See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/267524303

Pseudococcus meridionalis, a new species of mealybug found on grapes:

biology, morphological and molecular characterization

Conference Paper · November 2013

CITATIONS READS
0 229

3 authors, including:

Tania Zaviezo Alda Romero

Pontifical Catholic University of Chile Pontifical Catholic University of Chile
77 PUBLICATIONS   867 CITATIONS    8 PUBLICATIONS   14 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Mealybug biology and use of pheromones for its management View project

Estimation and analysis of the invasion of Harmonia axyridis in Chile at regional scale: spatial interactions with endemic and native coccinellids View project

All content following this page was uploaded by Alda Romero on 07 August 2015.

The user has requested enhancement of the downloaded file.

Bulletin of Entomological Research, Page 1 of 7 doi:10.1017/S0007485312000053
© Cambridge University Press 2012

Molecular and morphological

characterization of mealybugs (Hemiptera:
Pseudococcidae) from Chilean vineyards
M.C.G. Correa1*, J-F. Germain2, T. Malausa3 and T. Zaviezo1
1
Facultad de Agronomía e Ingeniería Forestal, Pontificia Universidad
Católica de Chile, Casilla 306-22, Santiago, Chile: 2ANSES, Laboratoire de la
Santé des Végétaux, Campus International de Baillarguet,
Montferrier-sur-Lez, France: 3Institut National de la Recherche
Agronomique, UMR ISA INRA/UNSA/CNRS, Equipe BPI 400,
route des Chappes, BP 167, 06903 Sophia-Antipolis, France

Abstract

Mealybugs are major pests of grapevines worldwide. They cause economic losses
by lowering the cosmetic value of fruits, reducing yields, transmitting viruses and
resulting in the quarantine or rejection of produce in international trade. Knowledge
of the species present in a vineyard is important for the adjustment of management
strategies. We surveyed and accurately characterized the mealybugs infesting
vineyards in one of the main production areas of Chile; 164 mealybugs were sampled
from 26 vineyards in four regions of Chile and identified by DNA sequencing for two
markers (cytochrome oxidase I and internal transcribed spacer 2) and morphological
examination. Pseudococcus viburni (Signoret) was the most common species, followed
by Pseudococcus meridionalis Prado and Pseudococcus cribata González. Molecular
variability at the COI and ITS2 loci was observed in both P. viburni and P. cribata. A
comparison of haplotypes of P. viburni worldwide provides support for a recent
hypothesis that this species is native to South America, a finding with direct
consequences for management. Neither Pseudococcus longispinus (Targioni &
Tozzetti) nor Planococcus ficus Signoret were found.

Keywords: molecular identification, DNA sequencing, DNA barcoding, CO1,

Pseudococcus, Hemiptera

(Accepted 16 January 2012)

Introduction problem confronting international sales of Chilean table

grapes, because their presence in the produce requires
Grape is one of the most economically important crops in
quarantine restrictions in many markets (SAG, 2009–2010).
Chile, with vineyards covering over 180,000 hectares in 2007,
For example, during the 2008–2009 season, mealybugs were
and about a third of production dedicated to table grapes
responsible for 71.5% of all table grape rejections during
(ODEPA, 2010). This crop is the principal fruit exported from
inspections before export (SAG, 2009–2010). In addition,
Chile, accounting for about 42% of all fruit exports. Mealybugs
mealybugs may damage the vines directly and indirectly.
(Hemiptera: Pseudococcidae) are the main phytosanitary
Large populations may lower the vigor of the plant by
feeding on phloem and may affect fruit quality by depositing
honeydew on the fruit, on which sooty mold subsequently
*Author for correspondence develops (Artigas, 1994; Geiger & Daane, 2001; Bentley et al.,
Fax: + 56-2-5534130 2008; Daane et al., 2008a). Mealybugs also can cause long-
E-mail: [email protected] term damage by transmitting viruses (Golino et al., 1999;
2 M.C.G. Correa et al.

Millar et al., 2002; Douglas & Krüger, 2008). The principal, Materials and methods
recurrent problem in the management of mealybugs is
Sample collection
the cryptic ecology of these species. They are small, feed in
concealed areas and can be transported on plant material, We sampled mealybugs from 26 Chilean vineyards during
workers and machinery, making them particularly successful the 2009–2010 and 2010–2011 seasons (table 1 and fig. 1). In
invaders (Miller et al., 2005). Mealybug biology, damage, each vineyard, we examined a large number of grapevine
current control techniques and the main pest species around individuals, checking all parts of the plants, and collecting
the world have recently been reviewed (Daane et al., in press). mealybugs at different stages of development, to ensure that
Mealybugs constitute a very diverse group, with 2291 we did not miss species with different phenological features
species belonging to 274 genera described worldwide and habitat preferences. Adult females and nymphs were
(Ben-Dov et al., 2010). The species are hard to tell apart stored at –20°C in 95% ethanol until laboratory analysis.
because they are very similar morphologically and their
taxonomic identification is based on keys dealing with
DNA extraction and PCR amplification
various cuticular structures on adult females, viewed on
slide-mounted specimens under a microscope. Furthermore, Genomic DNA was extracted with the DNeasy Tissue
in some species, there may exist phenotypic variations Kit (QIAGEN, Hilden, Germany), with the non-destructive
between individuals, depending on the climatic conditions protocol described by Malausa et al. (2011), to ensure that
or the substrate on which they are growing. This can make the specimen remained available for morphological exami-
identification impossible without considerable expertise nation. Polymerase chain reaction (PCR) was performed
(Cox, 1983; Gullan & Kosztarab, 1997; Charles et al., 2000; with the reagents and concentrations used by Malausa
Millar, 2002; Zaviezo et al., 2010). These problems have led et al. (2011). The primers used for COI were COI-J-2183-F
to the development and use of molecular tools for the correct CAACATTTATTTTGATTTTTTGG and COI-N-2568-R GCW-
identification of Pseudococcidae species (Beuning et al., 1999; ACWACRTAATAKGTATCATG from Gullan et al. (2003). For
Downie & Gullan, 2004; Rung et al., 2007; Demontis et al., 2007; ITS2, the primers were: ITS2-M-F CTCGTGACCAAA-
Cavalieri et al., 2008; Saccaggi et al., 2008; Hardy et al., 2008; GAGTCCTG and ITS2-M-R TGCTTAAGTTCAGCGGGTAG,
Malausa et al., 2011; Correa et al., 2011; Park et al., 2011). as described by Malausa et al. (2011).
Despite the difficulties involved in differentiating between PCR conditions were as follows: initial denaturation for
mealybug species, correct identification is essential when 30 s at 98°C, followed by 35 cycles of denaturation for 10 s at
dealing with species considered as pests. It is important to 98°C, annealing for 15 s at temperatures of 48–60°C, elongation
know which species are present in the field to optimize at 72°C for 15 s, and a final extension period for 5 min at 72°C.
the timing of insecticide applications, because different The quality of the PCR products was checked by electropho-
species living on the same host may have different bio- resis in 2% agarose gels.
logical characteristics (Geiger & Daane, 2001; Varela, 2006). PCR products were sent to Genoscreen (Lille, France) for
Furthermore, the natural enemies of mealybugs tend to bidirectional sequencing. Consensus sequences were gener-
specialize on particular species; identification of the mealy- ated and checked with Seqscape v2.7 (Applied Biosystems,
bugs present is, therefore, essential to the success of biological Foster City, CA, USA). Alignments were edited with Bioedit
control programs (Chong & Oetting, 2007; Daane et al., 2008b). 7.01 (Hall, 1999). Sequences differing from the consensus
In international trade, different markets identify different sequences were considered to belong to a different haplotype.
mealybug species as quarantine pests (Beuning et al., 1999; A median-joining haplotype network was built with the
González & Volosky, 2004; SAG, 2009–2010). software NETWORK (Bandelt et al., 1999) using our COI
The available data, based on morphological identification, sequences and those available in GenBank for P. viburni. The
suggest that Pseudococcus viburni (Signoret) is the most sequences were from Europe (GU134686, found at >20 sites all
abundant and widely distributed species in Chilean vineyards over France and JF714166 found at one site in Spain), Brazil
(Zaviezo, 2002; González & Volosky, 2004; Sazo et al., 2008; (GU134685, four sites from the region of Rio Grande do Sul),
Ripa & Luppichini, 2010; Daane et al., in press). Other species South Africa (FJ786966, number and location of sites un-
also have been reported sporadically: Pseudococcus longispinus known), USA (EU267207 and EU267206, number and location
(Targioni & Tozzetti) and other new Pseudococcus species of sites unknown) and Iran (JF905460, number and location of
(Correa et al., 2011; González, 2011). In addition, it has been sites unknown). The alignment used can be consulted in fig. S1
suggested that Planococcus ficus Signoret may be present in in the supplementary material.
Chilean vineyards, but this remains a matter of debate
(González, 2011).
Morphological examination
Here, we took profit from the recent development of
molecular markers for mealybugs to characterize the taxa For each observed multilocus genotype (i.e. each combi-
infesting Chilean vineyards, by coupling DNA and morphol- nation of haplotypes for the two genetic markers), we
ogical analyses. We collected mealybugs from 26 vineyards morphologically examined at least one specimen (and up to
in the main grape-producing areas of central Chile, DNA 31). Specimens were prepared for slide-mounting as described
sequenced them at two loci (Cytochrome oxydase I and ITS2) by Malausa et al. (2011): (i) after making a small incision, they
and examined morphologically. As a secondary objective, we were heated in 10% KOH for 20 min; (ii) they remaining body
used the produced DNA data to test the hypothesis that contents were expelled, tapering the body with a micro
P. viburni is native to South America (Daane et al., 2008a; spatula; (iii) the specimens were stained by incubation for 1 h
Charles, 2010). Indeed, this hypothesis has implications for in a saturated solution of fuchsine in a 1:1:1 mixture of distilled
pest management (e.g. choice of biocontrol agents) and the water, lactic acid and glycerol; (iv) then, the specimens were
level of genetic diversity observed among individual DNA washed in glacial acetic acid for 1 h to stabilize the staining;
sequences is an indication of the native regions of taxa. (v) finally, the specimens were transferred to lavender oil for at
 Characterization of mealybugs from Chilean vineyards 3

Table 1. Mealybug populations sampled.

Pop. Region Site GPS Collection date

1 O’Higgins Chimbarongo 34°43′4.19″S/71°2′32.00″W 8/04/2010
2 O’Higgins Chimbarongo 34°43′39.76″S/71°2′17.56″W 8/04/2010
3 O’Higgins Chimbarongo 34°43′16.63″S/71°2′7.84″W 8/04/2010
4 O’Higgins Chimbarongo 34°44′2.12″S/71°2′25.18″W 8/04/2010
5 O’Higgins Chimbarongo 34°43′22.28″S/71°2′48.61″W 30/04/2010
6 O’Higgins Chépica 34°41′32.77″S/71°9′46.65″W 10/06/2010
7 O’Higgins Nancagua 34°36′24.74″S/71°7′32.64″W 9/04/2010
10 O’Higgins Santa Cruz 34°40′42.46″S/71°23′7.92″W 12/04/2010
11 O’Higgins Nancagua 34°40′54.34″S/71°12′52.75″W 6/04/2010
12 O’Higgins Nancagua 34°40′47.54″S/71°12′25.92″W 11/06/2010
13 O’Higgins Nancagua 34°40′51.50″S/71°13′43.91″W 6/04/2010
14 O’Higgins Nancagua 34°40′55.84″S/71°13′24.77″W 6/04/2010
19 O’Higgins Placilla 34°36′40.67″S/71°4′16.54″W 10/06/2010
22 O’Higgins Placilla 34°38′04.07″S/71°07′29.71″W 30/12/2010
23 O’Higgins Placilla 34°37′27.05″S/71°07′29.52″W 30/12/2010
24 O’Higgins Placilla 34°37′10.43″S/71°07′00.33″W 30/12/2010
20 O’Higgins Nancagua 34°41′5.59″S/71°14′22.69″W 30/04/2010
21 O’Higgins Nancagua 34°40′30.74″S/71°12′27.76″W 29/04/2010
25 Valparaíso Los Andes 32°50′46.67″S/70°38′47.91″W 16/02/2011
8 Valparaíso Casablanca 33°21′41.89″S/71°19′0.31″W 9/04/2010
9 Valparaíso Casablanca 33°21′5.76″S/71°20′53.45″W 9/04/2010
15 Maule Molina 35°3′46.79″S/71°19′10.84″W 18/04/2010
16 Maule Molina 35°4′18.54″S/71°18′47.55″W 18/04/2010
17 Metropolitana Buin 33°43′44.61″S/70°42′37.12″W 10/06/2010
18 Metropolitana Buin 33°44′8.20″S/70°42′41.46″W 10/06/2010
26 Metropolitana Pirque 33°40′26.48″S/70°35′12.09″W 20/03/2011

accession numbers JN983129-JN983139. Multilocus genotypes

#A–E consisted of sequences similar or very similar to
sequences already available for P. viburni (Malausa et al.,
2011; Beltrà et al., 2012). Multilocus genotype F consisted of
COI and ITS2 sequences absolutely identical to those in the
description of the species Pseudococcus meridionalis Prado:
JF780513 for COI and JF780514 for ITS2 (Correa et al., 2011).
Multilocus genotypes #G–L did not correspond to any
sequences deposited in international databases.
Considering that all the haplotypes were very similar to the
published sequences assigned to P. viburni, we found that the
most common and widely distributed were haplotype #1 for
COI and haplotype #1 for ITS2 (multilocus genotype #A). Only
multilocus genotype #A was found in the Valparaiso region,
whereas four other multilocus genotypes in addition to
Fig. 1. Location of sampling sites in Chile. multilocus genotype #A were observed in the O’Higgins
region (table 3).
least 1 h, placed in a drop of Canada balsam on a slide and The multilocus genotype corresponding to the recently
covered with a coverslip. described species P. meridionalis was found only in the
The slide was then labeled and observed immediately Metropolitana region, whereas multilocus genotypes #G–L,
under a microscope. Identification was based on the tax- which could not be assigned to any species on the basis of
onomic keys of Williams & Granara de Willink (1992), Gimpel molecular data, were found at three sampling sites in the
& Miller (1996) and Williams (2004). The voucher specimens O’Higgins region.
are deposited in the Laboratoire de la Santé des Végétaux, When we compared the Chilean COI haplotypes with
ANSES, Campus International de Baillarguet, Montferrier- other available haplotypes (fig. 2), the Chilean P. viburni
sur-Lez, France. haplotype #1 (H1) was also found in France, Spain and South
Africa, whereas Chilean haplotypes #2 and #3 (H2 and H3)
were present only in Chile. Several haplotypes absent from
Results Chile were found in other countries: Brazil, U.S and Iran, (H4,
H5 and H6, respectively, in fig. 2).
Molecular characterization
We obtained 164 individual sequences for each marker. Six
Morphological characterization
haplotypes were identified for COI, and seven for ITS2,
resulting in 12 multilocus genotypes (table 2). The sequences The molecular results were confirmed by the examination
obtained in this work are available from GenBank under of slide-mounted specimens. Multilocus genotypes #A–E were
4 M.C.G. Correa et al.

Table 2. Multilocus genotypes for the various species found: P. viburni (COI: 1–3; ITS2: 1, 2), P. meridionalis (COI: 4; ITS2: 3) and P. cribata
(COI: 5, 6; ITS2: 4–7), with the identification code of the slide-mounted specimens.

Multilocus COI ITS2 Slide-mounted specimen # Morphological

genotype haplotype haplotype identification
A COI-1 ITS2-1 1002270, 1002269, 1101177, 1002260, 1002259, P. viburni
JN983135 JN983131 1002268, 1002229, 1002228, 1002267, 1002266,
1002265, 1002227, 1002258, 1002264, 1002271,
1002263, 1002257, 1002262, 1002256, 1002261,
1002255, 1002230, 1002275, 1002274, 1002254,
1002253, 1002273, 1002272, 1101179, 1101181,
1101185
B COI-1 ITS2-2 1002252 P. viburni
JN983135 JN983133
C COI-2 ITS2-1 1002233, 1002234, 1101182 P. viburni
JN983136 JN983131
D COI-2 ITS-2 1002232, 1002231, 1101180, 1101183, 1101184 P. viburni
JN983136 JN983133
E COI-3 ITS2-1 1101178, 1002226 P. viburni
JN983137 JN983131
F COI-4 ITS2-3 1002243, 1002242, 1002241, 1002240, 1002239, P. meridionalis
JF780513 JF780514 1002238, 1002237, 1002236, 1002235
G COI-5 ITS2-4 1101187, 1101188, 1101197, 1101198 P. cribata
JN983138 JN983130
H COI-5 ITS2-5 1101190, 1101195 P. cribata
JN983138 JN983132
I COI-5 ITS2-6 1101186, 1101189, 1101191, 1101193, 1101194 P. cribata
JN983138 JN983134
J COI-5 ITS2-7 1101199 P. cribata
JN983138 JN983129
K COI-6 ITS2-5 1101196 P. cribata
JN983139 JN983132
L COI-6 ITS2-6 1101192 P. cribata
JN983139 JN983134

assigned to Pseudococcus viburni. All the character states useful cribata González. These specimens had the following features:
for the diagnosis of P. viburni (Gimpel & Miller, 1996) were a dorsal OR between cerarii 15 and 16; presence of 1 to 2 OR
present in the specimens of this species: oral-rim tubular ducts close to the frontal cerarii and cerarii 8 and 10, which were
(OR), usually absent in the submedial row from segment III– not very marked or absent; a mean of 38 OR on the abdomen.
VII; with a medial row and a lateral row of OR on each side, 13 On the venter, no discoid pores were found close to the eyes,
(10–18) OR on the dorsum of segments I–VIII; dorsal OR and multilocular pores were present around the vulva.
absent on the submargin between cerarii 15 and 16; 2 (1–3) The species most closely related to P. cribata, based on
discoid pores close to each eye; numerous translucent pores on morphologically characterization, is Pseudococcus calceolariae
hind tibia and femur; 10 (8–16) oral collar tubular ducts (OC) (Maskell). Pseudococcus cribata differed from P. calceolariae
in clusters on the mesad of cerarius 12 and 1 (0–2) OC by the slight or even absent cerarii 8 and 10; the presence of 1 to
associated with cerarii 10 and 11. 2 dorsal OR close to cerarius 17; the higher density of trilocular
Multilocus genotype #F corresponded to the morphologi- pores on anal cerarii than in P. calceolariae and the presence of
cal description of Pseudococcus meridionalis Prado. This species at least 10 OR between the anterior spiracle and cerarius 12.
has several features in common with P. viburni: dorsal OR
absent on the submargin between cerarii 15 and 16; 2 (1–3)
discoid pores close to each eye; 9 (7–13) OC in clusters on the Discussion
mesad of cerarius 12 and numerous translucent pores on hind Pseudococcus viburni was the most common mealybug
tibia and femur. However, this species was characterized by found in this survey of Chilean vineyards, consistent
three morphological characteristics not associated with any with previous reports based on morphological taxonomy
species of the ‘Pseudococcus maritimus complex’ (Gimpel & (Zaviezo, 2002; González, 2003a,b; Ripa & Luppichini, 2010).
Miller, 1996). The most obvious of these character states was The second species found was P. meridionalis Prado (Correa
the many OR on the abdomen, in transverse rows, with up et al., 2011). This species had also been called Pseudococcus sp.1
to 9 OR per row, and 38 (34–43) OR on dorsum segments (González, 2003a) and recently described as Pseudococcus
I–VIII. There were also 19 (13–23) OR on dorsal cephalo- rubigena González (González, 2011). Nevertheless, to our
thoracic segments, with a transverse row at the cerarius 12 knowledge, Pseudococcus meridionalis is the valid name for this
level. Finally, there were 9 (6–13) OC clustered between cerarii species. In our study, P. meridionalis was much less frequent
10 and 11. than P. viburni, but nonetheless with high densities in a few
The specimens displaying multilocus genotypes #G–L vineyards of the Metropolitana region, confirming its status as
(which did not contain previously documented DNA a pest of grapes. The third species found would correspond
sequences) were morphologically similar to Pseudococcus morphologically to P. cribata (González, 2011), and the DNA
 Characterization of mealybugs from Chilean vineyards 5

Table 3. Geographic distribution and abundance of multilocus genotypes for the different species found: P. viburni (1–5), P. meridionalis (6)
and P. cribata (7–12).

Population Multilocus genotype no.

N° Region 1 2 3 4 5 6 7 8 9 10 11 12
1 O’Higgins 4 1
2 O’Higgins 5
3 O’Higgins 5
4 O’Higgins 4
5 O’Higgins 5
6 O’Higgins 9 1
7 O’Higgins 10
10 O’Higgins 8 1
11 O’Higgins 3 1
12 O’Higgins 5
13 O’Higgins 4
14 O’Higgins 5
19 O’Higgins 10
20 O’Higgins 5
21 O’Higgins 3 4 5
22 O’Higgins 2 2 3 1
23 O’Higgins 1 4
24 O’Higgins 2 1 1 1 1
25 Valparaíso 6
8 Valparaíso 10
9 Valparaíso 9
15 Maule 4
16 Maule 4
17 Metropolitana 5
18 Metropolitana 4
26 Metropolitana 4

Pseudococcus longispinus has previously been collected in

grapes in Chile, where it is known to be commonly associated
with grapes (González & Volosky, 2004; Ripa & Luppichini,
2010; González, 2011). Therefore, the absence of P. longispinus
from our two-year-long survey suggests that this species is not
common on grapes in the regions sampled.
One remarkable result in this survey was the haplotype
diversity and distribution for COI and ITS2 in P. viburni and
P. cribata. Three COI haplotypes and two ITS2 haplotypes
were found by us for P. viburni in Chile, and a different
haplotype had been previously found in Brazil (Malausa et al.,
2011). This contrasts with the situation found for P. viburni in
Europe, where, despite the large number of populations
Fig. 2. Median-Joining COI haplotype network for P. viburni. sampled and the diversity of hosts sampled, only one
Numbers indicate the location of the mutation within the haplotype has been found (Malausa et al., 2011; Beltrà et al.,
sequence. For more details of the alignment, refer to fig. S1 in 2012). The European haplotype corresponds to the most
the supplementary material ( , Spain; , Chile; , South Africa; , common haplotype found in Chile. Also, one haplotype with
France; , Brazil; , California, USA; , Iran).
high divergence from the Chilean ones has been found for
P. viburni in California (Genbank accession EU267206), which
sequences obtained did not match any sequence already may correspond to another strain or sibling species, or
present in an international database or publication. However, sequence ambiguities. These findings support the hypothesis
this taxon, characterized by two haplotypes at COI and four at of a neotropical origin of P. viburni (Daane et al., 2008a;
ITS2, was found at three sites in the O’Higgins region and may Charles, 2010) because the level of genetic diversity seems to
be, therefore, also considered a pest of grapes. On the other be higher in this biogeographic region than elsewhere.
hand, P. longispinus and Pl. ficus were not found at the sites However, a more thorough sampling should be carried out
studied, although they have been mentioned as grape pests in other regions of the world in order to better support this
in Chile (González & Volosky, 2004). The rarity of Pl. ficus in hypothesis.
Chilean vineyards remains surprising, given that most grape- For P. cribata, which was collected only in a few close sites
producing regions of the world, including France, the United (populations 22, 23 and 24), the samples displayed consider-
States, South Africa, Argentina and Uruguay (Daane et al., in able DNA variation (two COI haplotypes and four
press), are infested with this species. Indeed, the occurrence of ITS2 haplotypes). This suggests that this species may also be
Pl. ficus in Chile is a matter of debate (González, 2011). neotropical in origin, or at least is not a recent invader,
6 M.C.G. Correa et al.

although this conclusion remains speculative. On the other Available online at: http://www.ipm.ucdavis.edu/PMG/
hand, for P. meridionalis, only one haplotype was found at selectnewpest.grapes.html (accessed 20 September 2011).
each marker. In previous similar studies (Malausa et al., 2011; Beuning, L.L., Murphy, P., Wu, E., Batchelor, T.A. &
Abd-Rabou et al., 2012; Beltrà et al., 2012), a clear difference Morris, B.A.M. (1999) Molecular-based approach to the
was found between native species, which had several differentiation of mealybug (Hemiptera: Pseudococcidae)
haplotypes for the COI and ITS2 loci, and recent invaders, species. Journal of Economic Entomology 92, 463–472.
which systematically presented a single haplotype for each Cavalieri, V., Mazzeo, G., Garzia, G.T., Buonocore, E. &
marker. If this pattern holds true in Chile, then P. meridionalis is Russo, A. (2008) Identification of Planococcus ficus and
probably not native to this country, because no variation at Planococcus citri (Hemiptera: Pseudococcidae) by PCR-RFLP
either of the loci was found in this species, despite repeated of COI gene. Zootaxa 1816, 65–68.
sampling from different host plants (Correa et al., 2011; this Charles, J. (2010) Using parasitoids to infer a native range for the
study). If confirmed, these patterns may be of use in the obscure mealybug, Pseudococcus viburni, in South America.
development of biological control strategies, because the BioControl 56, 155–161.
native region of a species is generally considered the most Charles, J., Froud, K. & Henderson, R. (2000) Morphological
suitable place to look for natural enemies (Moore, 1988). variation and mating compatibility within the mealybugs
This survey identified P. viburni, P. meridionalis and Pseudococcus calceolariae and P. similans (Hemiptera: Pseudo-
P. cribata as pests of grape in Chile’s main grape production coccidae) and a new synonymy. Systematic Entomology 25,
area. The genetic variability of P. viburni and P. cribata, at the 285–294.
two molecular markers used, suggest that they are either Chong, J.-H. & Oetting, R.D. (2007) Specificity of Anagyrus sp. nov.
native or long-established in this biogeographic region. In nr. sinope and Leptomastix dactylopii for six mealybug species.
contrast, no genetic variability was found in P. meridionalis, BioControl 52, 289–308.
suggesting that this species may have been introduced Correa, M., Aguirre, C., Germain, J.-F., Hinrichsen, P.,
recently into Chile. Zaviezo, T., Malausa, T. & Prado, E. (2011) A new species of
Pseudococcus (Hemiptera: Pseudococcidae) belonging to the
‘Pseudococcus maritimus’ complex from Chile: molecular and
Acknowledgements
morphological description. Zootaxa 2926, 46–54.
We thank all the grape producers who allowed us access Cox, J. (1983) An experimental study of morphological variation
to their properties and the INRA ‘BPI’ team for their warm in mealybugs (Homoptera: Coccoidea: Pseudococcidae).
welcome and for providing access to their laboratories. Systematic Entomology 8, 361–382.
This work was funded by the following grants: a CONICYT Daane, K.M., Cooper, M.L., Triapitsyn, S.V., Andrews, J.W. Jr &
Doctoral Fellowship #21110864, CONICYT #78092002, Ripa, R. (2008a) Parasitoids of obscure mealybug,
MECESUP UC0707, FONDECYT #1080464, EU FP7-IRSES Pseudococcus viburni (Signoret) (Hem.: Pseudococcidae) in
#269196 ‘Iprabio’ and EU FP7-KBBE ‘PURE’. California vineyards: establishment of Pseudaphycus flavidu-
lus (Brèthes) (Hym.: Encyrtidae) and discussion of reared
parasitoid species. BioControl Science and Technology 18,
Supplementary material
43–57.
The online figure can be viewed at http://journals. Daane, K.M., Cooper, M.L., Triapitsyn, S.V., Walton, V.M.,
cambridge.org/ber. Yokota, G.Y., Haviland, D.R., Bentley, W.J.,
Godfrey, K.E. & Wunderlich, L.R. (2008b) Vineyard
managers and researchers seek sustainable solutions for
References
mealybugs, a changing pest complex. California Agriculture
Abd-Rabou, S., Shalaby, H., Germain, J.-F., Ris, N., Kreiter, P. & 62, 167–176.
Malausa, T. (2012) Identification of mealybug pest species Daane, K.M., Almeida, R.P.P., Bell, V.A., Botton, M.,
(Hemiptera: Pseudococcidae) in Egypt and France, using a Fallahzadeh, M., Mani, M., Miano, J.L., Sforza, R.,
DNA barcoding approach. Bulletin of Entomological Research Walton, V.M. & Zaviezo, T. Biology and Management of
102, this issue: doi: 10.1017/S0007485312000041. Mealybugs in Vineyards. in Bostanian, N.J., Isaacs, R. &
Artigas, J.N. (1994) Entomología económica, Insectos de interés Vincent, C. (Eds) Arthropod Management in Vineyards.
agrícola, forestal, medico y veterinario, vol. I. Concepción, Chile, Dordrecht, The Netherlands, Springer, in press.
Ediciones Universidad de Concepción. Demontis, M.A., Ortu, S., Cocco, A., Lentini, A. & Migheli, Q.
Bandelt, H.-J., Forster, P. & Röhl, A. (1999) Median-joining (2007) Diagnostic markers for Planococcus ficus (Signoret)
networks for inferring intraspecific phylogenies. Molecular and Planococcus citri (Risso) by random amplification of
Biology and Evolution 16, 37–48. polymorphic DNA-polymerase chain reaction and species-
Beltrà, A., Soto, A. & Malausa, T. (2012) Molecular and mor- specific mitochondrial DNA primers. Journal of Applied
phological characterisation of Pseudococcidae surveyed on Entomology 131, 59–64.
crops and ornamental plants in Spain. Bulletin of Douglas, N. & Krüger, K. (2008) Transmission efficiency
Entomological Research 102, doi: 10.1017/S0007485311000514. of grapevine leafroll-associated virus 3 (glrav-3) by the
Ben-Dov, Y., Miller, D.R. & Gibson, G.A.P. (2010) ScaleNet, mealybugs Planococcus ficus and Pseudococcus longispinus
Scales in a Family/Genus Query Results. Available on- (Hemiptera: Pseudococcidae). European Journal of Plant
line at http://www.sel.barc.usda.gov/scalecgi/chklist.exe? Pathology 122, 207–212.
Family=Pseudococcidae&genus (accessed 31 August 2011). Downie, D.A. & Gullan, P.J. (2004) Phylogenetic analysis
Bentley, W.J., Varela, L.G., Zalom, F.G., Smith, R.J., of mealybugs (Hemiptera: Coccoidea: Pseudococcidae)
Purcell, A.H., Phillips, P.A., Haviland, D.R., Daane, K.M. & based on DNA sequences from three nuclear genes, and a
Battany, M.C. (2008) Insects and Mites. UC IPM Pest review of the higher classification. Systematic Entomology 29,
Management Guidelines: Grape. UC ANR publication 3448. 238–259.
 Characterization of mealybugs from Chilean vineyards 7

Geiger, C.A. & Daane, K.M. (2001) Seasonal movement and (Homoptera: Pseudococcidae) in California vineyards.
distribution of the grape mealybug (Homoptera: Journal of Economic Entomology 4, 706–714.
Pseudococcidae): developing a sampling program for San Miller, D.R., Miller, G.L., Hodges, G.S. & Davidson, J.A. (2005)
Joaquin Valley vineyards. Journal of Economic Entomology 94, Introduced scale insects (Hemiptera: Coccoidea) of the
291–301. United States and their impact on US agriculture. Proceedings
Gimpel, W.F. & Miller, D.R. (1996) Systematic analysis of the of the Entomological Society of Washington 107, 123–158.
mealybugs in the Pseudococcus maritimus complex Moore, D. (1988) Agents used for biological control of mealybugs
(Homoptera: Pseudococcidae). Contributions on Entomology (Pseudococcidae). Biocontrol News and Information 9, 209–225.
International 2, 1–163. ODEPA (2010) Oficina de estudios y estadísticas Agropecuarias,
Golino, D.A., Sim, S., Rill, R. & Rowhani, A. (1999) Four species Gobierno de Chile, Santiago, Chile. Available online at
of California mealybugs can transmit leafroll disease. http://www.odepa.gob.cl (accessed 20 July 2010).
American Journal of Enology and Viticulture 50, 367–368. Park, D.S., Suh, S.J., Hebert, P.D.N., Oh, H.W. & Hong, K.J.
González, R.H. (2003a) Chanchitos blancos de importancia (2011) DNA barcodes for two scale insect families, mealy-
agrícola y cuarentenaria, en huertos frutales de Chile bugs (Hemiptera: Pseudococcidae) and armored scales
(Hemiptera: Pseudococcidae). Revista Frutícola (Chile) 24, (Hemiptera: Diaspididae). Bulletin of Entomological Research
5–17. 101, 429–434.
González, R.H. (2003b) Manejo cuarentenario de chanchitos Ripa, S.R. & Luppichini, P. (2010) Manejo de Plagas de la Vid.
blancos de pomáceas en Chile (Hemiptera: Pseudococcidae). Colección Libros INIA N° 26. Instituto de Investigaciones
Revista Frutícola (Chile) 24, 89–98. Agropecuarias (Chile). INIA. La Cruz, Chile.
González, R.H. (2011) Pseudocóccidos de importancia Frutícola Rung, A., Scheffer, S.J., Evans, G. & Miller, D. (2007) Molecular
en Chile. Publicaciones en Ciencias Agrícolas N° 18. identification of two closely related species of mealybugs of
Ediciones Universidad de Chile. the genus Planococcus (Homoptera: Pseudococcidae). Annals
González, R.H. & Volosky, C.F. (2004) Chanchitos of the Entomological Society of America 3, 525–532.
blancos y polillas de la fruta: Problemas cuarentenarios Saccaggi, D.L., Krüger, K. & Pietersen, G. (2008) A multiplex
de la fruticultura de exportación. Revista Frutícola (Chile) 25, PCR assay for the simultaneous identification of three
41–62. mealybug species (Hemiptera: Pseudococcidae). Bulletin of
Gullan, P. & Kosztarab, M. (1997) Adaptations in scale insects. Entomological Research 98, 27–33.
Annual Review of Entomology 42, 23–50. SAG (Servicio Agrícola y Ganadero - Chile) (2009–2010)
Gullan, P.J., Downie, D.A. & Steffan, S.A. (2003) A new pest Exportaciones Agrícolas. Available online at http://www.
species of the mealybug genus Ferrisia fullaway (Hemiptera: sag.cl (accessed 20 September 2011).
Pseudococcidae) from the United States. Annals of the Sazo, L., Araya, J. & de la Cerda, J. (2008) Effect of a siliconate
Entomological Society of America 96, 723–737. coadjuvant and insecticides in the control of mealybug of
Hall, T.A. (1999) BioEdit: a user-friendly biological sequence grapevines, Pseudococcus viburni (Hemiptera: Pseudo-
alignment editor and analysis program for Windows 95/98/ coccidae). Ciencia e Investigacion Agraria 35, 215–222.
NT. Nucleic Acids Symposiums Series 41, 95–98. Varela, L. (2006) Which mealybug is it? Why should you
Hardy, N.B., Gullan, P.J. & Hodgson, C.J. (2008) A subfamily- care? Practical Winery and Vineyard. January–February 2006,
level classification of mealybugs (Hemiptera: Pseudo- 1–6.
coccidae) based on integrated molecular and morphological Williams, D.J. (2004) Mealybugs of Southern Asia. London, UK, The
data. Systematic Entomology 33, 51–71. Natural History Museum & Kuala Lumpur, Malaysia,
Malausa, T., Fenis, A., Warot, S., Germain, J.-F., Ris, N., Prado, E., Southdene SDN, BHD.
Botton, M., Vanlerberghe-Masutti, F., Sforza, R., Williams, D.J. & Granara de Willink, M.C. (1992) Mealybugs of
Cruaud, C., Couloux, A. & Kreiter, P. (2011) DNA markers Central and South America. London, UK, CAB International.
to disentangle complexes of cryptic taxa in mealybugs Zaviezo, T. (2002) Manejo integrado del chanchito blanco en
(Hemiptera: Pseudococcidae). Journal of Applied Entomology viñedos. Tópicos de Actualización en Viticultura y Enología.
135, 142–155. Pontificia Universidad Católica de Chile, Departamento de
Millar, I.M. (2002) Mealybug genera (Hemiptera: Fruticultura y Enología y Centro del Vino, CEVIUC.
Pseudococcidae) of South Africa: identification and review. Santiago, Chile.
African Entomology 10, 185–233. Zaviezo, T., Cadena, E., Flores, M. F. & Bergmann, J. (2010)
Millar, J.G., Daane, K.M., McElfresh, J.S., Moreira, J.A., Influence of different plant substrates on development and
Malakar-Kuenen, R., Guillen, M. & Bentley, W.J. (2002) reproduction for laboratory rearing of Pseudococcus calceo-
Development and optimization of methods for using sex lariae (Maskell) (Hemiptera: Pseudococcidae). Ciencia e
pheromone for monitoring the mealybug Planococcus ficus Investigación Agraria 37, 31–37.

View publication stats