Genetic Codon: 3 Nucleotides
Genetic Codon: 3 Nucleotides
Genetic Codon: 3 Nucleotides
1. Specific
• Explain: A specific sequence of 3 nucluetides
(codons) could code for one AA.
Features of the genetic code
2. Universal
• Explain: No matter in what organism the
mRNA is being translated, it will express the
same aa
Features of the genetic code
3. Redundant/degenerate
• Explain: More than one triplet can code for
the same aa
UCGGUACAGAAUCCAACAGAAUCCGGUACA
Codon 1 Codon 2 Codon 3
UCGGUACAGAAUCCAACAGAAUCCGGUACA
Codon 1 Codon 2 Codon 3