymine;
CC: normal genotype; CT: partial mutation; TT: mutation in more dangerous than the existence of a single factor,
homozygosis. regardless of its magnitude [44,47]. In our study, as previ-

Page 6 of 9
(page number not for citation purposes)
Nutrition & Metabolism 2009, 6:39 http://www.nutritionandmetabolism.com/content/6/1/39

Table 5: Risk factor accumulation: genotype, folate and HDL-cholesterol

Genotype Folate cHDL % Hyperhomocysteinemia

CC Normal Normal 10.7

Low levels** 18.2

Low levels* Normal 31.8

Low levels** 0.0

CT Normal Normal 20.2

Low levels** 36.8

Low levels* Normal 29.2

Low levels** 66.7

TT Normal Normal 38.1

Low levels** 33.3

Low levels* Normal 55.6

Low levels** 100.0

HDL: High Density Lipoproteins

MTHFR: methylenetetrahydrofolate reductase
C: Cytosine; T:Thymine
*<5.3 nmol/l
**<35 mg/dl

ously described in Guo et al [48], prevalence of hyperho- further contribution towards finding an answer in this
mocysteinaemia increases when risk factors accumulate. field of investigation
The probability of being hyperhomocysteinemic is 5
times higher with deficit serum folate levels than it is with Conclusion
normal values. If, the person concerned also happens to A good definition of hyperhomocysteinaemia in adoles-
be a carrier of the MTHFR TT polymorphism, this risk is cents is the 90th percentile, equivalent to 8.23 μmol/L.
then multiplied by 30 because his/her ability to metabo-
lise homocysteine is very reduced; and if, in addition to Risk factors for hyperhomocysteinaemia are cHDL and
this, such a person has HDL cholesterol levels below 35 folate deficiency, and the MTHFR C677T mutant geno-
mg/dl, the likelihood of his/her being hyperhomo- type. Coexistence of all three factors increases the risk of
cysteinemic is multiplied by 90. These results suggest that suffering from hyperhomocysteinaemia 87-fold.
the higher decile is an appropriate cut-off to define homo-
cysteinemia in adolescents. Competing interests
The authors declare that they have no competing interests.
While many national and international studies link deficit
serum folate levels to hyperhomocysteinaemia and sug- Authors' contributions
gest dietary supplementation as a preventive strategy for RGP: design and coordination of the study, data acquisi-
reducing cardiovascular risk [48-53], other authors con- tion, analysis and interpretation of data, perform the sta-
tend that, as hyperhomocysteinaemia has not yet been tistical analysis and drafted the manuscript, VH:
shown to be an independent risk factor, dietary supple- participated in the statistical analysis, BC: carried out the
mentation is not justified [54]. PCRs, MO: design and coordination of the study, acquisi-
tion of funding, general supervision of the research group,
We thus feel that we are confronted by a still unresolved AG: design and coordination of the study, acquisition of
research question, and trust that our study may serve as a funding, general supervision of the research group. All

Page 7 of 9
(page number not for citation purposes)
Nutrition & Metabolism 2009, 6:39 http://www.nutritionandmetabolism.com/content/6/1/39

authors but MO, which sadly died during manuscript 16. Arnesen E, Refsum H, Bonaa KH, Ueland PM, Forde OH, Nordrehaug
JE: Serum total homocysteine and coronary heart disease. Int
preparation, read and approved the final manuscript. J Epidemiol 1995, 24(4):704-9.
17. Robinson K, Mayer EL, Miller DP, Green R, van Lente F, Gupta A, et
Acknowledgements al.: Hyperhomocysteinemia and low pyridoxal phosphate.
Common and independent reversible risk factors for coro-
This study forms part of a wider project entitled, "Evaluation of time trends
nary artery disease. Circulation 1995, 92(10):2825-30.
in eating habits and anthropometric and metabolic variables among chil- 18. Cordoba PA, Blanco VF, Gonzalez SF: [Hyperhomocysteinemia:
dren. Follow-up of the Four Provinces Study in the Madrid Region" (Eval- a new marker of vascular risk: affected vascular areas, its
uación de las tendencias temporales en los hábitos alimentarios y en las variables role in the pathogenesis of arteriosclerosis and thrombosis
antropométricas y metabólicas en niños. Seguimiento del Estudio Cuatro Provin- and treatment]. Med Clin (Barc) 1997, 109(18):715-25.
19. Taylor LM Jr, DeFrang RD, Harris EJ Jr, Porter JM: The association
cias en la Comunidad de Madrid), funded by the Madrid Regional Educational of elevated plasma homocyst(e)ine with progression of
Authority through its General-Directorate for Research (Dirección General symptomatic peripheral arterial disease. J Vasc Surg 1991,
de Investigación de la Consejería de Educación de la Comunidad de Madrid). All 13(1):128-36.
authors have nothing to disclosure 20. Stampfer MJ, Malinow MR, Willett WC, Newcomer LM, Upson B, Ull-
mann D, et al.: A prospective study of plasma homocyst(e)ine
and risk of myocardial infarction in US physicians. JAMA 1992,
This manuscript is presented in memoriam of Manuel Oya. 268(7):877-81.
21. Graham IM, Daly LE, Refsum HM, Robinson K, Brattstrom LE, Ueland
References PM, et al.: Plasma homocysteine as a risk factor for vascular
disease. The European Concerted Action Project. JAMA 1997,
1. Tunstall-Pedoe H, Kuulasmaa K, Mahonen M, Tolonen H, Ruokokoski 277(22):1775-81.
E, Amouyel P: Contribution of trends in survival and coronary- 22. Wu LL, Wu J, Hunt SC, James BC, Vincent GM, Williams RR, et al.:
event rates to changes in coronary heart disease mortality: Plasma homocyst(e)ine as a risk factor for early familial cor-
10-year results from 37 WHO MONICA project populations. onary artery disease. Clin Chem 1994, 40(4):552-61.
Monitoring trends and determinants in cardiovascular dis- 23. Pijoan Zubizarreta JI, Irigoien GI, Aguirre EC: Intervalos de refer-
ease. Lancet 1999, 353(9164):1547-57. encia poblacional y determinantes de la homocisteína plas-
2. Trabetti E: Homocysteine, MTHFR gene polymorphisms, and mática. Med Clin (Barc) 2001, 117(13):487-91.
cardio-cerebrovascular risk. J Appl Genet 2008, 49(3):267-82. 24. Guba SC, Fink LM, Fonseca V: Hyperhomocysteinemia. An
3. Pasternak RC, Grundy SM, Levy D, Thompson PD: 27th Bethesda emerging and important risk factor for thromboembolic and
Conference: matching the intensity of risk factor manage- cardiovascular disease. Am J Clin Pathol 1996, 106(6):709-22.
ment with the hazard for coronary disease events. Task 25. Gutierrez Revilla JI, Perez HF, Tamparillas SM, Calvo Martin MT:
Force 3. Spectrum of risk factors for coronary heart disease. [Influence of biochemical and genetic factors on homo-
J Am Coll Cardiol 1996, 27(5):978-90. cysteine concentrations]. An Pediatr (Barc) 2004, 60(3):215-21.
4. Harjai KJ: Potential new cardiovascular risk factors: left ven- 26. Napoli C, Glass CK, Witztum JL, Deutsch R, D'Armiento FP, Palinski
tricular hypertrophy, homocysteine, lipoprotein(a), triglyc- W: Influence of maternal hypercholesterolaemia during
erides, oxidative stress, and fibrinogen. Ann Intern Med 1999, pregnancy on progression of early atherosclerotic lesions in
131(5):376-86. childhood: Fate of Early Lesions in Children (FELIC) study.
5. Dalmau SJ, Ferrer LB, Modesto AV, Guillen DM, Vazquez GR, Corella Lancet 1999, 354(9186):1234-41.
PD, et al.: Concentración plasmática de homocisteína: rel- 27. Tuzcu EM, Kapadia SR, Tutar E, Ziada KM, Hobbs RE, McCarthy PM,
ación con los niveles plasmáticos de ácido fólico y con el poli- et al.: High prevalence of coronary atherosclerosis in asymp-
morfismo 677C-->T de la 5,10-metilenotetrahidrofolato tomatic teenagers and young adults: evidence from intravas-
reductasa. An Esp Pediatr 2002, 56(5):409-15. cular ultrasound. Circulation 2001, 103(22):2705-10.
6. Fowler B: Disorders of homocysteine metabolism. J Inherit 28. Berenson GS, Srinivasan SR, Hunter SM, Nicklas TA, Freedman DS,
Metab Dis 1997, 20(2):270-85. Shear CL, et al.: Risk factors in early life as predictors of adult
7. Saw SM, Yuan JM, Ong CN, Arakawa K, Lee HP, Coetzee GA, et al.: heart disease: the Bogalusa Heart Study. Am J Med Sci 1989,
Genetic, dietary, and other lifestyle determinants of plasma 298(3):141-51.
homocysteine concentrations in middle-aged and older Chi- 29. de Laet C, Wautrecht JC, Brasseur D, Dramaix M, Boeynaems JM,
nese men and women in Singapore. Am J Clin Nutr 2001, Decuyper J, et al.: Plasma homocysteine concentration in a Bel-
73(2):232-9. gian school-age population. Am J Clin Nutr 1999, 69(5):968-72.
8. Ueland PM: Homocysteine species as components of plasma 30. Ficha técnica Homocysteine IMx HOMOCYSTEINE 3D39-
redox thiol status. Clin Chem 1995, 41(3):340-2. 20 B3D393 68-3528/R4. © 1998, 2002 Abbott/Printed in Ger-
9. Delvin EE, Rozen R, Merouani A, Genest J Jr, Lambert M: Influence many/IMx Homocysteine September 2002. ABBOTT Diagnostics
of methylenetetrahydrofolate reductase genotype, age, vita- Division 2002.
min B-12, and folate status on plasma homocysteine in chil- 31. Ficha Técnica Vitamin B12 Sistemas Elecsys® 2010/MODU-
dren. Am J Clin Nutr 2000, 72(6):1469-73. LAR ANALYTICS E170. 11820753. 2002-08 - 1926306001 07
10. de Bree A, Verschuren WM, Bjorke-Monsen AL, Put NM van der, 05. Roche Diagnostics GmbH, D-68298 Mannheim 2002.
Heil SG, Trijbels FJ, et al.: Effect of the methylenetetrahydro- 32. Ficha Técnica Folate Elecsys® Sistemas 2010/MODULAR
folate reductase 677C-->T mutation on the relations among ANALYTICS E170. 11820761. -2001-07 - 1925369001 07 05.
folate intake and plasma folate and homocysteine concen- Roche Diagnostics GmbH, D-68298 Mannheim 2001.
trations in a general population sample. Am J Clin Nutr 2003, 33. Souto JC, Blanco-Vaca F, Soria JM, Buil A, Almasy L, Ordonez-Llanos
77(3):687-93. J, et al.: A genomewide exploration suggests a new candidate
11. Hankey GJ, Eikelboom JW: Homocysteine and vascular disease. gene at chromosome 11q23 as the major determinant of
Lancet 1999, 354(9176):407-13. plasma homocysteine levels: results from the GAIT project.
12. Ueland PM, Refsum H: Plasma homocysteine, a risk factor for Am J Hum Genet 2005, 76(6):925-33.
vascular disease: plasma levels in health, disease, and drug 34. Fakhrzadeh H, Ghotbi S, Pourebrahim R, Nouri M, Heshmat R,
therapy. J Lab Clin Med 1989, 114(5):473-501. Bandarian F, et al.: Total plasma homocysteine, folate, and vita-
13. Bostom AG, Selhub J: Homocysteine and arteriosclerosis: sub- min B12 status in healthy Iranian adults: the Tehran homo-
clinical and clinical disease associations. Circulation 1999, cysteine survey (2003-2004)/a cross-sectional population
99(18):2361-3. based study. BMC Public Health 2006, 6:29.
14. Refsum H, Ueland PM, Nygard O, Vollset SE: Homocysteine and 35. Tanis BC, Blom HJ, Bloemenkamp DG, Bosch MA van den, Algra A,
cardiovascular disease. Annu Rev Med 1998, 49:31-62. van der GY, et al.: Folate, homocysteine levels, methylenetet-
15. Sepulveda-Sanchez JM, Matia-Frances R, Martinez-Salio A, Gonzalez- rahydrofolate reductase (MTHFR) 677C --> T variant, and
de la Aleja-Tejera , Rodriguez-Pena MM, Porta-Etessam J: [Homo- the risk of myocardial infarction in young women: effect of
cysteine and cerebrovascular disease]. Rev Neurol 2004,
38(4):347-58.

Page 8 of 9
(page number not for citation purposes)
Nutrition & Metabolism 2009, 6:39 http://www.nutritionandmetabolism.com/content/6/1/39

female hormones on homocysteine levels. J Thromb Haemost ase-2 in cultured rat vascular smooth muscle cells. Circ J 2006,
2004, 2(1):35-41. 70(1):141-6.
36. Guillen M, Corella D, Portoles O, Gonzalez JI, Mulet F, Saiz C: Prev- 54. Fowler B: [Homocystein--an independent risk factor for car-
alence of the methylenetetrahydrofolate reductase 677C > T diovascular and thrombotic diseases]. Ther Umsch 2005,
mutation in the Mediterranean Spanish population. Associa- 62(9):641-6.
tion with cardiovascular risk factors. Eur J Epidemiol 2001,
17(3):255-61.
37. Hiraoka M: Folate intake, serum folate, serum total homo-
cysteine levels and methylenetetrahydrofolate reductase
C677T polymorphism in young Japanese women. J Nutr Sci
Vitaminol (Tokyo) 2004, 50(4):238-45.
38. Tonstad S, Refsum H, Sivertsen M, Christophersen B, Ose L, Ueland
PM: Relation of total homocysteine and lipid levels in children
to premature cardiovascular death in male relatives. Pediatr
Res 1996, 40(1):47-52.
39. Ganji V, Kafai MR: Population references for plasma total
homocysteine concentrations for U.S. children and adoles-
cents in the post-folic acid fortification era. J Nutr 2005,
135(9):2253-6.
40. Papoutsakis C, Yiannakouris N, Manios Y, Papaconstantinou E, Mag-
kos F, Schulpis KH, et al.: Plasma homocysteine concentrations
in Greek children are influenced by an interaction between
the methylenetetrahydrofolate reductase C677T genotype
and folate status. J Nutr 2005, 135(3):383-8.
41. Osganian SK, Stampfer MJ, Spiegelman D, Rimm E, Cutler JA, Feldman
HA, et al.: Distribution of and factors associated with serum
homocysteine levels in children: Child and Adolescent Trial
for Cardiovascular Health. JAMA 1999, 281(13):1189-96.
42. Armada E, Perez MC, Otero A, Gayoso P, Rodriguez M, Esteban MJ:
[Effect of folic acid supplementation on total homocysteine
levels in hemodialysis patients]. Nefrologia 2001, 21(2):167-73.
43. Casanueva V, Cid X, Cancino M, Borzone L, Cid L: [Serum homo-
cysteine in children and adolescents. Relation with family
history of cardiovascular disease]. Rev Med Chil 2003,
131(9):997-1002.
44. Villar-Fidalgo M, del Rey-Sanchez JM, Boix-Martinez R, Maties-Prats
M, Medrano-Albero MJ, Moro-Serrano C: [Prevalence of hyper-
homocysteinemia and associated factors in primary health
care]. Med Clin (Barc) 2005, 125(13):487-92.
45. Chang JB, Chu NF, Shen MH, Wu DM, Liang YH, Shieh SM: Deter-
minants and distributions of plasma total homocysteine con-
centrations among school children in Taiwan. Eur J Epidemiol
2003, 18(1):33-8.
46. Lewis SJ, Ebrahim S, Davey SG: Meta-analysis of MTHFR 677C-
>T polymorphism and coronary heart disease: does totality
of evidence support causal role for homocysteine and pre-
ventive potential of folate? BMJ 2005, 331(7524):1053.
47. Tonstad S, Refsum H, Ose L, Ueland PM: The C677T mutation in
the methylenetetrahydrofolate reductase gene predisposes
to hyperhomocysteinemia in children with familial hyperc-
holesterolemia treated with cholestyramine. J Pediatr 1998,
132(2):365-8.
48. Guo H, Lee JD, Ueda T, Cheng J, Shan J, Wang J: Hyperhomocystei-
naemia & folic acid supplementation in patients with high
risk of coronary artery disease. Indian J Med Res 2004,
119(1):33-7.
49. Bergen C, Compher C: Total homocysteine concentration and
associated cardiovascular and renal implications in adults. J
Cardiovasc Nurs 2006, 21(1):40-6.
50. Pfeiffer CM, Caudill SP, Gunter EW, Osterloh J, Sampson EJ: Bio-
chemical indicators of B vitamin status in the US population Publish with Bio Med Central and every
after folic acid fortification: results from the National Health
and Nutrition Examination Survey 1999-2000. Am J Clin Nutr scientist can read your work free of charge
2005, 82(2):442-50. "BioMed Central will be the most significant development for
51. Jacques PF, Selhub J, Bostom AG, Wilson PW, Rosenberg IH: The disseminating the results of biomedical researc h in our lifetime."
effect of folic acid fortification on plasma folate and total
homocysteine concentrations. N Engl J Med 1999, Sir Paul Nurse, Cancer Research UK
340(19):1449-54. Your research papers will be:
52. Guo H, Chi J, Xing Y, Wang P: Influence of folic acid on plasma
homocysteine levels & arterial endothelial function in available free of charge to the entire biomedical community
patients with unstable angina. Indian J Med Res 2009, peer reviewed and published immediately upon acceptance
129(3):279-84.
53. Guo H, Lee JD, Uzui H, Yue H, Wang J, Toyoda K, Geshi T, Ueda T: cited in PubMed and archived on PubMed Central
Effects of folic acid and magnesium on the production of yours — you keep the copyright
homocysteine-induced extracellular matrix metalloprotein-
Submit your manuscript here: BioMedcentral
http://www.biomedcentral.com/info/publishing_adv.asp

Page 9 of 9
(page number not for citation purposes)