Scribd Logo
Upload

Welcome to Scribd!

  • 37 views

    07 10 2021 Bio Assignment

    Uploaded by

    Suneel Reddy
    This document discusses characteristics of nucleic acids including types of cellular RNA, their sizes, and functions. It lists the main types of RNA as messenger RNA, transfer RNA, ribosomal RNA, and small nuclear RNA. The document also includes tasks about DNA structure, replication, Chargaff's rules on base pairing ratios, and the differences between DNA and RNA.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd

    07 10 2021 Bio Assignment

    Uploaded by

    Suneel Reddy
    37 views4 pages
    This document discusses characteristics of nucleic acids including types of cellular RNA, their sizes, and functions. It lists the main types of RNA as messenger RNA, transfer RNA, ribosomal RNA, and small nuclear RNA. The document also includes tasks about DNA structure, replication, Chargaff's rules on base pairing ratios, and the differences between DNA and RNA.

    Copyright

    © © All Rights Reserved

    Available Formats

    DOCX, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    This document discusses characteristics of nucleic acids including types of cellular RNA, their sizes, and functions. It lists the main types of RNA as messenger RNA, transfer RNA, ribosomal RNA, and small nuclear RNA. The document also includes tasks about DNA structure, replication, Chargaff's rules on base pairing ratios, and the differences between DNA and RNA.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Download as docx, pdf, or txt
    37 views4 pages

    07 10 2021 Bio Assignment

    Uploaded by

    Suneel Reddy
    This document discusses characteristics of nucleic acids including types of cellular RNA, their sizes, and functions. It lists the main types of RNA as messenger RNA, transfer RNA, ribosomal RNA, and small nuclear RNA. The document also includes tasks about DNA structure, replication, Chargaff's rules on base pairing ratios, and the differences between DNA and RNA.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Download as docx, pdf, or txt
    of 4

    Dat e Theme 3: Characteristics of nucleic acids Types of Size Function

    cellular
    RNA
    Messenger RNA 300-3000 messenger RNA (mRNA) carries the protein
    blueprint from a cell's DNA to its ribosomes,
    Task 1. Study the structure of DNA (m-RNA) nucleotides which are the "machines" that drive protein
    synthesis. Transfer RNA (tRNA) then carries the
    appropriate amino acids into the ribosome for
    inclusion in the new protein.
    Transfer RNA 75-95 Transfer ribonucleic acid (tRNA) helps decode a
    messenger RNA (mRNA) sequence into a
    (t-RNA) nucleotides protein. tRNAs function at specific sites in the
    ribosome during translation, which is a process that
    synthesizes a protein from an mRNA molecule.
    Ribosomal RNA 3000-5000 Ribosomal RNA (rRNA) associates with a set of
    proteins to form ribosomes., catalyze the assembly
    (r-RNA) nucleotides of amino acids into protein chains. They also bind
    tRNAs and various accessory molecules necessary
    for protein synthesis.
    90-220  play important roles in splicing of introns from
    Small nuclear RNA primary genomic transcripts.
    nucleotides
    (snRNA)
    Task 3. Write down the types of RNA.
    mRNA,tRNA,snRNA,tmRNA,dsRNA

    1- Amino acid
    2- Ester bond
    Task 2. Complete the table below “Forms of DNA”.
    3- Intra molecular base pairing
    Characteristic A-DNA B-DNA Z-DNA 4- Anti codon
    Coiling right-handed right-handed  a left-handed 5-
    double helix double helix double helix
    Base pair per 11 10 12 Task 4. Give a definition of the terms
    turn
    “replication”, reparation”.
    Task 3. Write down the functions of different types of cellular RNA.
    Replication — molecule is copied to produce two identical
    molecules or strands
    Reparation — action of repairing

    Task 5. Study the scheme of DNA replication. Fill the table below

    Enzyme Function
    Topoisomerase Enzyme that cuts and rejoins DNA strands.
    Topoisomerase is essential during DNA
    replication.
    Helicase Enzyme that helps unwind the DNA double
    helix during replication.
    Destabilizing fundamental to the mechanisms of replication,
    proteins recombination and gene expression.
    RNA-primase RNA primase lays down an RNA primer to start
    DNA replication.

    RNA-primer Primer RNA is RNA that initiates DNA synthesis.


    Primers are required for DNA synthesis 
    DNA-polymerase  responsible for forming new copies of DNA, in
    the form of nucleic acid molecules. ... DNA
    polymerase is responsible for the process of DNA
    replication

    Okazaki fragment Allows replication of 5 to 3 strands


    DNA-ligase  facilitates the joining of DNA strands together
    by catalyzing the formation of a phosphodiester
    bond. DNA ligase is used in both DNA repair and
    DNA replication 

    Scheme of DNA replication


    3

    Task 6. Study Chargaff’s rules that reflect principle of complementary Task 8. Study a scheme that explains an algorithm of solving of the
    correspondence between nucleotides A and T, C and G.
    problems in molecular biology.
    Chargaff’s rules

    1) The ratio of A to T is 1 to 1 and of G to C is 1 to 1.


    2) Quantities of purine nitrogenous bases and pirimidine nitrogenous
    bases are equal.
    3) Wide variations exist in the (A+T)/(G+C) ratio.
    4) A + T + G + C = 100%

    Task 7. Complete the table Differences between DNA and RNA”.

    Features DNA RNA


    Strands Usually Double Usually one, rarely two
    Sugar Deoxyribose
     Adenine,  Adenine,
    Nitrogenous
     Guanine,  Guanine,
    bases
     Cytosine,  Cytosine,
     …………………  Uracil
    A=T A=U
    Pairing
    G C=G
    =C .
    Site in the Mostly in chromosomes, Mostly in Cytoplasm and
    some in mitochondria and ribosomes
    cell
    chloroplasts
    Reparation Yes Damaged DNA repaired No reparation once
    by repair pathways damaged
    Self replicating Needs cellular engymes
    Replication
    A-DNA,B-DNA,Z-DNA mRNA,tRNA,snRNA,tmRN
    Types A,dsRNA
    Task 9. Solve the problems. Problem 4. 1078 cytidylic nucleotides in DNA molecule are 22 % from
    the general amount of nucleotides. To define:
    Problem 1. Write the complementary of a daughter strand of DNA 1) How many adenylic, guanylic and thymidylic nucleotides are there
    replicated from the following parental base sequences: in this DNA fragment?
    5’
    T C G A C G A T T G A A T C T A C G G C A3’ 2) What is the length of this fragment in DNA molecule?
    3’AGTGCTAACTTAGATGCCGT’5………………………………… 3) What is the mass of this fragment in DNA molecule?
    …………………………….. 4) What is the mass of corresponding fragment in mRNA molecule?
    Calculate the percentage of thymine and guanine in the region of DNA 5) How many amino acids will be present in the polypeptide strand if
    molecule. 350 nucleotides in mRNA are introns?

    Solving:
    Thymine is 30%
    Guanine is 25% 1) G-1078,A-1372,T-1372
    2) 1470 nm
    3) 1.5925*10 power 6 Daltons
    Problem 2. Write the sequence of the m-RNA strand from the
    4) 7.9625*10 power 5 Daltons
    following parental DNA bases sequences:
    5) 700 Amino acids
    5’
    T A A C T C A A G G A C A T A G C C A A T T 3’
    3’AUUGAGUUCCUGUACGGUUAA’5……………………………
    …………………………………………..
    Calculate the percentage of adenine and thymine in the region of RNA
    molecule.
    Adenine is 20%
    Thymine is 0%

    Problem 3. The DNA fragment is 510 nm long. How many nitrogenous


    bases are there?
    Solving:
    150 base pairs=300 bases

    Date Signature

    You might also like